Abstract
The role of flagella and motility in the attachment of the foodborne pathogen Listeria monocytogenes to various surfaces is mixed with some systems requiring flagella for an interaction and others needing only motility for cells to get to the surface. In nature this bacterium is a saprophyte and contaminated produce is an avenue for infection. Previous studies have documented the ability of this organism to attach to and colonize plant tissue. Motility mutants were generated in three wild type strains of L. monocytogenes by deleting either flaA, the gene encoding flagellin, or motAB, genes encoding part of the flagellar motor, and tested for both the ability to colonize sprouts and for the fitness of that colonization. The motAB mutants were not affected in the colonization of alfalfa, radish, and broccoli sprouts; however, some of the flaA mutants showed reduced colonization ability. The best colonizing wild type strain was reduced in colonization on all three sprout types as a result of a flaA deletion. A mutant in another background was only affected on alfalfa. The third, a poor alfalfa colonizer was not affected in colonization ability by any of the deletions. Fitness of colonization was measured in experiments of competition between mixtures of mutant and parent strains on sprouts. Here the flaA and motAB mutants of the three strain backgrounds were impaired in fitness of colonization of alfalfa and radish sprouts, and one strain background showed reduced fitness of both mutant types on broccoli sprouts. Together these data indicate a role for flagella for some strains to physically colonize some plants, while the fitness of that colonization is positively affected by motility in almost all cases.
Introduction
Listeria monocytogenes is a Gram-positive, saprophytic, soil bacterium that can become associated with food including fresh produce. When ingested, it can cause systemic foodborne illness in susceptible populations such as the elderly, the immunocompromised, pregnant women, and neonates with a fatality rate of approximately 25% [1]. While the lifestyle and physiology of L. monocytogenes as it relates to virulence is well studied [2], [3], less well understood is the physiology and molecular determinants important for interactions with plants. Surveys have detected L. monocytogenes on supermarket produce, including sprouts, and outbreaks have originated from contaminated produce and alfalfa tablets [4]–[7]. Previous work with the colonization of alfalfa sprouts showed that L. monocytogenes had strain-specific colonization of alfalfa that reflected differences in attachment of the cells to the sprouts [8]. Extension of that work into broccoli and radish sprouts showed that many L. monocytogenes strains were capable of colonizing all three sprout types to varying abilities, and that colonization was at least somewhat dependent on a strain's ability to withstand oxidative stress, but not acid stress [9].
Cell surface features such as pili, fimbriae, and flagella can be used by bacteria to attach to various surfaces [10], [11]. Pili and fimbriae have not been described for L. monocytogenes. In general flagella may be used directly for attachment and colonization as an adhesin, or indirectly to provide movement of the cell to the surface to be colonized. Depending on the surface L. monocytogenes uses flagella in both direct and indirect ways for attachment and colonization to different surfaces. Motility is necessary for L. monocytogenes host cell invasion in tissue culture, but flagella themselves are not used as adhesins in that environment [12], [13]. Motility, and not the presence of flagella contribute to colonization of the gastrointestinal tract in mice [13]. Also, motility and not flagella per se were shown to be important for biofilm formation on polyvinyl chloride, glass, and stainless steel surfaces [14], [15]. However, in a previous study flagella were shown to act as means of attachment for L. monocytogenes to stainless steel [16]. The conflicting data suggest that strain background, nutrient environment, and the type of surface may play a role in the use of flagella for attachment. Adhesin studies with L. monocytogenes and surfaces have included work in tissue culture, animal models, and in vitro surfaces.
Previous work in our lab indicates that flagellar motility is needed for L. monocytogenes to attach to fresh cut radishes, [17], but that study did not differentiate between motility or the presence of flagella. That work was done on cut plant tissue over the course of a few hours. Colonization of intact, growing plant tissue involves not only adherence to the plant surface by the bacteria, but also growth on that surface over time via substrates present in the plant. Not all plants would be expected to provide the same environment for colonizing bacteria. The aim of the present study was to determine via mutant analysis if flagella and/or motility played roles in the colonization of sprouts by L. monocytogenes. Sprouts provide a simple system for assaying colonization by bacteria since they grow within a few days, the plant type can be easily varied, and they provide root and leaf environments for attachment and colonization. Three wild type L. monocytogenes strains were selected for this study, and they were chosen based on their abilities to colonize alfalfa, radish, and broccoli sprouts at high, medium, and low levels [8], [9]. In the three strains, markerless deletion mutants were generated in flaA, which encodes flagellin, the structural subunit for flagella, and motAB, which encodes part of the flagella motor. Both types of mutants should be non-motile; however, the motAB mutant should contain intact, yet non-functional flagella, effectively divorcing the presence of flagella from the process of motility. Thus, if flagella were important for colonization, and motility less so, a motAB mutant might not be affected in colonization. All of these strains were screened for their ability to colonize alfalfa, radish, and broccoli sprouts as well as their fitness for that colonization.
Results
Construction of flaA and motAB deletion mutants
Sequence analysis of the deletion constructs confirmed that 805 bp (93%) of the flaA gene were removed with the first 7 nucleotides intact before the deletion, resulting in an out of frame mutation. The flaA gene is monocistronic [18]–[20]. For motAB, 658 bp were removed from the middle to the end of the motA gene, leaving the first 52 amino acids of motA intact, and resulting in a deletion of 83% of motA. This was an out of frame deletion that also overlapped the translational start site for motB. Any product made from this construct would be nonsense.
To determine if these mutants behaved as motility mutants, they were tested in soft agar to determine the amount of colony spread (Figure 1), and they were observed microscopically both in wet mounts and after flagellar staining (Figure 2). In motility agar all of the ΔflaA and ΔmotAB mutants displayed small colony spreading phenotypes, indicating a lack of motility. Furthermore, all of the mutants were non-motile in wet mounts observed under the phase contrast microscope. Observations after flagellar staining showed that none of the ΔflaA mutants had visible flagella on their cell surfaces; whereas all of the wild types and the ΔmotAB mutant strains did. These data indicate that the ΔflaA mutants were non-motile due to a lack of flagella, and the ΔmotAB mutants were non-motile due to non-functional, but present flagella. Complementation of all the ΔflaA and ΔmotAB mutants with a plasmid carrying the wild type gene in trans resulted in motile phenotypes (data not shown).
Figure 1. Colony spread of strains in soft agar.
Strains were toothpicked onto BHI+0.4% agar, and grown at 30°C. Row 1 contains strains in the 10403 background, Row 2 contains strains in the RM2387 background, and Row 3 contains strains in the RM2992 background.
Figure 2. Flagellar stains of wild type and mutant strains.
Some flagella are indicated by arrows. Shown are representative panels from the three different strain backgrounds: Row A) 10403 strain background, Row B) RM2387 strain background, Row C) RM2992 strain background. All micrographs were taken at 1000× magnification.
Sprout colonization
Seeds were inoculated at Day 0 by exposure to a suspension of L. monocytogenes in water for 1 h after which the inoculum was removed. Sampling of the sprouts began at Day 1, and results shown for Days 1 and 3 (Table 1) reflect the number of CFU that grew on and attached to the sprouts from that initial seed inoculation. The broad range of alfalfa colonization that was previously reported for these three wild type strains [8] was confirmed with RM2992 being a poor colonizer, 10403 a mid-level colonizer, and RM2387 a very good colonizer reaching levels of 5 log CFU/sprout. Furthermore the levels of colonization for the wild type strains on radish and broccoli also agreed with previous experiments [9].
Table 1. Number (log CFU/sprout) of the different L. monocytogenes on sprouts after 1 and 3 days of growth.
| Strain | Alfalfa | Radish | Broccoli | |||
| Day 1 | Day 3 | Day 1 | Day 3 | Day 1 | Day 3 | |
| 10403 wild type | 0.6±0.6 Aa | 2.5±1.5 A | 4.0±0.8 A | 5.5±0.5 A | 2.0±1.1 A | 4.5±0.3 A |
| 10403ΔflaA | 0.3±0.3 A | 1.0±0.8 B | 3.9±0.9 A | 5.4±0.2 A | 1.8±1.3 A | 4.7±0.6 A |
| 10403ΔmotAB | 0.6±0.6 A | 2.8±0.7 A | 3.7±1.1 A | 5.0±0.4 A | 2.2±1.1 A | 4.5±0.2 A |
| RM2387 wild type | 1.4±0.9 A | 5.1±0.4 A | 4.7±0.7 A | 6.7±0.3 A | 2.5±0.6 A | 5.1±0.5 A |
| RM2387ΔflaA | 0.07±0.07 A | 2.4±1.0 B | 3.5±1.0 B | 5.6±0.2 B | 1.1±0.7 B | 4.6±0.2 A |
| RM2387ΔmotAB | 0.25±0.25 A | 4.0±1.1 A | 4.7±0.8 A | 6.7±0.5 A | 2.6±0.6 A | 5.1±0.4 A |
| RM2992 wild type | 0.2±0.2 A | 0.6±1.0 A | 3.9±0.8 A | 5.3±0.3 A | 1.1±1.0 A | 3.9±0.6 AB |
| RM2992ΔflaA | 0.2±0.2 A | 0.7±0.5 A | 3.7±0.7 A | 5.2±0.4 A | 0.6±0.5 A | 3.1±0.6 A |
| RM2992ΔmotAB | 0.2±0.2 A | 1.1±1.1 A | 3.6±0.5 A | 5.6±0.3 A | 0.9±0.8 A | 4.3±0.6 B |
For each set of parent and isogenic mutant strains within a column, numbers followed by the same letter are not statistically different, and a different letter indicates a statistical difference.
As for the motility mutants, none of the ΔmotAB mutants showed any difference in colonization from their parent strains when tested in single culture. However, some of the ΔflaA mutants were reduced in colonization on some sprout types. Strain 10403ΔflaA was reduced in colonization by Day 3 by over 1 log CFU/sprout from the 10403 parent (P<0.01) only on alfalfa. RM2387ΔflaA was reduced in sprout colonization on all the sprout types when compared with its parent. It had a 3 log reduction by Day 3 on alfalfa (P<0.0001), a one log reduction on Days 1 and 3 on radish (P<0.01), and over a one log reduction on broccoli on Day 1 (P<0.01), which was overcome by Day 3 when it was equivalent to the parent strain. For strain RM2992 there were no significant differences for any of the mutant strains from their wild type parent strains.
The ΔflaA strains that had phenotypes on sprouts were complemented with copies of their parent flaA genes in trans (Table 2). Complementation experiments in this system were somewhat problematic. Antibiotics added to the sprouting system led to wildly variable colonization levels, so the experiments were run without antibiotic selection. There is some plasmid loss without antibiotic selection, so colonization levels similar to the parent strains would not be expected due to variable expression of the complement plasmid. Expression of flaA in trans in both 10403ΔflaA and RM2387ΔflaA complemented some defects. Specifically 10403ΔflaA on alfalfa was complemented by Day 3 (P<0.0001), as was RM2387ΔflaA on alfalfa and radish by Day 3 (P<0.05) in comparison to the vector control strains. The colonization defects of RM2387ΔflaA on alfalfa and radish on Day 1 were not complemented, but the vector controls showed higher values than their non-plasmid carrying counterparts. However the RM2387ΔflaA complemented strain on broccoli was rescued on Day 1 (P<0.02). The flaA gene from RM2387 was placed into strains 10403ΔflaA and RM2992ΔflaA to see if they enhanced colonization by those mutant strains, and no enhancement was seen (data not shown). None of the mutants or their complements had any growth kinetic defects in complex media when compared to their control strains.
Table 2. Complementation of affected flaA mutants on sprouts.
| Strain | Alfalfa | Radish | Broccoli | |||
| Day 1 | Day 3 | Day 1 | Day 3 | Day 1 | Day 3 | |
| 10403ΔflaA+vector | 2.0±0.6 Ab | 2.7±0.1 A | NDa | ND | ND | ND |
| 10403ΔflaA+flaA | 2.0±1.0 A | 3.2±0.1 B | ND | ND | ND | ND |
| RM2387ΔflaA+vector | 1.7±1.0 A | 4.2±0.1 A | 4.5±0.1 A | 5.6±0.3 A | 1.5±0.7 A | 4.7±0.2 A |
| RM2387ΔflaA+flaA | 0.8±0.8 A | 5.0±0.1 B | 4.5±0.1 A | 6.3±0.3 B | 2.3±0.1 B | 4.6±0.6 A |
Number (log CFU/sprout) on sprouts after 1 and 3 days of growth.
Not Done (because the flaA mutants had no phenotype on sprouts).
For each set of parent and isogenic mutant strains within a column, numbers followed by the same letter are not statistically different, and a different letter indicates a statistical difference.
Fitness of sprout colonization
Mutant strains that displayed no statistical difference from their parent strains when tested for sprout colonization in single culture were tested in 1∶1 mixtures with the parent strains to determine if there were any differences in fitness of colonization. The RM2992 strains were not tested on alfalfa due to the very low numbers of colonies that result. Table 3 presents the percent of each isogenic pairing that were non-motile after three days of growth with sprouts. A result of 50% indicates equal fitness between the parent and mutant strains. In all cases tested, the ΔflaA mutants competed poorly with the wild type strains, ranging from 4% recovery for 10403ΔflaA on radish sprouts to 11.5% recovery for RM2387ΔflaA on broccoli sprouts. The ΔmotAB mutants fared better in competition than did the ΔflaA:wild type pairings, but several of the ΔmotAB strains displayed reduced fitness on sprouts including 10403ΔmotAB on all sprout types, RM2387ΔmotAB on alfalfa and radish, and RM2992ΔmotAB on radish sprouts. However, both RM287ΔmotAB and RM2992ΔmotAB were as fit as their parent strains on broccoli sprouts. In the five instances where fitness was measured for both isogenic ΔflaA and ΔmotAB mutants, there were statistical differences between the non-motile strains in fitness only for the RM2387 and RM2992 backgrounds on broccoli with the ΔflaA mutants reduced in comparison with the ΔmotAB mutants by a factor of five.
Table 3. Percent Non-motile resulting from 1∶1 Competition between Wild Type and Mutant Strains on Sprouts after 3 days of Colonization.
| Strain | Alfalfa | Radish | Broccoli |
| 10403 : ΔflaA | NDa | 4.5±4.0 Ab | 10.0±6.7 A |
| 10403 : ΔmotAB | 36.6±12.5 | 14.9±8.3 A | 18.8±8.1 A |
| RM2387 : ΔflaA | ND | ND | 11.5±5.2 A |
| RM2387 : ΔmotAB | 31.5±9.1 | 26.4±8.2 | 54.9±14.1 B |
| RM2992 : ΔflaA | ND | 8.3±5.1 A | 10.5±5.6 A |
| RM2992 : ΔmotAB | ND | 19.0±5.9 A | 44.8±14.4 B |
Not Done.
For each set of parent and isogenic mutant strains within a column, numbers followed by the same letter are not statistically different, and a different letter indicates a statistical difference.
Sequence analysis of flaA alleles
The flaA alleles of the three wild type strains were amplified by PCR and sequenced to determine if differences in the single culture phenotypes of the different flaA mutants on sprouts could be explained by sequence differences in the alleles. Two independent PCR reactions were done for each flaA gene, and the duplicates were sequenced to ensure that no mutations were introduced during PCR. For all three the coding regions were 864 nucleotides long, which translates into a protein of 287 amino acids, and agrees with all other published sequence lengths of flaA from L. monocytogenes. The sequences of flaA in RM2387 and RM2992 were identical at both the DNA and protein level. The flaA gene from these two serotype 4b strains was also identical to the serotype 4b outbreak strain F2365 [20]. The DNA sequence of flaA for strain 10403 had 15 individual nucleotide changes in comparison with the others, but these changes translate into a one amino acid difference with a glutamine instead of a glutamate predicted at amino acid position 198.
Discussion
The three wild type L. monocytogenes strains were selected because of their demonstrated differing abilities to colonize alfalfa, radish, and broccoli sprouts [9]. Previous work indicated that motility played some role in plant attachment [17], but it was not clear whether that attachment was due to the presence of flagella or to the process of motility itself. In the present study the only mutants to display a colonization phenotype in single culture were ΔflaA mutants. This would seem to indicate that the presence of flagella and not motility is important for the colonization of some plant tissues by some L. monocytogenes. Additionally, fitness studies with wild type and isogenic mutants in co-culture with sprouts indicated that motility itself contributed toward fitness of colonization in some cases.
Flagella may play a more significant role in the colonization of alfalfa than the other plants since both strains capable of alfalfa colonization (10403 and RM2387) showed reductions in single strain colonization when there was no flaA expression (Table 1). Furthermore while the loss of flaA led to a reduction of colonization in the RM2387 background for all of the sprouts, the defect was most pronounced on alfalfa with a 3 log reduction compared to 1–2 log reductions for radish and broccoli. Of the three wild type strains, RM2387 was the most robust colonizer and only RM2387 showed defects with a flaA deletion on radish and broccoli sprouts. It is possible that the flagella of RM2387 possess traits that allow for better attachment and/or colonization to the plant surface. The deletion of flaA did not obliterate colonization for any strain, so while flagella may be necessary for some strains to colonize some plants, they are not the only bacterial factor playing a role in the interaction. We added the flaA gene from RM2387 to both 10403ΔflaA and RM2992ΔflaA to see if colonization ability would be enhanced in the latter two strains, but it was not, suggesting that it is not the product of the flaA gene itself that helps to determine colonization, but possibly additional factors, including some that may be decorating the flagella. The fact that there were no sequence differences between the flaA genes of RM2387 and RM2992 is further support of this.
Other explanations for the high colonization ability of RM2387 are the potential presence of additional colonization factors not present in the other strains, and that its flagellar complement may be larger than the others. Also the finding that the RM2992 wild type was equivalent to both its ΔflaA and ΔmotAB mutants for sprout colonization could indicate that RM2992 does not make flagella in this system. Attempts to assess expression of flaA in the sprout system were met with great technical difficulties due to the tightness of the interactions of the L. monocytogenes cells to the plant tissue and, with RM2992, very few cells present on the plant tissue so that RNA could not be isolated. However, the finding that the non-motile RM2992 mutants did show phenotypes in the experiments measuring fitness of colonization (Table 3) implies that this strain did produce flagella in the system.
While motility itself was not needed for colonization in single culture the data from the competition experiments showed that it contributed to the fitness of colonization (Table 3). Fitness was reduced in almost all the ΔmotAB strains, and these reductions were statistically similar to the reductions in fitness by isogenic ΔflaA mutants in most cases when both were tested. Fitness was not assessed in mutants that displayed a colonization defect in single culture as those ΔflaA mutants were obviously not competitive with the wild type. Fitness for colonization of alfalfa and radish sprouts by all three strains required motility for full efficiency; however, full motility played a role in fitness for broccoli colonization only in the 10403 strain background. RM2387ΔmotAB and RM2992ΔmotAB had wild type fitness on broccoli.
Previous studies demonstrate that L. monocytogenes preferentially colonizes the roots of these sprouts [8], [9]. The literature regarding the use of flagella for attachment to plant roots is mixed, and can vary among different plants and bacteria. In the colonization of various plants by Pseudomonas spp., flagella, motility, and chemotaxis are important some for plant attachment and/or colonization [21], and non-motile mutants were defective in the colonization of tomato and potato roots, [22]–[24]. Martínez-Granero et al [25] showed that highly motile variants of P. fluorescens were enhanced in the ability to colonize alfalfa roots over strains with normal motility, but this study did not address if it was motility or the presence of flagella that were important for the enhanced colonization. However in other studies some motility mutants of Pseudomonas species, were not defective in root colonization of wheat and soybean [26], [27], Flagella are important for colonization and attachment of Azospirillum brasilense to wheat roots [28]. Root exudates from lettuce induce Salmonella enterica to chemotax toward the roots, and is thought to positively influence plant colonization efficiency [29]. Flagella-minus, non-motile mutants of Salmonella enterica Senftenberg were defective in attachment to basil leaves [30].
Since RM2387 and RM2992 had identical sequences, the difference in single culture sprout colonization by these two serotype 4b strains cannot be explained by the sequence of the flagellin protein. However, the flagellin protein in L. monocytogenes is post-translationally modified by glycosylation [31]. It is possible that the differences in colonization seen by the three wild type strains, and the differential contribution of flagella to that colonization among the strains is caused by chemical modifications on the flagella structures. The bacterial strains may also have differential expression of other adhesin factors that are not related to motility. Plant lectins may also contribute to the attachment and colonization process, as it does in other bacteria such as Rhizobium [32], and L. monocytogenes does react to different plant lectins in a strain-specific fashion [33], [34]. Plant factors and attachment sites may also account for fitness differences seen among the strains, especially with broccoli sprouts.
The role of flagella and motility in the L. monocytogenes-plant system differs from that seen in the L. monocytogenes culture with animal cells where motility and not flagella is important for invasion of tissue culture cells. L. monocytogenes ΔflaA mutants are defective in the invasion of tissue culture cells but not in cell-to-cell spread [12]. O'Neil and Marquis [13] demonstrated that the defect in tissue culture cell invasion was due to a lack of motility and not a lack of flagella, because a motB mutant was as deficient in invasion as a ΔflaA mutant. This means that flagella do not act as attachment factors for tissue culture cells. Similarly motility, but not flagella per se were shown to be important for biofilm formation by L. monocytogenes in both static and flow cell biofilm systems [14], [15]. However, flagella do play a role in the attachment of L. monocytogenes to stainless steel [16]. In the colonization of plants, the role of motility and flagella may be more complicated. The contributions of flagella and motility by L. monocytogenes to colonization were dependent upon the strain and the plant. In general, motility played a role in fitness for sprout colonization. In some strains the presence of flagella itself was a determinant for colonization, indicating a direct role for flagella in part of the colonization process for some strains on some plants. It is likely that contributions from chemotaxis and attachment via flagella are needed in some systems for full colonization ability by L. monocytogenes, and further study of plant attractants and attachment sites is required to determine the exact role of each in the system.
Materials and Methods
L. monocytogenes strains, plasmids, media, and culture conditions
The strains used in this study are listed in Table 4. Deletion mutants of flaA and motAB were constructed in three L. monocytogenes wild type strain backgrounds. Routinely, strains were grown in TSYE medium (Tryptic Soy Broth without dextrose+0.6% yeast extract, Difco, Becton Dickinson, Franklin Lakes, NJ) or Brain Heart Infusion Medium (BHI, Difco) at 30°C. Modified Oxford Agar (MOX, Difco, Becton Dickinson, Franklin Lakes, NJ), which inhibits most Gram-negative bacteria, as well as many Gram-positives, was used to selectively grow L. monocytogenes from inoculated seeds/sprouts. Escherichia coli strains were grown on Luria Broth or Luria Agar (LB, Difco). Deletion constructs were made in pAUL-A [35], which was maintained in Escherichia coli with erythromycin (300 µg/ml), and in L. monocytogenes with erythromycin (1 µg/ml) and lincomycin (25 µg/ml). Complementation plasmids were constructed in pAT18 [36], which was maintained in both E. coli and L. monocytogenes with the same antibiotics used for pAUL-A. Phosphate buffered saline (PBS) contained 150 mM NaCl and 10 mM sodium phosphate (pH 7.2).
Table 4. Strains used in this study.
| Strain | Description | Source or reference |
| L. monocytogenes | ||
| 10403 | Serotype 1/2a, animal isolate | D. Portnoy, UC Berkeley |
| RM5708 | 10403, ΔflaA | This study |
| RM4493 | 10403, ΔmotAB | This study |
| RM2387 | Serotype 4b, mint isolate | [17] |
| RM5345 | RM2387, ΔflaA | This study |
| RM4494 | RM2387, ΔmotAB | This study |
| RM2992 | Serotype 4b, cucumber isoate | M. Borucki, USDA, ARS |
| RM5346 | RM2992, ΔflaA | This study |
| RM4720 | RM2992, ΔmotAB | This study |
| E. coli | ||
| DH10B | Cloning Strain | |
Construction of mutants
The flaA and motAB genes were cloned from each of the three wild type strains' chromosomes using primers that were designed against the L. monocytogenes EGD-e genome sequence [19]. The primer sequences are in Table 5. BamHI or KpnI restriction sites were engineered into the primers to facilitate cloning. PCR was performed with the Expand High Fidelity PCR kit (Roche, Indianapolis, IN) and cloned into the vector pDrive using the Qiagen PCR cloning kit (Qiagen, Inc., Valencia, CA) or the vetor pCR2.1 using the Invitrogen TOPO TA cloning kit (Invitrogen Corp., Carlsbad, CA). The genome regions were then subcloned into pAUL-A, a shuttle vector used for allelic exchange in L. monocytogenes [35]. Markerless deletion mutants were constructed in the flaA and motAB genes using inverse PCR with primers that had restriction sites engineered into the 5′ ends. The central portion of the genes were deleted using inverse PCR with the Expand Long Template PCR kit (Roche) using internal primers in which restriction sites were engineered into the 5′ ends. The resulting amplicons were cut with the restriction enzymes in the deletion primers, self-ligated, electroporated into E. coli DH10B, and selected on LB+erythromycin agar. The sequence of the deletion constructs was confirmed by sequencing on an ABI Prism 3130×l DNA Analyzer, using Big Dye Terminator v. 3.1 chemistry (Applied Biosystems, Foster City, CA). The deletion plasmids were electroporated into each of the three wild type strains of L. monocytogenes [8] and selected on BHI agar with erythromycin and lincomycin. Allelic exchange was done as described except that erythromycin and lincomycin were used instead of just erythromycin [37]. The physical structure of the chromosomal deletions in the mutants was confirmed by PCR using the primers used to originally amplify the genome regions from the L. monocytogenes wild type strains, and comparing the sizes of the products to the wild type clones and the deletion constructs.
Table 5. PCR primers used in this study.
| Gene and purpose | Primer Name | Primer sequence (5′→3′) | Restriction sitea |
| flaA cloning | flaA PCR for | GCGGATCCGCAACGATCCGCAATGTCTTCC | BamHI |
| flaA PCR rev | GCGGATCCACTTCCGTATCTGCGCCTTCAATCACTAAA | ||
| flaA deletion | fla002 | AAAGCTCGAGCTTCTCAAGCAAACCAAACACC | XhoI |
| fla400 | AAAGCTCGAGCTTTCATTTGTGTTTCCCTCCTAC | ||
| motAB cloning | cheR K for | TGGGTACCCAAGCTATATTACGAACCGCGAC | KpnI |
| che R K rev | CTGGTACCGGATAAAAACGGCTCTGGCAAAC | ||
| motAB deletion | mot002 | ATAGATCTGGGTGCGCCATCATAACAGC | BglII |
| mot101 | CGAGATCTGCCAAGCGTCGCAAGAAACC |
Restriction site in primer is underlined.
Complementation plasmids were constructed in pAT18 [36] using the cloned flaA genes from both 10403 and RM2387, and the motAB operon from 10403.
Flagellar staining and assessment of motility
Motility was assessed microscopically in wet mounts on cultures grown overnight at 30°C in BHI broth, and by monitoring colony spread on BHI+0.4% agar plates grown overnight at 30°C. Flagellar staining was done using Becton-Dickinson flagella stain (Becton-Dickinson), following the manufacturer's instructions with the exception that the cultures were grown on trypticase soy agar with 5% sheep blood at 30°C.
DNA Sequence Analysis
The flaA genes from all three wild type strains were PCR amplified with the Expand High Fidelity PCR kit (Roche), sequenced, and compared. DNA sequences were assembled and analyzed with DNA Star (DNA Star, Madison, WI). Two separate PCR reactions were done for each flaA allele, and were sequenced independently to ensure that mutations were not introduced during PCR. The GenBank accession numbers for the three flaA sequences are FJ234181 for 10403 flaA, FJ234182 for RM2387 flaA, and FJ234183 for RM2992 flaA.
Assay for growth of L. monocytogenes on sprouts
Alfalfa seeds were purchased from International Specialty Supply (Cookeville, TN), and radish and broccoli seeds were purchased from The Sproutpeople (Poulsboro, WA). Seeds were sanitized with Ca(OCl)2 as described, and washed and soaked for 4 h in 100×15 mm Petri dishes containing sterile water to remove the disinfectant 8, 9. After soaking, alfalfa, radish, and broccoli seeds were inoculated with strains of L. monocytogenes as previously described [8]. Briefly, 20 ml of an aqueous cell suspension of L. monocytogenes (104 CFU/ml) was added to the seeds in Petri dishes, and incubated at room temperature on a rotating shaker (The Belly Dancer, Stovall Life Science, Greenboro, NC) for 1 h. The cell suspension was removed and replaced with sterile water. The seeds were then incubated and sprouted at room temperature on the rotating shaker for three days. Each day, the irrigation water was removed and replaced with sterile water. Sprout sampling was done within 30 minutes of these water changes. At these time points, sprouts were placed into 300 µl of PBS, and homogenized using a sample pestle (Scienceware™, BelArt #F19922-0001) attached to a cordless rotary tool (Dremel, Racine, WI) set at 7500 rpm for 2–3 seconds. The suspension was dilution plated onto MOX agar, and the plates incubated at 30°C for two days. L. monocytogenes colonies are characteristically bluish-white on this selective and differential medium, which inhibits the growth of most Gram-negative bacteria.
Competition experiments
Mutants displaying no phenotype when tested for sprout colonization in single culture were tested in competition with the wild type after three days of sprout colonization to assess fitness of colonization. Strains were mixed in a 1∶1 combination before inoculation of seeds as described above. Inoculating suspensions were dilution plated onto BHI agar to confirm that the ratio was 1∶1. Each experiment used three separate dishes of each sprout. Irrigation water was changed daily, and three sprouts were sampled per dish, crushed, and dilution plated on MOX on Day 3. MOX plates were incubated, and 96 colonies from each sprout plating were picked at random and transferred individually with a sterile toothpick into a well of a 96 well microtitre plate that contained BHI+0.4% agar. These microtitre plates were incubated at 30°C overnight. The numbers of motile and non-motile colonies were counted and the percentage non-motile of the total was calculated.
Statistics
All sprout colonization experiments were conducted at least four times with at least three replicates and two separate cultures for each. Data is presented as the average of all experiments with standard deviation. GraphPad Prism version 5.01 (GraphPad Software, San Diego, CA) was used for statistical analysis. Two Way ANOVA with Bonferroni post tests or unpaired t-tests with Welch correction were performed on the sprout colonization data to compare the results for the mutant strains with their wild type parent strains and complemented strains to vector control strains to determine statistical differences. Statistical differences in fitness between isogenic ΔflaA and ΔmotAB strains were determined by the Kruskal-Wallis test with Dunn's Multiple Comparison post-test.
GenBank Accession Numbers for sequences presented in this paper: FJ234181, FJ234182, FJ234183
Acknowledgments
We thank K. Nguyen, A. Liang, and C. Clark for technical assistance. We thank P. Courvalin for the gift of pAT18. We thank J. Palumbo for advice and careful reading of the manuscript.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This research was funded by the U.S. Department of Agriculture (Agricultural Research Service CRIS project number 5325-42000-044-00D). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, et al. Food-related illness and death in the United States. Emerging Infectious Diseases. 1999;5:607–625. doi: 10.3201/eid0505.990502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Vázquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Domínguez-Bernal G, et al. Listeria pathogenesis and molecular virulence determinants. Clinical Microbiology Reviews. 2001;14:584–640. doi: 10.1128/CMR.14.3.584-640.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dussurget O, Pizzaro-Cerda J, Cossart P. Molecular determinants of Listeria monocytogenes virulence. Annual Review of Microbiology. 2004;58:587–610. doi: 10.1146/annurev.micro.57.030502.090934. [DOI] [PubMed] [Google Scholar]
- 4.Heisick JE, Wagner DE, Nierman ML, Peeler JT. Listeria spp. found on fresh market produce. Applied and Environmental Microbiology. 1989;55:1925–1927. doi: 10.1128/aem.55.8.1925-1927.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schlech WFI, Lavigne PM, Bortolussi RA, Allen AC, Haldane EV, et al. Epidemic listeriosis-evidence for transmission by food. The New England Journal of Medicine. 1983;308:203–206. doi: 10.1056/NEJM198301273080407. [DOI] [PubMed] [Google Scholar]
- 6.Farber JM, Carter AO, Varughese PV, Ashton FE, Ewan EP. Listeriosis traced to the consumption of alfalfa tablets and soft cheese. New England Journal of Medicine. 1990;322:338. doi: 10.1056/nejm199002013220519. [DOI] [PubMed] [Google Scholar]
- 7.Strapp CM, Shearer AEH, Joerger RD. Survey of retail alfalfa sprouts and mushrooms for the presence of Escherichia coli O157:H7, Salmonella, and Listeria with BAX, and evaluation of this polymerase chain reaction-based system with experimentally contaminated samples. Journal of Food Protection. 2003;66:182–187. doi: 10.4315/0362-028x-66.2.182. [DOI] [PubMed] [Google Scholar]
- 8.Gorski L, Palumbo JD, Nguyen KD. Strain-specific differences in the attachment of Listeria monocytogenes to alfalfa sprouts. Journal of Food Protection. 2004;67:2488–2495. doi: 10.4315/0362-028x-67.11.2488. [DOI] [PubMed] [Google Scholar]
- 9.Gorski L, Flaherty D, Duhé JM. Comparison of the stress response of Listeria monocytogenes strains with sprout colonization. Journal of Food Protection. 2008;71:1556–1562. doi: 10.4315/0362-028x-71.8.1556. [DOI] [PubMed] [Google Scholar]
- 10.Merritt PM, Danhorn T, Fuqua C. Motility and chemotaxis in Agrobacterium tumefaciens surface attachment and biofilm formation. Journal of Bacteriology. 2007;189:8005–8014. doi: 10.1128/JB.00566-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fernàndez LA, Berenguer J. Secretion and assembly of regular surface structures in Gram-negative bacteria. FEMS Microbiology Reviews. 2000;24:21–44. doi: 10.1111/j.1574-6976.2000.tb00531.x. [DOI] [PubMed] [Google Scholar]
- 12.Dons L, Eriksson E, Jin Y, Rottenberg ME, Kristensson K, et al. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infection and Immunity. 2004;72:3237–3244. doi: 10.1128/IAI.72.6.3237-3244.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.O'Neil HS, Marquis H. Listeria monocytogenes flagella are used for motility, not as adhesins, to increase host cell invasion. Infection and Immunity. 2006;74:6675–6681. doi: 10.1128/IAI.00886-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lemon KP, Higgins DE, Kolter R. Flagellar motility is critical for Listeria monocytogenes biofilm formation. Journal of Bacteriology. 2007;189:4418–4424. doi: 10.1128/JB.01967-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Todhanakasem T, Young GM. Loss of flagellum-based motility by Listeria monocytogenes results in formation of hyperbiofilms. Journal of Bacteriology. 2008;190:6030–6034. doi: 10.1128/JB.00155-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Vatanyoopaisarn S, Nazli A, Dodd CER, Rees CED, Waites WM. Effect of flagella in initial attachment of Listeria monocytogenes to stainless steel. Applied and Environmental Microbiology. 2000;66:860–863. doi: 10.1128/aem.66.2.860-863.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gorski L, Palumbo JD, Mandrell RE. Attachment of Listeria monocytogenes to radish tissue is dependent upon temperature and flagellar motility. Applied and Environmental Microbiology. 2003;69:258–266. doi: 10.1128/AEM.69.1.258-266.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dons L, Rasmussen OF, Olsen JE. Cloning and characterization of a gene encoding flagellin of Listeria monocytogenes. Molecular Microbiology. 1992;6:2919–2929. doi: 10.1111/j.1365-2958.1992.tb01751.x. [DOI] [PubMed] [Google Scholar]
- 19.Glaser P, Frangeul L, Buchrieser C, Rusniok C, Amend A, et al. Comparative genomics of Listeria species. Science. 2001;294:849–852. doi: 10.1126/science.1063447. [DOI] [PubMed] [Google Scholar]
- 20.Nelson KE, Fouts DE, Mongodin EF, Ravel J, DeBoy RT, et al. Whole genome comparisons of serotype 4b and 1/2a strains of the food-borne pathogen Listeria monocytogenes reveal new insights into the core genome components of this species. Nucleic Acids Research. 2004;32:2386–2395. doi: 10.1093/nar/gkh562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lugtenberg BJJ, Dekkers L, Bloemberg GV. Molecular determinants of rhizosphere colonization by pseudomonads. Annual Review of Phytopathology. 2001;39:461–490. doi: 10.1146/annurev.phyto.39.1.461. [DOI] [PubMed] [Google Scholar]
- 22.de Weger LA, van der Vlugt CIM, Wijfjes AHM, Bakker PAHM, Schippers B, et al. Flagella of a plant growth stimulating Pseudomonas fluorescens strain are required for colonization of potato roots. Journal of Bacteriology. 1987;169:2769–2773. doi: 10.1128/jb.169.6.2769-2773.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Chin-A-Woeng TFC, Bloemberg GV, Mulders IHM, Dekkers LC, Lugtenberg BJJ. Root colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. Molecular Plant-Microbe Interactions. 2000;13:1340–1345. doi: 10.1094/MPMI.2000.13.12.1340. [DOI] [PubMed] [Google Scholar]
- 24.Dekkers LC, van der Bij AJ, Mulders IHM, Phoelich CC, Wentwoord RAR, et al. Role of the O-antigen of lipopolysaccharide, and possible roles of growth rate and of NADH:ubiquinone oxidoreductase (nuo) in competitive tomato root-tip colonization by Pseudomonas fluorescens WCS365. Molecular Plant-Microbe Interactions. 1998;11:763–771. doi: 10.1094/MPMI.1998.11.8.763. [DOI] [PubMed] [Google Scholar]
- 25.Martínez-Granero M, Rivilla R, Martín M. Rhizosphere selection of highly motile phenotypic variants of Pseudomonas fluorescens with enhanced competitive colonization ability. Applied and Environmental Microbiology. 2006;72:3429–3434. doi: 10.1128/AEM.72.5.3429-3434.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Scher FM, Kloepper JW, Singleton C, Zaleska I, Laliberte M. Colonization of soybean roots by Pseudomonas and Serratia species: relationship to bacterial motility, chemotaxis and generation time. Phytopathology. 1988;78:1055–1059. [Google Scholar]
- 27.Howie WJ, Cook RJ, Weller DM. Effects of soil matric potential and cell motility on wheat root colonization by fluorescent pseudomonads suppresive to take-all. Phytopathology. 1987;77:286–292. [Google Scholar]
- 28.Croes C, Moens S, Van Bastelaere E, Vanderleyden J, Michiels K. The polar flagellum mediates Azosprillum brasilense adsorption to wheat roots. Journal of General Microbiology. 1993;139:2261–2269. [Google Scholar]
- 29.Klerks MM, Franz E, Van Gent-Pelzer M, Zijlstra C, Van Bruggen AHC. Differential iteraction of Salmonella enterica serovars wtih lettuce cultivars and plant-microbe factors influencing the colonization efficiency. The ISME Journal. 2007;1:620–631. doi: 10.1038/ismej.2007.82. [DOI] [PubMed] [Google Scholar]
- 30.Berger CN, Shaw RK, Brown DJ, Mather H, Clare S, et al. Interaction of Salmonella enterica with basil and other salad leaves. The ISME Journal. 2009;3:261–265. doi: 10.1038/ismej.2008.95. [DOI] [PubMed] [Google Scholar]
- 31.Schirm M, Kalmokoff M, Aubry A, Thibault P, Sandoz M, et al. Flagellin from Listeria monocytogenes is glycosylated with ß-O-linked N-acetylglucosamine. Journal of Bacteriology. 2004;186:6721–6727. doi: 10.1128/JB.186.20.6721-6727.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hirsch AM. Role of lectins (and rhizobial exopolysaccharides) in legume nodulation. Current Opinion in Plant Biology. 1999;2:320–326. doi: 10.1016/S1369-5266(99)80056-9. [DOI] [PubMed] [Google Scholar]
- 33.Facinelli B, Giovanetti E, Casolari C, Varaldo PE. Interactions with lectins and agglutination profiles of clinical, food, and environmental isolates of Listeria. Journal of Clinical Microbiology. 1994;32:2929–2935. doi: 10.1128/jcm.32.12.2929-2935.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Facinelli B, Giovanetti E, Magi G, Biavasco F, Varaldo PE. Lectin reactivity and virulence among strains of Listeria monocytogenes determined in vitro using the enterocyte-like cell line Caco-2. Microbiology. 1998;144:109–118. doi: 10.1099/00221287-144-1-109. [DOI] [PubMed] [Google Scholar]
- 35.Schaferkordt S, Chakraborty T. Vector plasmid for insertional mutagenesis and directional cloning in Listeria spp. Biotechniques. 1995;19:720–725. [PubMed] [Google Scholar]
- 36.Triue-Cuot P, Carlier C, Poyart-Salmeron C, Courvalin P. Shuttle vectors containing a multiple cloning site and a lacZα gene for conjugal transfer of DNA from Escherichia coli to Gram-positive bacteria. Gene. 1991;102:99–104. doi: 10.1016/0378-1119(91)90546-n. [DOI] [PubMed] [Google Scholar]
- 37.Lingnau A, Domann E, Hudel M, Bock M, Nichterlein T, et al. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infection and Immunity. 1995;63:3896–3903. doi: 10.1128/iai.63.10.3896-3903.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]


