Skip to main content
NCBI home page
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2009 Mar 23;106(14):5913–5918. doi: 10.1073/pnas.0808716106

Glucocorticoid regulation of preproglucagon transcription and RNA stability during stress

Rong Zhang a,1, Benjamin A Packard a, Miyuki Tauchi a, David A D'Alessio a,b, James P Herman a,1
PMCID: PMC2667044  PMID: 19307579

Abstract

Stress elicits a synchronized response of the endocrine, sympathetic, and central nervous systems to preserve homeostasis and well-being. Glucagon-like peptide-1 (GLP-1), a primary posttranslational product of the preproglucagon (PPG) gene, activates both physical and psychological stress responses. The current study examined mechanisms regulating expression of PPG gene products in the hindbrain. Our results indicate that PPG mRNA decreases rapidly after exposure to acute stressors of multiple modalities. Reduced mRNA levels are accompanied by reduced GLP-1 immunoreactivity in the paraventricular nucleus of hypothalamus, suggesting release at PPG terminals. Stress-induced decrements in PPG mRNA were attenuated in adrenalectomized-corticosterone-replaced rats, suggesting that mRNA down-regulation is due at least in part to glucocorticoid secretion. In contrast, acute stress increased levels of PPG heteronuclear RNA (hnRNA) in a glucocorticoid-dependent manner, suggesting that decreases in PPG mRNA are due to increased degradation rather than reduced transcription. Glucocorticoid administration to unstressed rats is sufficient to cause decrements in PPG mRNA and increments in PPG hnRNA. These findings suggest that glucocorticoids deplete the pool of transcribed PPG mRNA and concurrently stimulate PPG gene transcription, with the latter allowing a mechanism for replenishment of PPG mRNA after stress cessation. The combination of rapid PPG mRNA depletion and initiation of PPG transcription within 30 min is consistent with a rapid action of glucocorticoids on GLP-1 bioavailability, resulting in a transient reduction in the capacity for neuropeptidergic excitation of stress responses.

Keywords: hypothalamo-pituitary-adrenal (HPA), glucagon-like peptide-1 (GLP-1), nucleus of the solitary tract (NTS)

Stress mobilizes endocrine, sympathetic, and behavioral systems to promote physiologic adaptation and maintain homeostasis (1–4). Prolonged exposure to stress severely taxes adaptive mechanisms, contributing to the development of a variety of psychiatric and somatic disorders (5, 6). Activation of the hypothalamo–pituitary–adrenal (HPA) axis is a primary stress-adaptive mechanism. Stressors activate release of corticotrophin-releasing hormone (CRH) by medial parvocellular paraventricular nucleus (mpPVN) neurons, which triggers pituitary release of ACTH and resultant secretion of glucocorticoids (7, 8). A substantial component of stressor-induced HPA axis activation is mediated by ascending neurons of the nucleus of the solitary tract (NTS) (9, 10), which project directly to CRH neurons in the mpPVN (11, 12).

Glucagon-like peptide-1 (GLP-1) is a product of posttranslational processing of preproglucagon (PPG). In the brain, GLP-1 synthesis is limited to selected neurons of the NTS and ventrolateral medulla in the brainstem (13–15). Central administration of GLP-1 is sufficient to activate the HPA axis, whereas central administration of a GLP-1 receptor antagonist inhibits HPA axis responses to both psychogenic and systemic stressors (10). Morphological studies indicate that GLP-1-containing neurons make synaptic contacts with CRH neurons in the PVN, indicating the potential for direct activation of the HPA axis (9). These data indicate that GLP-1 signaling is an important component of homeostatic adaptation after stress (16). Thus, bioavailability of GLP-1 is of potential importance in brain mechanisms of stress integration. In this study, we examined the expression of both PPG gene transcription and steady-state mRNA levels in the NTS after exposure to stress. Our data indicate rapid, glucocorticoid-dependent decrements in PPG mRNA expression after exposure of rats to either systemic or psychogenic stressors. Loss of mRNA is accompanied by protein depletion in the PVN and by increased PPG heteronuclear (hnRNA) expression in the NTS. The data are consistent with a glucocorticoid-initiated pause in GLP-1 bioavailability that may contribute to poststress recovery of HPA axis tone.

Results

PPG mRNA Expression Is Rapidly Decreased by Systemic and Psychogenic Stress Exposure.

Assessment of PPG mRNA expression was tested after LiCl exposure, which activates GLP-1-containing neurons in the NTS and triggers an HPA axis response (10, 17). In situ hybridization analysis of PPG mRNA revealed a rapid-onset decrease in NTS PPG mRNA (F(3,20) = 13.007, P < 0.05), with expression levels significantly lower than those of controls (0 min) at 30, 60, and 120 min after treatment (P < 0.05) (Fig. 1 A–E). There were significant effects of stress on both corticosterone (F(3,20) = 27.988, P < 0.05) and ACTH (F(3,20) = 15.820, P < 0.05) secretion (Fig. 1 F and G) along the same time frame as PPG mRNA down-regulation.

Fig. 1.

Fig. 1.

Open in a new tab

Representative images of PPG mRNA expression in NTS as assessed by in situ hybridization after i.p. injection of 0.15 M LiCl (2% bodyweight). (A–D) The results shown are for 0 (A), 30 (B), 60 (C), and 120 (D) min after injection. (E) Semiquantitative analysis revealed that PPG mRNA expression was decreased at 30, 60, and 120 min in NTS. (F) The plasma corticosterone response to i.p. LiCl injection was elevated at 30, 60, and 120 min compared with 0 min. The peak reached at 60 min after injection. Significant differences were detected between any of two groups. (G) The plasma ACTH response increased at 30 and 60 min and reached the maximum level at 30 min after injection of LiCl. *, P < 0.01 vs. control (n = 5–7 per group).

We then assessed expression of PPG mRNA after acute restraint or hypoxia by quantitative real-time RT-PCR. Our results (Fig. 2A) confirmed rapid decreases in PPG mRNA 30 min after either hypoxia (F(2,10) = 8.429, P < 0.05) or restraint (F(2,11) = 5.671, P < 0.05), consistent with the results observed by in situ hybridization. The magnitude of PPG mRNA reduction was similar after exposure to restraint or hypoxia. Reduced PPG mRNA again coincided with stress-induced increases in corticosterone (hypoxia: F(2,15) = 29.641, P < 0.05; restraint: F(2,14) = 23.699, P < 0.05) and ACTH (hypoxia: F(2,14) = 10.088, P < 0.05; restraint: F(2,14) = 11.398, P < 0.05) levels (Fig. 2 B and C). The peak and recovery levels of ACTH and corticosterone did not differ between the restraint and hypoxia groups suggesting that the two stressors were similar in intensity.

Fig. 2.

Fig. 2.

Open in a new tab

Quantitative real time RT-PCR analysis of the regulation of PPG mRNA expression in the NTS by acute stress exposure. (A) Expression of PPG mRNA rapidly decreased at 30 min after exposure to both systemic (8% hypoxia) and psychogenic (restraint) stress in NTS. (B) Both 8% hypoxia and restraint exposure increased the plasma corticosterone at 30 min after onset of the stress challenge. Levels remained elevated at 60 min in both hypoxia- and restraint-treated rats. (C) Plasma ACTH increased after onset of acute 30-min hypoxia at 8% and restraint challenge. *, P < 0.05 vs. previous time point (n = 5–6 per group).

PPG mRNA Expression Is Down-Regulated by Stress-Induced Glucocorticoid Secretion.

The temporal correspondence of peak corticosterone release and PPG mRNA led us to test the hypothesis that mRNA down-regulation was due to glucocorticoid secretion. Subcutaneous injection of corticosterone caused marked reduction of PPG gene expression in the NTS (F(3,15) = 3.941, P < 0.05) (Fig. 3A), mimicking the effects of stress induced by LiCl, restraint, or hypoxia. Plasma corticosterone increased in restraint 30-min treated rats compared to naive rats [data are shown as mean (ng/ml) ± SEM; naive: 15.01 ± 3.15; restraint 30 min: 836.44 ± 85.47]. Corticosterone administration (15 mg/kg) resulted in supraphysiological levels of corticosterone (Cort 30 min: 6,933.68 ± 412.17). The plasma corticosterone levels of vehicle-injected rats were slightly higher than resting basal levels (vehicle 30 min: 87.91 ± 15.51), but did not approach values seen after restraint or hypoxia.

Fig. 3.

Fig. 3.

Open in a new tab

Quantitative real time RT-PCR analysis of regulation of PPG gene expression in the NTS. (A) Subcutaneous injection of corticosterone (15 mg/kg) resulted in a down-regulation of PPG mRNA expression at 30 min when compared with vehicle (propylene glycol) injection. Acute restraint exposure decreased expression of PPG mRNA. (B) Acute restraint exposure rapidly decreased PPG mRNA expression in sham rats. There was no difference in the expression of PPG mRNA between unstressed ADX-Cort-replaced and restrained ADX-Cort-replaced rats. (C) Plasma corticosterone was elevated by restraint challenge only in sham rats. Acute stress challenge did not change plasma corticosterone in ADX-Cort-replaced rats. *, P < 0.05 vs. control (n = 6–10 per group).

To determine whether stress-induced glucocorticoid secretion is responsible for down-regulation of PPG mRNA, we assessed the impact of restraint stress on NTS PPG mRNA expression in adrenalectomized-corticosterone (ADX-Cort)-replaced rats. There was a significant effect of restraint on PPG mRNA expression in the NTS (F(1,31) = 5.86, P < 0.05) (Fig. 3B) but no effect of surgery and no stress by surgery interaction. In sham ADX rats, 30 min of exposure to restraint significantly decreased PPG mRNA expression [P < 0.05, Fisher's probable least-squares difference (PLSD), planned comparison]. In contrast, down-regulation of PPG mRNA did not occur in ADX-Cort-replaced rats, indicating that an acute corticosterone increase is required for PPG mRNA decrements. There appears to be a trend toward PPG mRNA levels decreasing in the ADX animals, although these results do not reach statistical significance. Plasma corticosterone increased in the sham but not ADX-Cort-replaced rats after 30 min of stress exposure (restraint: F(1,31) = 495.65, P < 0.01; surgery: F(1,31) = 499.47, P < 0.01; restraint–surgery interaction: F(1,31) = 526.96, P < 0.01), verifying that ADX-Cort-replaced animals did not mount corticosteroid responses to stress (Fig. 3C).

Glucocorticoids Increase PPG Gene Transcription in the NTS.

Decrements in mRNA expression may be due to decreased transcription or increased degradation. To distinguish among these possibilities, expression of PPG hnRNA was assessed as a measure of recent gene transcription (18). Using primers targeting short intronic sequences from the fourth intron (intron D) of the PPG gene, a 952-bp intronic fragment was cloned by PCR, using Sprague–Dawley genomic DNA as a template. The intron D fragment was subsequently subcloned into the pCR4-TOPO vector and sequenced [supporting information (SI) Fig. S1; see details in SI Materials and Methods]. Intraintronic probes and primers were then designed for in situ hybridization and quantitative real time RT-PCR analysis, respectively.

Expression of PPG hnRNA was visualized by fluorescence in situ hybridization (Fig. S2; see details in SI Materials and Methods). Nuclear PPG hnRNA was observed in NTS neurons 30 and 60 min after stress but not at 120 min or in unstressed animals. We were unable to quantify PPG hnRNA in tissue sections by densitometry, likely due to low levels of hnRNA expression. Therefore, quantitative PCR was used to assess PPG hnRNA in NTS microdissections. As shown in Fig. 4, stress resulted in a rapid increase in PPG hnRNA (hypoxia: F(2,10) = 7.992, P < 0.05; restraint: F(2,10) = 8.429, P < 0.05) (Fig. 4A), consistent with recent transcription. Stress-induced increases in PPG hnRNA were mimicked by s.c. injection of corticosterone (F(3,13) = 5.55, P < 0.05) (Fig. 4B). Moreover, 30 min of exposure to restraint did not affect the PPG hnRNA expression in ADX-Cort-replaced rats (Fig. 4C). Together, the data suggest that stress-induced glucocorticoid secretion increases PPG gene transcription. Thus, poststress decrements in PPG mRNA expression seen in initial experiments are likely due to reduced mRNA stability rather than reduced transcriptional activity.

Fig. 4.

Fig. 4.

Open in a new tab

Quantitative real time RT-PCR analysis of regulation of PPG hnRNA expression in the NTS. (A) Expression of PPG hnRNA rapidly increased 30 min after exposure to both systemic (8% hypoxia) and psychogenic (restraint) stress in the NTS (n = 5–6 per group). (B) s.c. injection of corticosterone (15 mg/kg) resulted in a rapid increased PPG hnRNA expression at 30 min when compared to vehicle (propylene glycol) injection. Acute restraint exposure was included as a positive control. (C) Acute restraint exposure rapidly increased PPG hnRNA expression in sham rats whereas acute 30-min restraint stress did not affect the expression of PPG hnRNA in ADX-Cort-replaced rats (n = 6–10 per group). *, P < 0.05 vs. control.

Stress Causes Depletion of PVN GLP-1 Peptide.

A subset of neurons in the PVN express the GLP-1 receptor, and GLP-1-containing nerve fibers are prevalent in this nucleus (15, 19). Previous studies have demonstrated that GLP-1 signaling activates PVN neurons in response to stress (9). To determine whether acute stress affects PVN GLP-1 immunoreactivity, GLP-1 fiber densities were determined by using Axiovision 4.4 measurement software on projection images of confocal stacks, centered on the mpPVN (see Materials and Methods) (20). In unstressed rats, GLP-1-positive fibers were prevalent in the PVN, as previously reported (15, 17). Density of GLP-1 fibers in this area decreased rapidly after acute LiCl i.p. injection (F(3,39) = 6.121, P < 0.05), consistent with recent release (and degradation) of peptide (Fig. 5 A–D and I). Loss of fiber density is reversed at 120 min, suggesting replenishment of peptide stores by axonal transport of GLP-1. A similar pattern of GLP-1-positive fiber density was observed in the restraint-challenged rats (F(3,37) = 9.706, P < 0.01) (Fig. 5 E–H and J).

Fig. 5.

Fig. 5.

Open in a new tab

Quantification of the expression of GLP-1 fiber in the central PVN after acute systemic (i.p. injection of 0.15 M LiCl, 2% bodyweight) and psychogenic [30-min restraint (Res)] stress exposure. The field area percent occupied by GLP-1 immunoreactivity in mpPVN is shown as mean ± SEM. (A–H) Representative images of GLP-1 fiber in the PVN of hypothalamus at different time points. (A and B) Low magnification of GLP-1 fiber staining in PVN for LiCl-treated rats at 0 (A) min and 30 (B) min time points. (C and D) Projection images for high magnification of measured areas (mpPVN) at 0 (C) and 30 (D) min. (E and F) Low magnification of GLP-1 fiber staining in PVN for naive (E) and 30-min Res (F) rats. (G and H) Projection images for high magnification of measured areas (mpPVN) in naive (G) and 30-min Res (H) rats. (I) The number of GLP-1 fibers as indicated by GLP-1 fiber-occupied area in total measured area decreased at 30 and 60 min after i.p. injection of LiCl compared with 0 min. (J) The number of GLP-1 fibers decreased at 30 and 60 min after onset of the 30-min Res. Data are shown as the percentage of control. *, P < 0.05 vs. control (n = 8–12 per group). (Scale bars, 10 μm for low-magnification images; 20 μm for high-magnification images.)

Discussion

Our results indicate that glucocorticoid stress responses cause a rapid, transient decrease in PPG mRNA in the NTS that is accompanied by increased PPG hnRNA expression. These findings suggest concurrent increases in PPG mRNA instability and PPG hnRNA, indicating that loss of mRNA is not due to decreased transcription. Decreases in mRNA expression are accompanied by depletion of GLP-1 in terminal fields in the PVN, likely due to recent neuronal activation and peptide release. Overall, the data are consistent with a feedback mechanism whereby stress-induced glucocorticoid secretion causes an acute and transient reduction in the CNS availability of GLP-1, a key mediator of HPA axis stress responses.

By measuring hnRNA levels we were able to demonstrate a rapid response of the PPG gene to acute stress stimulation in the NTS. Changes in PPG hnRNA expression in acute stress-challenged rats were detected within 30 min of onset of stress, consistent with a rapid transcriptional response to stress exposure. In agreement with previous studies, our data demonstrated that increases in hnRNA can be detected within minutes (21–24). Rapid increases in PPG hnRNA were also observed after injection of corticosterone, whereas stress-induced increases in PPG hnRNA were not observed in glucocorticoid-clamped animals. Together, these data indicate that glucocorticoids are both necessary and sufficient to drive PPG gene transcription by stress.

Previous studies indicate that glucocorticoid receptors (GRs) bind to glucocorticoid response elements (GREs) to target gene promoters, resulting in gene activation or repression (25). The rat PPG promoter is not extensively characterized (26, 27). We scanned the 5′-flanking region for canonical GRE consensus elements GGTACAnnnTGTTCT (28) and GGnACAnnnTGTnCC (29). A search of the Ensemble database indicates 2 GRE-like sequences in the 5′-flanking region 1.5 and 5.5 kb upstream of the transcription initiation start site. Thus, glucocorticoids are in position to promote PPG transcription via GR-complex binding to regulatory regions within or upstream of the PPG promoter.

Decrements in PPG mRNA were not observed in acutely stressed ADX-Cort-replaced rats, suggesting that glucocorticoid secretion contributes to down-regulation of PPG mRNA. However, it is important to note that ADX-Cort-replaced rats expressed lower levels of PPG mRNA than Sham ADX animals under unstressed conditions. Decreased basal PPG mRNA may be associated with the corticosterone replacement regimen itself, which clamps corticosterone at low AM levels and does not account for the natural circadian rhythm.

The robust and rapid stress-induced decline in PPG mRNA suggests that glucocorticoids are able to either decrease RNA stability and/or enhance degradation. The short time frame of mRNA down-regulation is inconsistent with the transcriptional effects of GR activation. However, in vitro studies indicate that GR complexes can decrease the stability of a variety of mRNAs by binding to the AU-rich elements in the 3′-untranslated region (30). The GR complex can bind directly to target mRNAs to facilitate degradation, providing a potential mechanism for glucocorticoid suppression of gene expression (31, 32). Rapid mRNA decay and loss of protein may also be due to mobilization of microRNAs (miRNA), which can promote degradation of mRNA by deadenylation and decapping and/or repress protein translation (33, 34). Notably, a search of miRNA databases suggests that there are several miRNA targets that might interact with PPG at sequence sites, including miR-215, miR-155, miR-187, miR-376 (family), and miR-764 (family). Finally, it is possible that reciprocal increases in PPG hnRNA and decreases in PPG mRNA are due to a transient suppression of primary transcript processing and/or enhanced mRNA utilization. The current study suggests that glucocorticoids enhance mRNA degradation in vivo and that this process is a physiologically important modulator of mRNA expression.

Our data indicate that glucocorticoids trigger dynamic changes in PPG gene expression in the NTS. Decreased PPG mRNA expression is accompanied by a rapid loss of GLP-1 peptide in the PVN. Given that GLP-1 is rapidly degraded (half life: 1.5–5 min) (35), the most parsimonious explanation for loss of staining is depletion of peptide content in terminals. Restoration of GLP-1 staining is likely too fast for de novo synthesis and probably represents replenishment of terminal GLP-1 by axonal transport. The net result is a down-regulation of biosynthetic capacity during periods immediately following acute stress. Given that GLP-1 is a powerful central activator of the HPA axis (9, 16), the brief inhibition of PPG synthesis may provide a mechanism to limit further activation of the HPA axis during times of repeated or recurrent stress. Importantly, prior studies indicate that the HPA axis is resistant to the effects of a second stressor for approximately hours after the imposition of an initial stress (36). Our current studies suggest that subtraction of the GLP-1 system may serve a role in so-called “intermediate glucocorticoid feedback,” contributing to this stress insensitivity (37).

Prior studies indicate that GLP-1 signaling is involved in processing of both psychogenic and systemic stressors (16). Our data support this observation, given that down-regulation of PPG mRNA and increased PPG hnRNA expression are observed after exposure to a variety of stressors. Importantly, the representative psychogenic (restraint) and systemic (hypoxia) stressors produce HPA axis responses of similar magnitude, whereas LiCl causes more protracted HPA axis responses and a more pronounced and long-lasting PPG mRNA down-regulation. These data suggest that stress effects on PPG mRNA expression are commensurate with the magnitude of the glucocorticoid responses.

The present study reveals rapid and simultaneous gene transcription and mRNA degradation of an important neuroactive peptide after stress. Both effects appear to depend on glucocorticoids providing a mechanism where steroid levels can induce a “pause” in PPG-derived peptide signaling while replenishing capacity for later synthesis and secretion. These findings are further consistent with a prominent role of NTS PPG neurons in feedback regulation of stress responses and suggest that disturbances in glucocorticoid homeostasis may result in inappropriate and possibly deleterious changes in regulation of the hindbrain neuropeptidergic systems responsible for stress integration.

Materials and Methods

Animals.

Adult male Sprague–Dawley rats (Harlan Sprague–Dawley) weighing 280–320 g were housed in a 12:12-h light/dark cycle, temperature- and humidity-controlled, vivarium with free access to rat chow and water. Animals were maintained in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (1996). All animal procedures were approved by the University of Cincinnati Institutional Animal Care and Use Committee.

Regulation of PPG Gene Expression by Acute Stress.

Experiment 1: In situ hybridization analysis of PPG mRNA expression.

Acute systemic stress exposure: Rats received an i.p. injection of 0.15 M LiCl (2% bodyweight). One group was killed by rapid decapitation immediately after injection (time-0 control). The remaining animals were returned to their home cages and subsequently killed by rapid decapitation 30, 60, and 120 min after injection. Brains were removed and immersed in isopentane on dry ice (−45 °C) and subsequently stored at −80 °C. Trunk bloods were collected from all treatments, and plasma was isolated and stored at −20 °C until analysis.

Experiment 2: Comparison of the effects of restraint and hypoxia on PPG mRNA and hnRNA expression.

Restraint stress consisted of placing animals in Plexiglas restraint tubes. For hypoxia stress, rats were placed in a chamber and exposed to 8% oxygen. Both stressors were 30 min in duration. Stressed animals were either killed immediately upon removal from the restrainers or hypoxia chamber or returned to their home cages and killed 30 min after stress cessation. Naive rats were used as controls. Rats were killed by decapitation, and brains were removed. Hindbrains were blocked, and the cerebellum was removed. Anatomical regions were determined based on the Paxinos and Watson rat brain atlases (38). By using the obex (bregma, −14.40 mm) and the fourth ventricle as landmarks, the NTS was dissected with a scalpel under a dissecting microscope. Tissue samples were isolated by using the following anatomical parameters: anterior (rostral) margin (bregma, ≈11.04 mm; 3.36 mm from obex to rostral margin); posterior (caudal) margin (bregma, ≈−15.72 mm; 1.32 mm from obex to caudal margin); total length, 4.68 mm. Both sides were trimmed ≈1 mm along the brain edges, and an addition cut was made ≈2 mm ventral to the dorsal surface of caudal brainstem. The microdissected NTS were kept in RNAlater (Ambion) at 4 °C for RNA extraction and subsequent assessment of PPG mRNA and hnRNA. Trunk bloods were collected for the determination of plasma ACTH and corticosterone by RIA.

Experiment 3: Regulation of PPG gene expression by exogenous corticosterone.

Based on the data obtained in experiments 1 and 2, we hypothesized that the decrease in PPG mRNA expression produced by stress was due to corticosterone secretion. To test this hypothesis, groups of animals were s.c. injected with corticosterone (Sigma) (39, 40) or vehicle (propylene glycol; Sigma) and killed by rapid decapitation 30 min after injection. Naive rats and rats exposed to 30-min restraint were included as negative and positive controls. The region of the NTS was blocked and microdissected as described in experiment 2.

Experiment 4: PPG gene expression in ADX-Cort-replaced rats.

PPG gene expression was assessed in ADX-Cort-replaced rats. Rats received bilateral ADX or sham ADX under anesthesia (ketamine, 87 mg/kg; xylazine, 13 mg/kg). Pellets of cholesterol or a fused mixture of corticosterone-cholesterol (15%, 100 mg) were implanted s.c. into sham ADX and ADX rats as previously described (41). After surgery, ADX-Cort-replaced rats were provided with saline (0.9% NaCl). After 1 week of recovery, blood samples were collected by tail nick from freely moving rats within 3 h of lights-on (basal corticosterone levels). Three days after blood sampling, rats were assigned to experimental groups, including sham ADX no restraint, sham ADX restraint 30 min, ADX-Cort no restraint, and ADX-Cort restraint 30 min. Rats were killed by rapid decapitation, with brains and blood samples processed as above.

Experiment 5: Dynamics of GLP-1 peptides processing after acute stress.

To test the dynamics of GLP-1 peptide processing after acute stress, additional groups of rats were exposed to LiCl or 30-min restraint stress as summarized in experiments 1 and 2. Groups of animals were anesthetized by pentobarbital overdose (50 mg/kg) either 30, 60, or 120 min after injection or restraint. Controls were processed immediately after injection or without restraint, respectively. Animals were subsequently perfused with 100 ml of 0.9% saline followed by 4% paraformaldehyde, as previously described (20). Hypothalamic regions were cut at 25 μm on a sliding microtome (Microm) and placed in cyroprotectant (0.1 M phosphate buffer/30% sucrose/1% polyvinylpyrrolidone/30% ethylene glycol). Sections were stored at −20 °C until immunohistochemical analysis.

Cloning of PPG Intron D.

PPG intron D was cloned by PCR using primers from the exon 4 (accession no. K02811) and exon 5 (accession no. K02812) (42) of the published cDNA sequence, using rat genomic DNA. The primers used were 5′TGGTTTAATATCTGATGATTTTCCT3′ (exon 4) and 5′GCAAAGAAGGCTTGGAGTCA3′ (exon 5), which produced a 952-bp fragment that was subcloned into the pCR4-TOPO vector using the TOPO TA cloning kit for sequencing with One Shot TOP10 Chemically Competent E. coli (Invitrogen). The resulting plasmid was sequenced by the Cincinnati Children's Hospital DNA Core and confirmed (GenBank accession no. AAHX01022268).

In Situ Hybridization.

In situ hybridization was performed as previous described (43). Antisense cRNA probes complementary to rat PPG (399 bp) labeled by in vitro transcription [35S]UTP were applied for PPG mRNA analysis, and biotin-labeled hnRNA probes were used for PPG hnRNA analysis (see details in SI Materials and Methods).

Quantitative Real-Time RT-PCR.

RNA was isolated (Molecular Research Center) and treated by Turbo DNA-free (Ambion) to remove the genomic DNA, and cDNAs were synthesized (SuperScript III first-strand synthesis system) (Invitrogen) according to the manufacturer's instructions. Quantitative real-time RT-PCR analysis was carried out in the iCycler iQTM multicolor real-time PCR detection system (Bio-Rad) (see details in SI Materials and Methods). Minus RT samples were used to detect the genomic DNA contamination. After quantitative real-time RT-PCR, the amplicons of different primers were verified by electrophoresis (Fig. S3; see details in SI Materials and Methods).

Immunohistochemistry (IHC).

IHC was performed as previously described (20) with a primary antibody (1:5 k) directed against enteroglucagon C-terminal octapeptide (see details in SI Materials and Methods) (44).

Image Collection and Processing.

Imaging of PVN fiber density was performed with a Zeiss 510 Meta laser confocal microscope system in single-channel mode (Zeiss) using a 40× oil-immersion lens. The images of the mpPVN (40–50 optical sections per animal) were collected at approximately –−1.8 mm from bregma. All projection image processing was performed by using Zeiss LSM 510 Image Browser software. Projections were analyzed with the measurement function of Axiovision 4.4 software (Zeiss) to obtain the field area percent occupied by GLP-1 immunoreactivity. Finally, the field area percent was averaged across animals by treatment group (see details in SI Materials and Methods).

RIA.

Plasma ACTH and corticosterone were determined by RIA, as previously described (see details in SI Materials and Methods) (43).

Statistical Analysis.

Data are expressed as mean ± SEM. Quantitative real-time RT-PCR data from experiment 4 were analyzed by 2-way ANOVA (ADX-Cort, stress) with GB Stat Version 9.0 (Dynamic Microsystems), and significant main effects were followed up with Fisher's PLSD post hoc tests. In situ, IHC, RIA, and quantitative real-time RT-PCR data otherwise mentioned before were analyzed by 1-way ANOVA with StatView (SAS Institute), and significant main effects were further analyzed by Fisher's PLSD post hoc test. Because specific hypotheses were defined, planned comparisons were conducted between and within factors for the glucocorticoid supplementation and ADX-Cort replacement studies (Fisher's PLSD test). Statistical significance was set at P < 0.05 (see details in SI Materials and Methods).

Supplementary Material

Supporting Information
supp_106_14_5913__index.html (491B, html)

Acknowledgments.

We thank Dr. Yve Ulrich-Lai for assistance with ADX surgeries and helpful discussion and Ronald Bittner, Kenneth Jones, and Ingrid Thomas for technical assistance. This work was supported by National Institutes of Health Grants MH069860 (to J.P.H. and D.A.D.) and MH49698 (to J.P.H.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/cgi/content/full/0808716106/DCSupplemental.

References

  • 1.Kathol RG, Anton R, Noyes R, Gehris T. Direct comparison of urinary free cortisol excretion in patients with depression and panic disorder. Biol Psychiatry. 1989;25:873–878. doi: 10.1016/0006-3223(89)90267-9. [DOI] [PubMed] [Google Scholar]
  • 2.Marti O, Gavalda A, Jolin T, Armario A. Effect of regularity of exposure to chronic immobilization stress on the circadian pattern of pituitary adrenal hormones, growth hormone, and thyroid stimulating hormone in the adult male rat. Psychoneuroendocrinology. 1993;18:67–77. doi: 10.1016/0306-4530(93)90056-q. [DOI] [PubMed] [Google Scholar]
  • 3.Blanchard DC, et al. Visible burrow system as a model of chronic social stress: Behavioral and neuroendocrine correlates. Psychoneuroendocrinology. 1995;20:117–134. doi: 10.1016/0306-4530(94)e0045-b. [DOI] [PubMed] [Google Scholar]
  • 4.Herman JP, Adams D, Prewitt C. Regulatory changes in neuroendocrine stress-integrative circuitry produced by a variable stress paradigm. Neuroendocrinology. 1995;61:180–190. doi: 10.1159/000126839. [DOI] [PubMed] [Google Scholar]
  • 5.Charney DS, Deutch AY, Krystal JH, Southwick SM, Davis M. Psychobiologic mechanisms of posttraumatic stress disorder. Arch Gen Psychiatry. 1993;50:295–305. doi: 10.1001/archpsyc.1993.01820160064008. [DOI] [PubMed] [Google Scholar]
  • 6.Grillon C, Southwick SM, Charney DS. The psychobiological basis of posttraumatic stress disorder. Mol Psychiatry. 1996;1:278–297. [PubMed] [Google Scholar]
  • 7.Herman JP, Prewitt CM, Cullinan WE. Neuronal circuit regulation of the hypothalamo-pituitary-adrenocortical stress axis. Crit Rev Neurobiol. 1996;10:371–394. doi: 10.1615/critrevneurobiol.v10.i3-4.50. [DOI] [PubMed] [Google Scholar]
  • 8.Herman JP, Cullinan WE. Neurocircuitry of stress: Central control of the hypothalamo-pituitary-adrenocortical axis. Trends Neurosci. 1997;20:78–84. doi: 10.1016/s0166-2236(96)10069-2. [DOI] [PubMed] [Google Scholar]
  • 9.Larsen PJ, Tang-Christensen M, Jessop DS. Central administration of glucagon-like peptide-1 activates hypothalamic neuroendocrine neurons in the rat. Endocrinology. 1997;138:4445–4455. doi: 10.1210/endo.138.10.5270. [DOI] [PubMed] [Google Scholar]
  • 10.Kinzig KP, et al. CNS glucagon-like peptide-1 receptors mediate endocrine and anxiety responses to interoceptive and psychogenic stressors. J Neurosci. 2003;23:6163–6170. doi: 10.1523/JNEUROSCI.23-15-06163.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cunningham ET, Jr, Sawchenko PE. Anatomical specificity of noradrenergic inputs to the paraventricular and supraoptic nuclei of the rat hypothalamus. J Comp Neurol. 1988;274:60–76. doi: 10.1002/cne.902740107. [DOI] [PubMed] [Google Scholar]
  • 12.Liposits Z, Sherman D, Phelix C, Paull WK. A combined light and electron microscopic immunocytochemical method for the simultaneous localization of multiple tissue antigens. Tyrosine hydroxylase immunoreactive innervation of corticotropin releasing factor synthesizing neurons in the paraventricular nucleus of the rat. Histochemistry. 1986;85:95–106. doi: 10.1007/BF00491754. [DOI] [PubMed] [Google Scholar]
  • 13.Han VK, et al. Cellular localization of proglucagon/glucagon-like peptide I messenger RNAs in rat brain. J Neurosci Res. 1986;16:97–107. doi: 10.1002/jnr.490160110. [DOI] [PubMed] [Google Scholar]
  • 14.Jin SL, et al. Distribution of glucagonlike peptide I (GLP-I), glucagon, and glicentin in the rat brain: An immunocytochemical study. J Comp Neurol. 1988;271:519–532. doi: 10.1002/cne.902710405. [DOI] [PubMed] [Google Scholar]
  • 15.Larsen PJ, Tang-Christensen M, Holst JJ, Orskov C. Distribution of glucagon-like peptide-1 and other preproglucagon-derived peptides in the rat hypothalamus and brainstem. Neuroscience. 1997;77:257–270. doi: 10.1016/s0306-4522(96)00434-4. [DOI] [PubMed] [Google Scholar]
  • 16.Kinzig KP, D'Alessio DA, Seeley RJ. The diverse roles of specific GLP-1 receptors in the control of food intake and the response to visceral illness. J Neurosci. 2002;22:10470–10476. doi: 10.1523/JNEUROSCI.22-23-10470.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rinaman L. Interoceptive stress activates glucagon-like peptide-1 neurons that project to the hypothalamus. Am J Physiol. 1999;277:R582–R590. doi: 10.1152/ajpregu.1999.277.2.R582. [DOI] [PubMed] [Google Scholar]
  • 18.Herman JP, Schafer MK, Watson SJ, Sherman TG. In situ hybridization analysis of arginine vasopressin gene transcription using intron-specific probes. Mol Endocrinol. 1991;5:1447–1456. doi: 10.1210/mend-5-10-1447. [DOI] [PubMed] [Google Scholar]
  • 19.Dunphy JL, Taylor RG, Fuller PJ. Tissue distribution of rat glucagon receptor and GLP-1 receptor gene expression. Mol Cell Endocrinol. 1998;141:179–186. doi: 10.1016/s0303-7207(98)00096-3. [DOI] [PubMed] [Google Scholar]
  • 20.Mueller NK, Di S, Paden CM, Herman JP. Activity-dependent modulation of neurotransmitter innervation to vasopressin neurons of the supraoptic nucleus. Endocrinology. 2005;146:348–354. doi: 10.1210/en.2004-0539. [DOI] [PubMed] [Google Scholar]
  • 21.Herman JP, Schafer MK, Thompson RC, Watson SJ. Rapid regulation of corticotropin-releasing hormone gene transcription in vivo. Mol Endocrinol. 1992;6:1061–1069. doi: 10.1210/mend.6.7.1324419. [DOI] [PubMed] [Google Scholar]
  • 22.Herman JP. In situ hybridization analysis of vasopressin gene transcription in the paraventricular and supraoptic nuclei of the rat: Regulation by stress and glucocorticoids. J Comp Neurol. 1995;363:15–27. doi: 10.1002/cne.903630103. [DOI] [PubMed] [Google Scholar]
  • 23.Imaki T, et al. Stress-induced activation of neuronal activity and corticotropin-releasing factor gene expression in the paraventricular nucleus is modulated by glucocorticoids in rats. J Clin Invest. 1995;96:231–238. doi: 10.1172/JCI118026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ma XM, Levy A, Lightman SL. Rapid changes of heteronuclear RNA for arginine vasopressin but not for corticotropin releasing hormone in response to acute corticosterone administration. J Neuroendocrinol. 1997;9:723–728. doi: 10.1046/j.1365-2826.1997.00646.x. [DOI] [PubMed] [Google Scholar]
  • 25.Malkoski SP, Handanos CM, Dorin RI. Localization of a negative glucocorticoid response element of the human corticotropin releasing hormone gene. Mol Cell Endocrinol. 1997;127:189–199. doi: 10.1016/s0303-7207(96)04004-x. [DOI] [PubMed] [Google Scholar]
  • 26.Heinrich G, Gros P, Habener JF. Glucagon gene sequence. Four of six exons encode separate functional domains of rat pre-proglucagon. J Biol Chem. 1984;259:14082–14087. [PubMed] [Google Scholar]
  • 27.McKinnon CM, Ravier MA, Rutter GA. FoxO1 is required for the regulation of preproglucagon gene expression by insulin in pancreatic alphaTC1–9 cells. J Biol Chem. 2006;281:39358–39369. doi: 10.1074/jbc.M605022200. [DOI] [PubMed] [Google Scholar]
  • 28.Beato M, Chalepakis G, Schauer M, Slater EP. DNA regulatory elements for steroid hormones. J Steroid Biochem. 1989;32:737–747. doi: 10.1016/0022-4731(89)90521-9. [DOI] [PubMed] [Google Scholar]
  • 29.Nordeen SK, Suh BJ, Kuhnel B, Hutchison CD. Structural determinants of a glucocorticoid receptor recognition element. Mol Endocrinol. 1990;4:1866–1873. doi: 10.1210/mend-4-12-1866. [DOI] [PubMed] [Google Scholar]
  • 30.Stellato C. Post-transcriptional and nongenomic effects of glucocorticoids. Proc Am Thorac Soc. 2004;1:255–263. doi: 10.1513/pats.200402-015MS. [DOI] [PubMed] [Google Scholar]
  • 31.Dhawan L, Liu B, Blaxall BC, Taubman MB. A novel role for the glucocorticoid receptor in the regulation of monocyte chemoattractant protein-1 mRNA stability. J Biol Chem. 2007;282:10146–10152. doi: 10.1074/jbc.M605925200. [DOI] [PubMed] [Google Scholar]
  • 32.Poon M, Liu B, Taubman MB. Identification of a novel dexamethasone-sensitive RNA-destabilizing region on rat monocyte chemoattractant protein 1 mRNA. Mol Cell Biol. 1999;19:6471–6478. doi: 10.1128/mcb.19.10.6471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hobert O. miRNAs play a tune. Cell. 2007;131:22–24. doi: 10.1016/j.cell.2007.09.031. [DOI] [PubMed] [Google Scholar]
  • 34.Meister G. miRNAs get an early start on translational silencing. Cell. 2007;131:25–28. doi: 10.1016/j.cell.2007.09.021. [DOI] [PubMed] [Google Scholar]
  • 35.Hui H, Farilla L, Merkel P, Perfetti R. The short half-life of glucagon-like peptide-1 in plasma does not reflect its long-lasting beneficial effects. Eur J Endocrinol. 2002;146:863–869. doi: 10.1530/eje.0.1460863. [DOI] [PubMed] [Google Scholar]
  • 36.Keller-Wood ME, Shinsako J, Dallman MF. Inhibition of the adrenocorticotropin and corticosteroid responses to hypoglycemia after prior stress. Endocrinology. 1983;113:491–496. doi: 10.1210/endo-113-2-491. [DOI] [PubMed] [Google Scholar]
  • 37.Keller-Wood ME, Dallman MF. Corticosteroid inhibition of ACTH secretion. Endocr Rev. 1984;5:1–24. doi: 10.1210/edrv-5-1-1. [DOI] [PubMed] [Google Scholar]
  • 38.Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates. New York: Elsevier Academic; 2005. [Google Scholar]
  • 39.Harvey PW, et al. Corticosterone does not cause testicular toxicopathology in the rat: Relevance to methylxanthines, ACTH and stress. Hum Exp Toxicol. 1992;11:505–509. doi: 10.1177/096032719201100611. [DOI] [PubMed] [Google Scholar]
  • 40.Sapolsky RM. Glucocorticoid toxicity in the hippocampus. Temporal aspects of synergy with kainic acid. Neuroendocrinology. 1986;43:440–444. doi: 10.1159/000124561. [DOI] [PubMed] [Google Scholar]
  • 41.Akana SF, Jacobson L, Cascio CS, Shinsako J, Dallman MF. Constant corticosterone replacement normalizes basal adrenocorticotropin (ACTH) but permits sustained ACTH hypersecretion after stress in adrenalectomized rats. Endocrinology. 1988;122:1337–1342. doi: 10.1210/endo-122-4-1337. [DOI] [PubMed] [Google Scholar]
  • 42.Heinrich G, Gros P, Lund PK, Bentley RC, Habener JF. Pre-proglucagon messenger ribonucleic acid: Nucleotide and encoded amino acid sequences of the rat pancreatic complementary deoxyribonucleic acid. Endocrinology. 1984;115:2176–2181. doi: 10.1210/endo-115-6-2176. [DOI] [PubMed] [Google Scholar]
  • 43.Choi DC, et al. Bed nucleus of the stria terminalis subregions differentially regulate hypothalamic-pituitary-adrenal axis activity: Implications for the integration of limbic inputs. J Neurosci. 2007;27:2025–2034. doi: 10.1523/JNEUROSCI.4301-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Collie NL, et al. Purification and sequence of rat oxyntomodulin. Proc Natl Acad Sci USA. 1994;91:9362–9366. doi: 10.1073/pnas.91.20.9362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–386. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information
supp_106_14_5913__index.html (491B, html)
0808716106_0808716106SI.pdf (701.2KB, pdf)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES