Abstract
Small-subunit (SSU) rRNA-based methods have been commonly used in the differentiation of Cryptosporidium species or genotypes. In order to develop a new tool for confirming the genotypes of Cryptosporidium species, parts of the 90-kDa heat shock protein (Hsp90) genes of seven Cryptosporidium species and genotypes known to infect humans (C. hominis, C. parvum, C. meleagridis, C. canis, C. muris, C. suis, and the cervine genotype), together with one from cattle (C. andersoni), were sequenced and analyzed. With the exception of C. felis from cats and C. baileyi from birds, the Hsp90 genes of all tested Cryptosporidium species were amplified. Phylogenetic analysis of the hsp90 sequences from all these species is congruent with previous studies in which the SSU rRNA, 70-kDa heat shock protein, oocyst wall protein, and actin genes were analyzed and showed that gastric and intestinal parasites segregate into two distinct clades. In this study, the secondary products of hsp90 produced after PCR-restriction fragment length digestion with StyI and HphI or with BbsI showed that parasites within the intestinal or gastric clade could be differentiated from each other. These data confirm the utility of the Hsp90 gene as a sensitive, specific, and robust molecular tool for differentiating species and/or genotypes of Cryptosporidium in clinical specimens.
Once an emerging pathogen, Cryptosporidium is now firmly established as a serious and widespread agent of enteric diseases in humans and other animals that is responsible for waterborne and food-borne outbreaks, diarrhea in the very young and elderly, and life-threatening infection in individuals with an impaired immune system (7). Currently, there are at least 20 valid species of Cryptosporidium (6, 24). These include C. hominis (humans); C. parvum (humans and ruminants); C. muris (rodents); C. andersoni, C. bovis, and C. ryanae (ruminants); C. felis (cats); C. canis (dogs); C. suis (pigs); C. wrairi (guinea pigs); C. fayeri and C. macropodum (marsupials); C. meleagridis, C. baileyi, and C. galli (birds); C. serpentis and C. varanii (previously known as C. saurophilum) (reptiles); C. fragile (toads); and C. molnari and C. scophthalmi (fish). There are also over 40 unnamed species in mammals, birds, and reptiles, which currently have only genotype names. Among the established species and genotypes, at least eight are known to infect humans, including C. hominis, C. parvum, C. meleagridis, C. felis, C. canis, C. suis, C. muris, and the cervine genotype (6, 24, 27). Nevertheless, the pathology of these parasites in human tissues has been well documented only for C. hominis and C. parvum (22). Therefore, additional information will be essential before the pathogenicity of other Cryptosporidium species for humans can be established.
Many genus-specific PCR-restriction fragment length polymorphism (RFLP) techniques have been described for the differentiation of Cryptosporidium species or genotypes, all of which are based on the small-subunit (SSU) rRNA gene (3, 4, 11, 13, 14, 17, 18, 23). This is largely due to the fact that Cryptosporidium species and genotypes are mostly characterized at this locus. The SSU rRNA gene has some advantages over other genes because of the multiple copy number and presence of conserved regions interspersed with highly polymorphic regions, which facilitates the design of PCR primers. DNA sequences of the 70-kDa heat shock protein (Hsp70), oocyst wall protein (COWP), and actin genes are also available for some Cryptosporidium spp. and genotypes (15, 19, 20, 23, 26, 28). Because sequence diversity occurs over the entire Hsp70, COWP, and actin genes of Cryptosporidium, designing efficient PCR primers for genotyping using these genes is limiting. Therefore, other gene targets were analyzed for applicability.
One disadvantage of the SSU rRNA gene is that there are minor sequence differences among different copies of the gene, which sometimes can lead to variation in RFLP for certain Cryptosporidium species or genotypes (8, 25). In such situations, it is very important to differentiate intragenotypic variations among isolates from sequence variations between different copies of the gene (2) and to have a tool that confirms the genotype. Although there are other genes available which can differentiate the two major human-pathogenic species, C. parvum and C. hominis, these cannot distinguish genetically divergent species of Cryptosporidium, i.e., C. canis, C. felis, C. suis, and C. muris, from them (10, 16, 21).
The genome of C. muris (http://msc.jcvi.org/c_muris/index.shtml), which is currently being sequenced, appears to be highly divergent from those of C. parvum (1) and C. hominis (29). Therefore, it is thought that any gene sequence conserved among all three of these species might provide a specific tool for genotyping. When the genomes of C. hominis, C. parvum, and C. muris were analyzed, the 90-kDa heat shock protein (Hsp90) gene appeared to provide this type of conserved sequence identity. From these data, a genus-specific nested PCR for hsp90 was developed, which, with the exceptions of C. felis (cats) and C. baileyi (birds), amplified all Cryptosporidium species and genotypes tested. These species and genotypes had very different hsp90 sequences, which allowed them to be differentiated by RFLP analysis and/or DNA sequencing.
MATERIALS AND METHODS
Genomic DNA.
DNA preparations extracted from specimens containing oocysts of C. hominis, C. parvum, C. meleagridis, C. canis, C. felis, C. suis, C. baileyi, C. muris, C. andersoni, and the cervine genotype were used in this study. The number and sources of specimens used for each Cryptosporidium species are shown in Table 1. They were previously extracted from 0.2-ml fecal pellets (for most DNA preparations) or from immunomagnetic separation-purified oocysts (for the C. andersoni river water sample) using the FastDNA Spin kit for soil (BIO 101, Carlsbad, CA) and were identified to Cryptosporidium species/genotypes based on PCR-RFLP and sequence analyses of the SSU rRNA gene (26). The specificity was determined by PCR amplification of the hsp90 DNA from each of a selected group of possible confounding parasites, including Cyclospora cayetanensis, Eimeria papillata, Eimeria tenella, Enterocytozoon bieneusi, Giardia duodenalis, Isospora (Cystoisospora) felis, Naegleria fowleri, Sarcocystis cruzi, and Toxoplasma gondii. To determine the sensitivity of the hsp90 PCR amplification, five specimens each of DNA extracted from 200 μl of Cryptosporidium-negative stools that had been seeded with 0, 10, 20, 50, and 100 flow cytometer-sorted oocysts of the C. parvum Iowa isolate was eluted in 100 μl water, from which 1 microliter of each was removed and amplified.
TABLE 1.
RFLP analysis of the Hsp90 genes of various Cryptosporidium specimens in this study
| Species or genotype | Isolate(s) | Host(s) | Location(s) | Fragment(s) (bp)a
|
|||
|---|---|---|---|---|---|---|---|
| PCR | StyI digestion | HphI digestion | BbsI digestion | ||||
| C. hominis | 13029, 13037, 6118 | Children and AIDS patient | Peru | 676 | 42, 634 | 80, 135, 461 | 676 |
| C. parvum | 13033, 13026 | Children | Peru | 676 | 42, 119, 515 | 46, 215, 415 | 676 |
| C. meleagridis | 9917, 9528 | Children | Peru | 676 | 42, 119, 155, 360 | 215, 461 | 676 |
| C. canis | 9502, 10191 | Children | Peru | 670 | 230, 440 | 135, 165, 370 | 670 |
| Cervine genotype | 11689, 8774 | Deer mouse, child | New York, Ohio | 676 | 208, 230, 238 | 135, 541 | 676 |
| C. suis | 14290, 14289 | Pigs | Czech Republic | 673 | 111, 119, 443 | 43, 630 | 673 |
| C. andersoni | 13732, 14237 | River water, Cattle | Virginia, Czech Republic | 685 | 685 | 685 | 32, 87, 584 |
| C. muris | 14714 | Child | Kenya | 685 | 685 | 685 | 32, 653 |
| C. felis | 11747, 14891 | Children | Peru | NA | |||
| C. baileyi | 11269, 11273 | Ducks | Peru | NA | |||
Boldface indicates bands visualized by agarose electrophoresis. NA, no amplification.
hsp90 PCR.
A nested PCR protocol was used to amplify the partial Hsp90 genes of various Cryptosporidium species, using primers based on the conserved sequences of C. parvum, C. hominis, and C. muris. The Hsp90 gene was targeted after BLAST searches of the sequences of the raw C. muris genome against the C. parvum and C. hominis genomes, which showed high sequence identity at the hsp90 locus among all three species. PCR products of 835 bp for C. parvum and C. hominis and 844 bp for C. muris were amplified using primers hsp90-F3 (5′-CTA GTG AAA GCT ACG AGT TCC AA-3′) and hsp90-R3 (5′-TCT ATT TCA CCT TCG GCG GAA AA-3′) (Table 2). The PCR mixture consisted of 1 μl of DNA, 200 mM (each) deoxynucleoside triphosphate, 1× PCR buffer (Perkin-Elmer, Foster City, CA), 3.0 mM MgCl2, 5.0 U of Taq polymerase (GIBCO BRL, Frederick, MD), 400 ng/μl of nonacetylated bovine serum albumin (Sigma-Aldrich, St. Louis, MO), and 100 nM primers in a total volume of 100 μl. The reactions were performed for 35 cycles of 94°C for 45 s, 50°C for 45 s, and 72°C for 60 s in a GeneAmp PCR 9700 thermocycler (Perkin-Elmer), with an initial denaturation (94°C for 5 min) and a final extension (72°C for 10 min). For the secondary PCR, fragments of 676 bp for C. parvum and C. hominis and 685 bp for C. muris were amplified using 2 μl of the primary PCR product and 200 nM primers hsp90-F4 (5′-GGA TAT TAT TAT TAA CTC TCT CTA TTC TCA GAA-3′) and hsp90-R4 (5′-CCA TAT TGC CTT TTC TAC ATT AAC-3′) (Table 2). The conditions and cycle number for the secondary PCR were identical to those for the primary amplification except that a higher annealing temperature (55°C) was used and no bovine serum albumin was added. The PCR products were detected by agarose gel electrophoresis and ethidium bromide staining.
TABLE 2.
Nucleotide sequence polymorphism in the PCR primer regions of the Hsp90 gene
| Primer and Cryptosporidium species | Sequence polymorphism (5′ → 3′) |
|---|---|
| hsp90-F3 | CTAGTGAAAGCTACGAGTTCCAA |
| C. parvum | ....................... |
| C. hominis | ....................... |
| C. muris | ..........T..T..A...... |
| hsp90-R3 | TCTATTTCACCTTCGGCGGAAAA |
| C. parvum | ....................... |
| C. hominis | ....................... |
| C. muris | ...........C..T..T..... |
| hsp90-F4 | GGATATTATTATTAACTCTCTCTATTCTCAGAA |
| C. parvum | .....................A........... |
| C. hominis | ................................. |
| C. muris | ...............T..CT.G........... |
| hsp90-R4 | CCATATTGCCTTTTCTACATTAAC |
| C. parvum | ........................ |
| C. hominis | ........................ |
| C. muris | ......A.....C..A........ |
Sequence analysis.
After being purified through Montage PCR filters (Millipore, Bedford, MA), the secondary PCR products were directly sequenced using the ABI BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA) as detailed by the manufacturer. Sequences were read on an ABI3130 Genetic Analyzer (Applied Biosystems). Sequence accuracy was confirmed by two-directional sequencing of at least two PCR products from each positive specimen. Nucleotide sequences were then aligned with reference Cryptosporidium sequences using the ClustalX 1.81 package (ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalX/) and the default setting.
To assess phylogenetic relationships among Cryptosporidium species and genotypes, a neighbor-joining analysis was carried out on the aligned sequences constructed using the TreeCon package (http://www.psb.rug.ac.be/bioinformatics/psb/Userman/treeconw.html), based on the evolutionary distances calculated by the Kimura two-parameter model. The tree was rooted with the hsp90 sequence of Plasmodium falciparum (GenBank accession no. AF030694), and the reliability of various clusters was evaluated by bootstrapping 1,000 pseudoreplicates. The value of 95% was used as the statistically significant value (5); however, values greater than 70% are reported, since bootstrap values may be conservative estimates of the reliability of clades (9).
RFLP analysis.
To develop an RFLP method for the rapid differentiation of Cryptosporidium species and genotypes, the Hsp90 gene sequences were examined using the software BioEdit (www.mbio.ncsu.edu/BioEdit/bioedit.html) for restriction enzyme sites. After analyzing the restriction maps, StyI or HphI was selected for differentiating among intestinal species of Cryptosporidium, whereas BbsI was used to distinguish C. muris from C. andersoni. Ten microliters of the secondary PCR products of the Hsp90 gene was digested with StyI, HphI, or BbsI (New England BioLabs, Ipswich, MA) under the conditions suggested by the manufacturer, and the products were visualized by electrophoresis through a 2% agarose gel.
Nucleotide sequence accession numbers.
The partial hsp90 sequences obtained from this study were deposited in the GenBank database under accession numbers FJ153249 to FJ153257.
RESULTS
Detection of Cryptosporidium spp. by hsp90 PCR.
Among those intestinal and gastric Cryptosporidium species tested, PCR amplified the partial Hsp90 genes of DNA extracted from one to three specimens each of C. parvum, C. hominis, C. meleagridis, cervine genotype, C. canis, C. suis, C. muris, and C. andersoni (Table 1) using primers designed in this study (Table 2). Among the Cryptosporidium species/genotypes studied, only C. felis and C. baileyi failed to generate hsp90 PCR products (Table 1).
Sequence differences in the Hsp90 gene among Cryptosporidium spp.
All hsp90 PCR products were sequenced. The PCR amplicons varied from 670 to 685 bp, depending on the species and genotype; the products of C. canis were the shortest, whereas those of C. muris and C. andersoni were the longest (Table 1). The differences in length were due to deletions and insertions near the 3′ ends of the PCR products, with a total of nine base pair insertions in C. muris and C. andersoni, six base pair deletions in C. canis, and three base pair deletions in C. suis. Marked heterogeneity in the hsp90 nucleotide sequences (1.9% to 38.8%) was noticed among Cryptosporidium spp., with C. hominis and C. parvum being mostly similar to each other. The greatest sequence differences were seen between intestinal and gastric species (34.1 to 38.8%). Among the intestinal Cryptosporidium spp., C. canis was the most divergent, having >20% sequence differences from other intestinal species. When analyzed, the sequence differences encompassed the entire Hsp90 gene (see Fig. S1 and S2 in the supplemental material, which also include sequences from C. serpentis and the Cryptosporidium mouse genotype). With the exception of C. canis, which had four single-nucleotide polymorphisms between the two specimens sequenced, no intragenotypic sequence variation was observed for the species of Cryptosporidium.
Significantly fewer sequence differences were seen among Cryptosporidium spp. at the amino acid level. For example, the 12 nucleotide differences in the partial Hsp90 gene between C. parvum and C. hominis were all synonymous, resulting in no amino acid changes. There were few amino acid sequence differences in the Hsp90 gene between C. meleagridis or C. suis and C. hominis or C. parvum (four and two amino acid changes, respectively) in spite of extensive nucleotide sequences differences between the them (35 to 36 bp and 68 to 69 bp, respectively). Likewise, the four single-nucleotide polymorphisms between two C. canis specimens were also synonymous.
Genetic relatedness of Cryptosporidium spp.
Results of the neighbor-joining analysis showed that the isolates of all species of Cryptosporidium could be grouped either into an intestinal clade or a gastric clade (Fig. 1).
FIG. 1.
Phylogenetic relationships among Cryptosporidium spp. inferred by a neighboring-joining analysis of hsp90 nucleotide sequences (numbers on branches are percent bootstrapping values for 1,000 replicates).
Differentiation of Cryptosporidium spp. by RFLP.
The Hsp90 gene sequences were mapped for restriction sites, which resulted in the selection of StyI and HphI or of BbsI for the differentiation of intestinal or gastric species of Cryptosporidium, respectively (see Fig. S2 in the supplemental material). The digestion of the secondary hsp90 PCR products with StyI resulted in seven restriction patterns (Fig. 2). Because the StyI site is absent both in C. andersoni and C. muris, these species possessed the longest restriction fragments (685 bp). In contrast, Cryptosporidium from the intestine had one to three StyI sites, the locations of which varied among species of Cryptosporidium to yield species- or genotype-specific fragments. Thus, C. hominis had one 634-bp visible band, and C. meleagridis had three visible bands (119, 155, and 360 bp). Even though C. parvum, C. suis, C. canis, and the cervine genotype all generated two visible bands, the sizes of these differed among species of Cryptosporidium (Table 1).
FIG. 2.
Differentiation of intestinal Cryptosporidium spp. by RFLP analysis of hsp90 PCR gene products using StyI and HphI. Lanes 1 to 4, C. parvum; lanes 5 to 9 and 28, C. hominis; lanes 11 to 14, C. canis; lanes 15 and 29, 100-bp molecular markers; lanes 16 to 19, C. meleagridis; lanes 20, 21, 26, and 27, cervine genotype; lanes 22 to 25, C. suis. The upper panel shows StyI digestion products, and the lower panel shows HphI digestion products.
Similarly, the digestion of the secondary hsp90 PCR products with HphI resulted in seven restriction pattern polymorphisms (Fig. 2). As mentioned above, both gastric species of Cryptosporidium had the largest restriction fragments because they lacked the HphI site. In contrast, a single fragment of 630 bp was present in C. suis, whereas the fragments of C. parvum, C. meleagridis, and the cervine genotype each had two fragments that distinguished them from one another, i.e., 215 and 415 bp, 215 and 461 bp, and 135 and 541 bp, respectively. On the other hand, C. hominis and C. canis each had three visible bands distinguishing them from other species (80, 135, and 461 bp and 135, 165, and 370 bp, respectively).
Furthermore, the gastric parasites C. muris and C. andersoni could be clearly delineated from all intestinal species because their amplicons were digested only by BbsI (Fig. 3) to yield either a single 653-bp fragment or two bands of 87 and 584 bp, respectively (Table 1). Electrophoresis of the digested products confirmed the predicted restriction patterns (Fig. 2 and 3).
FIG. 3.
Differentiation of gastric Cryptosporidium spp. by RFLP analysis of hsp90 PCR gene products using BbsI. Lanes 1 and 11, 100-bp molecular markers; lanes 2, 3, 6, 7, and 10, C. muris; lanes 4, 5, 8, and 9, C. andersoni.
Specificity and sensitivity of the hsp90-based PCR.
Analysis of DNA from C. cayetanensis, E. papillata, E. tenella, E. bieneusi, G. duodenalis, I. felis, N. fowleri, S. cruzi, and T. gondii confirmed the specificity of hsp90 for species of Cryptosporidium. Five control stools from humans that were Cryptosporidium negative by microscopy were consistent with those results in that no products were amplified. Sensitivity was confirmed by seeding 200 μl negative stool with 100, 50, 20, and 10 oocysts of the C. parvum Iowa isolate (data not shown). As expected, after extraction of the DNA, these dilution controls yielded 3/5, 1/5, 2/5, and 0/5 samples positive for Cryptosporidium.
DISCUSSION
In this study, partial nucleotide sequences of the Hsp90 gene were obtained from seven Cryptosporidium species/genotypes known to infect humans, as well as C. andersoni, the cattle parasite. The results of sequence and phylogenetic analyses are congruent with previous analyses using the SSU rRNA, Hsp70, COWP, and actin genes (15, 19, 20, 23, 26, 28), showing that species of Cryptosporidium may be grouped into two clades: those invading the gastric epithelium (C. muris and C. andersoni) and those within the small intestine (C. hominis, C. parvum, C. canis, C. meleagridis, C. suis, and the cervine genotype). These data suggest that like for other members of the Apicomplexa and Dinoflagellata (12), the Hsp90 gene may be a useful molecular tool for dissecting phylogenetic relationships among diverse eukaryotes.
The results of the hsp90 sequence analysis allowed us to develop a new and confirmative genus-specific diagnostic tool, which is needed for monitoring the presence of pathogens in clinical and water samples. The hsp90-based PCR amplified the sequences of the species of Cryptosporidium, other than C. hominis and C. parvum, known to infect humans, e.g., C. meleagridis, C. canis, C. muris, C. suis, and the cervine genotype. Among 10 Cryptosporidium species or genotypes tested, only those infecting cats (C. felis) and birds (C. baileyi) could not be detected. This was probably due to sequence polymorphism in the primer regions. Although conserved sequences were selected when the primers were designed, minor sequence polymorphism was noted, which might affect the fidelity of the reaction. Because C. hominis and C. parvum are responsible for most human infections, the nucleotide sequences eventually used in primers were based on C. hominis and C. parvum sequences. Thus, three or four nucleotide mismatches are present in each primer used to amplify the Hsp90 gene of C. muris, the gastric species most divergent from these two intestinal species (Table 2).
The intestinal species and genotypes can be identified by digesting the secondary PCR product with the restriction enzyme StyI or HphI. PCR products of the gastric species can be easily differentiated from the intestinal species, as they do not have the StyI or HphI restriction site. The two common gastric species in mammals, C. andersoni and C. muris, can be differentiated by restriction analysis with BbsI. Since the SSU rRNA PCR product of C. felis (864 bp) is longer than those of other Cryptosporidium species and genotypes (826 to 838 bp) (26), it is easier to differentiate C. felis from other Cryptosporidium species and genotypes by using PCR analysis of the SSU rRNA gene. Cryptosporidium baileyi was commonly found in birds (6, 24); it has not been reported in humans. Consequently, the failure to amplify this species by the hsp90 method may not be a major concern from the point of view of public health importance. Therefore, the PCR-RFLP based on the Hsp90 gene developed in this study could be used as a secondary and confirmative genotyping tool, especially when the human-pathogenic species are detected in human, animal, and water samples.
The results of this study suggest that the Hsp90 gene offers several advantages over the SSU rRNA gene for the species and genotype differentiation of Cryptosporidium. Unlike the SSU rRNA gene, which sometimes has intraspecific or intragenotypic variations in RFLP patterns due to sequence variations among different copies of the gene (8, 25, 26), the consistent hsp90 RFLP pattern for each Cryptosporidium species/genotype facilitates molecular typing. In addition, the greater sequence heterogeneity within the Cryptosporidium Hsp90 gene than observed for SSU rRNA gene indicates that hsp90 may be a more robust tool for genotyping. Unlike those in the SSU rRNA gene, which restrict nucleotide changes to a certain region of the gene, mutations in the Hsp90 gene encompass the entire sequence. Because deletions and insertions are limited in the Hsp90 gene, the alignment of sequences from diverse organisms is also easier. Although hsp90 failed to detect two species of Cryptosporidium and the sensitivity of this method may be less than that with SSU rRNA, which occurs in multiple copies, this gene obviously complements SSU rRNA-based PCR-RFLP methods and can serve as a new molecular tool to confirm the genotypes of Cryptosporidium species.
Supplementary Material
Acknowledgments
This study was supported in part by the National Natural Science Foundation of China (30771881) and the Program for New Century Excellent Talents in the University of China (NCET-05-0382). Conference grant R13 AI078718 from the National Institute of Allergy and Infectious Diseases is acknowledged.
We thank Martin Kváč for providing some C. suis and C. andersoni specimens.
The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.
Footnotes
Published ahead of print on 23 January 2009.
Supplemental material for this article may be found at http://ec.asm.org/.
REFERENCES
- 1.Abrahamsen, M. S., T. J. Templeton, S. Enomoto, J. E. Abrahante, G. Zhu, C. A. Lancto, M. Deng, C. Liu, G. Widmer, S. Tzipori, G. A. Buck, P. Xu, A. T. Bankier, P. H. Dear, B. A. Konfortov, H. F. Spriggs, L. Iyer, V. Anantharaman, L. Aravind, and V. Kapur. 2004. Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science 304441-445. [DOI] [PubMed] [Google Scholar]
- 2.Atwill, E. R., R. Phillips, M. D. Pereira, X. Li, and B. McCowan. 2004. Seasonal shedding of multiple Cryptosporidium genotypes in California ground squirrels (Spermophilus beecheyi). Appl. Environ. Microbiol. 706748-6752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Awad-el-Kariem, F. M., D. C. Warhurst, and V. McDonald. 1994. Detection and species identification of Cryptosporidium oocysts using a system based on PCR and endonuclease restriction. Parasitology 10919-22. [DOI] [PubMed] [Google Scholar]
- 4.Coupe, S., C. Sarfati, S. Hamane, and F. Derouin. 2005. Detection of cryptosporidium and identification to the species level by nested PCR and restriction fragment length polymorphism. J. Clin. Microbiol. 431017-1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Efron, B., E. Halloran, and S. Holmes. 1996. Bootstrap confidence levels for phylogenetic trees. Proc. Natl. Acad. Sci. USA 9313429-13434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fayer, R. 2008. Introduction, p. 1-42. In R. Fayer and L. Xiao (ed.), Cryptosporidium and cryptosporidiosis, 2nd ed. CRC Press, Boca Raton, FL.
- 7.Fayer, R., C. A. Speer, and J. P. Dubey. 1997. The general biology of Cryptosporidium, p. 1-41. In R. Fayer (ed.), Cryptosporidium and cryptosporidiosis. CRC Press, Boca Raton, FL.
- 8.Gibbons-Matthews, C., and A. M. Prescott. 2003. Intra-isolate variation of Cryptosporidium parvum small subunit ribosomal RNA genes from human hosts in England. Parasitol. Res. 90439-444. [DOI] [PubMed] [Google Scholar]
- 9.Hillis, D., and J. Bull. 1993. An empirical test of bootstraping as a method for assessing confidence in phylogentic analysis. Syst. Biol. 42182-192. [Google Scholar]
- 10.Jiang, J., and L. Xiao. 2003. An evaluation of molecular diagnostic tools for the detection and differentiation of human-pathogenic Cryptosporidium spp. J. Eukaryot. Microbiol. 50(Suppl.)542-547. [DOI] [PubMed] [Google Scholar]
- 11.Kimbell, L. M., III, D. L. Miller, W. Chavez, and N. Altman. 1999. Molecular analysis of the 18S rRNA gene of Cryptosporidium serpentis in a wild-caught corn snake (Elaphe guttata guttata) and a five-species restriction fragment length polymorphism-based assay that can additionally discern C. parvum from C. wrairi. Appl. Environ. Microbiol. 655345-5349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Leander, B. S., and P. J. Keeling. 2004. Early evolutionary history of Dianofalgellates and Apicomplexans (Alveolata) as inferred from HSP90 and actin phylogenies. J. Phycol. 40341-350. [Google Scholar]
- 13.Leng, X., D. A. Mosier, and R. D. Oberst. 1996. Differentiation of Cryptosporidium parvum, C. muris, and C. baileyi by PCR-RFLP analysis of the 18S rRNA gene. Vet. Parasitol. 621-7. [DOI] [PubMed] [Google Scholar]
- 14.Lowery, C. J., J. E. Moore, B. C. Millar, D. P. Burke, K. A. McCorry, E. Crothers, and J. S. Dooley. 2000. Detection and speciation of Cryptosporidium spp. in environmental water samples by immunomagnetic separation, PCR and endonuclease restriction. J. Med. Microbiol. 49779-785. [DOI] [PubMed] [Google Scholar]
- 15.Morgan, U. M., P. T. Monis, R. Fayer, P. Deplazes, and R. C. Thompson. 1999. Phylogenetic relationships among isolates of Cryptosporidium: evidence for several new species. J. Parasitol. 851126-1133. [PubMed] [Google Scholar]
- 16.Muthusamy, D., S. S. Rao, S. Ramani, B. Monica, I. Banerjee, O. C. Abraham, D. C. Mathai, B. Primrose, J. Muliyil, C. A. Wanke, H. D. Ward, and G. Kang. 2006. Multilocus genotyping of Cryptosporidium sp. isolates from human immunodeficiency virus-infected individuals in South India. J. Clin. Microbiol. 44632-634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nichols, R. A., B. M. Campbell, and H. V. Smith. 2003. Identification of Cryptosporidium spp. oocysts in United Kingdom noncarbonated natural mineral waters and drinking waters by using a modified nested PCR-restriction fragment length polymorphism assay. Appl. Environ. Microbiol. 694183-4189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sturbaum, G. D., C. Reed, P. J. Hoover, B. H. Jost, M. M. Marshall, and C. R. Sterling. 2001. Species-specific, nested PCR-restriction fragment length polymorphism detection of single Cryptosporidium parvum oocysts. Appl. Environ. Microbiol. 672665-2668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Sulaiman, I. M., A. A. Lal, and L. Xiao. 2002. Molecular phylogeny and evolutionary relationships of Cryptosporidium parasites at the actin locus. J. Parasitol. 88388-394. [DOI] [PubMed] [Google Scholar]
- 20.Sulaiman, I. M., U. M. Morgan, R. C. Thompson, A. A. Lal, and L. Xiao. 2000. Phylogenetic relationships of Cryptosporidium parasites based on the 70-kilodalton heat shock protein (HSP70) gene. Appl. Environ. Microbiol. 662385-2391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sulaiman, I. M., L. Xiao, and A. A. Lal. 1999. Evaluation of Cryptosporidium parvum genotyping techniques. Appl. Environ. Microbiol. 654431-4435. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Warren, C. A., and R. L. Guerrant. 2008. Clinical disease and pathology, p. 235-253. In R. Fayer and L. Xiao (ed.), Cryptosporidium and cryptosporidiosis, 2nd ed. CRC Press, Boca Raton, FL.
- 23.Xiao, L., L. Escalante, C. Yang, I. Sulaiman, A. A. Escalante, R. J. Montali, R. Fayer, and A. A. Lal. 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl. Environ. Microbiol. 651578-1583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Xiao, L., R. Fayer, U. Ryan, and S. J. Upton. 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin. Microbiol. Rev. 1772-97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xiao, L., J. R. Limor, L. Li, U. Morgan, R. C. Thompson, and A. A. Lal. 1999. Presence of heterogeneous copies of the small subunit rRNA gene in Cryptosporidium parvum human and marsupial genotypes and Cryptosporidium felis. J. Eukaryot Microbiol. 4644S-45S. [PubMed] [Google Scholar]
- 26.Xiao, L., U. M. Morgan, J. Limor, A. Escalante, M. Arrowood, W. Shulaw, R. C. Thompson, R. Fayer, and A. A. Lal. 1999. Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl. Environ. Microbiol. 653386-3391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Xiao, L., and U. M. Ryan. 2004. Cryptosporidiosis: an update in molecular epidemiology. Curr. Opin. Infect. Dis. 17483-490. [DOI] [PubMed] [Google Scholar]
- 28.Xiao, L., I. M. Sulaiman, U. M. Ryan, L. Zhou, E. R. Atwill, M. L. Tischler, X. Zhang, R. Fayer, and A. A. Lal. 2002. Host adaptation and host-parasite co-evolution in Cryptosporidium: implications for taxonomy and public health. Int. J. Parasitol. 321773-1785. [DOI] [PubMed] [Google Scholar]
- 29.Xu, P., G. Widmer, Y. Wang, L. S. Ozaki, J. M. Alves, M. G. Serrano, D. Puiu, P. Manque, D. Akiyoshi, A. J. Mackey, W. R. Pearson, P. H. Dear, A. T. Bankier, D. L. Peterson, M. S. Abrahamsen, V. Kapur, S. Tzipori, and G. A. Buck. 2004. The genome of Cryptosporidium hominis. Nature 4311107-1112. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.