Maternal undernutrition programmes atherosclerosis in the Apo E*3 Leiden mouse

Abstract

Poor quality of nutrition during fetal development is associated with adverse health outcomes in adult life. Epidemiological studies suggest that markers of fetal undernutrition are predictive of risk of metabolic syndrome and coronary heart disease. Here we show that feeding a low protein diet during pregnancy programmed development of atherosclerosis in ApoE*3 Leiden mice. ApoE*3 Leiden mice carry a mutation of human ApoE*3 rendering them prone to atherosclerosis when fed a diet rich in cholesterol. It was noted that fetal exposure to protein restriction led to a greater degree of dyslipidaemia in mice when fed an atherogenic diet, with low protein exposed ApoE*3 mice having elevated total plasma cholesterol (34% higher, P<0.001) and triglycerides (39% higher, P<0.001) relative to offspring exposed to a control diet in utero. The low protein group developed more severe atherosclerotic lesions within the aortic arch (2.61-fold greater lesion area, P<0.001). Analysis of a targeted gene array suggested a potential role for members of the LDL receptor superfamily, along with similar programmed suppression of the mRNA expression of hepatic SREBP-1c. This indicates that disordered lipid metabolism may play a role in the fetal programming of atherosclerosis in this model. Whereas earlier studies have shown early programming of cardiovascular risk factors, these results demonstrate for the first time that the interaction of prenatal undernutrition, with a postnatal atherogenic diet increases the extent of atherosclerotic disease.

INTRODUCTION

It is acknowledged that the onset and development of disease in adult life is associated with quantity and quality of nutrition during the fetal period¹. Epidemiological studies in developed and developing countries have strongly suggested that the intrauterine environment plays a role in determining risk of adult disease^2,3. Many cohort studies indicate that lower weight at birth, followed by rapid catch-up growth in childhood, is associated with risk of metabolic syndrome and cardiovascular disease in later life. It has been proposed that maternal undernutrition may “programme” long-term changes in gene expression and therefore metabolism in the fetus, resulting in cardiovascular abnormalities in later life⁴. While the origins of metabolic syndrome are multifactorial, maternal nutrition and its impact during fetal development may be an important contributing factor. Work from Napoli and colleagues, has for example demonstrated that atherosclerotic lesions begin to form during fetal life, in both humans and animals, and that this process is accelerated by maternal hypercholesterolaemia^5,6. Moreover the expression of genes that predispose to, or protect against, these conditions will be further modified by interactions between the genotype, early life nutrition and the postnatal environment⁷.

Transgenic mice with an altered lipoprotein metabolism, in particular transgenic and knock out mice based on the Apolipoprotein E (ApoE) gene, have provided important tools for elucidation of the relationships between hyperlipidemia and atherosclerosis. The ApoE*3 Leiden mouse carries a naturally occurring tandem duplication mutation of codons 120-126 in the human ApoE gene, on a C57Bl/6J background⁸. This results in impaired clearance of lipoproteins from the plasma, raised plasma lipid levels and greater susceptibility to developing atherosclerosis when the mice are fed diets rich in cholesterol⁹. Whilst other transgenic mouse strains, for example the LDL receptor knockout mouse, develop atherosclerosis even when fed a standard chow diet, the cholesterol-rich diet is an absolute requirement for the development of lesions in the ApoE*3 Leiden mouse. This makes this strain ideal for studies evaluating the influence of diet upon atherosclerosis and coronary heart disease.

Less than optimal intakes of protein remain commonplace throughout the world, impacting upon populations in developing countries and among the lower socioeconomic groups in developed nations. In the rat, fetal exposure to a maternal low protein diet has been consistently shown to programme high blood pressure, impairments of renal function, dyslipidaemia and glucose intolerance⁷. Although these phenotypes are commonly seen in the offspring of rodents and sheep subject to a variety of different manipulations of the maternal diet, they are all risk factors for disease rather than disease outcomes in their own right. In this study, therefore, we aimed to assess the capacity of undernutrition to programme atherosclerosis using the well-established low protein model.

MATERIALS AND METHODS

Animal protocols

All experiments involving mice were performed in accordance with the Animals (Scientific Procedures) Act 1986 and subject to UK Home Office regulations. Male and female mice (10-12 wk old) were maintained in a controlled environment (21°C, 55% humidity) with a 12 hr light-dark cycle. Animals were maintained on a standard laboratory chow diet (Beekay Universal) and had ad libitum access to food and water at all times. Male ApoE*3 Leiden transgenic mice, on a C57BL/6J background, were mated with wild-type C57BL/6J females. The ApoE*3 Leiden transgene is lethal to homozygotes, so this mating strategy was necessary to produce mice that were heterozygous for the transgene, and which would therefore be atherosclerosis-prone. All litters in the study therefore contained a mixed population of wild-type and transgenic offspring. The pregnant females were fed either a control (18% casein, n=20) or low protein (9% casein, n=22) diet, as described previously¹⁰. At birth all mothers were transferred to the same standard chow diet, therefore the offspring differed only in their prenatal dietary exposures. Mothers and offspring were otherwise left undisturbed until weaning, as preliminary work with these mice suggested handled pups may be rejected by their mothers. Offspring were genotyped using PCR prior to weaning at 28 days postnatal age. Based on their genotype, sex and prenatal experience offspring were then allocated to be fed either a chow diet or an atherogenic diet comprising 15% cocoa butter, 40.5% sucrose and 0.25% cholesterol. The latter was designed to induce the disease process, as in the ApoE*3 Leiden mice, cholesterol in the diet produces proportionate increases in circulating cholesterol⁹. There were eight treatment groups of male and female offspring from both control and low protein fed mothers. Offspring were of either wildtype or apoE*3 Leiden genotype. As, in keeping with previous studies of ApoE*3 Leiden mice¹¹, we observed neither significant hypercholesterolaemia, nor atherosclerosis in male offspring fed atherogenic diet, we report here only the data from the female offspring in the trial.

After 3 months of postnatal feeding, animals were killed using a rising concentration of carbon dioxide and were not fasted prior to cull. Whole blood was collected into vacutainers by heart puncture and plasma prepared by centrifugation at 13000 rpm at 4°C for 10 min. The liver, adipose (perirenal and gonadal depots), kidneys and abdominal aorta were dissected from each animal, weighed to the nearest 0.1mg and snap-frozen in liquid nitrogen. Hearts and the aortic root were dissected from each animal and infused with OCT fixing compound and snap-frozen in OCT until sectioning.

Genotyping of transgenic mice

Genomic DNA was extracted from 0.3 cm of mouse tail by standard procedures¹⁰. PCR was performed on genomic tail DNA using primers spanning the ApoE*3 Leiden mutation; Forward primer 5′ GCCCCGGCCTGGTACACTGC 3′, Reverse primer 5′ GGCACGGCTGTCCAAGGAGC 3′.

Measurement of plasma metabolites

Total circulating plasma cholesterol and triglycerides were assayed using commercially available kits (ThermoTrace, Noble Park, Victoria, Australia),according to manufacturer’s instructions. Assay linearity; Cholesterol (20 mmol/L), triglycerides (10 mmol/L). Assay sensitivity; Cholesterol (62 ΔmA per mmol/L), triglycerides (0.158 ΔA per mmol/L).

Histological analysis of the heart and aortic root

Frozen heart and aortic root samples were sectioned using a cryostat (Bright Instruments, Huntingdon, U.K.). Alternate sections of 10μm thickness were collected of the aortic root, stained with Oil Red O and imaged using a Nikon phase contrast 2 microscope and a MicroPublisher 3.3 RTV camera (Q Imaging, St. Helen’s, U.K.). Atherosclerotic lesions were analysed and quantified following the method of Paigen et al.,¹³ using Image Pro-Plus software to determine the percentage of the total area of the aortic intima exhibiting atherosclerotic lesions. The average lesion area for each animal was calculated using data from 15 sections per animal.

Oligo GEArray® Analysis of gene expression

In order to assess some of the mechanisms that might lead offspring of low protein fed mice to be more prone to atherosclerosis in postnatal life, we used a targeted DNA microarray to analyse transcripts in the liver. Liver was selected as the main tissue of interest, as earlier work with rats⁷ suggested programming of disturbed lipid metabolism could be of particular significance in the apoE*3 Leiden mouse. RNA was extracted from the livers of ApoE*3 Leiden female mice using the TRIzol® method (Invitrogen). RNA was quantified on a Nanodrop spectrophotometer (ND1000) and ribosomal band integrity was assessed on an agarose gel and an Agilent Bioanalyzer® (Agilent Technologies). cDNA and cRNA were synthesised and the latter labelled using the SuperArray TrueLabelling-AMP™ 2.0 kit (according to manufacturer’s instructions). Target cRNA was hybridized to each microarray using the Oligo GEArray® System (SuperArray), according to manufacturer’s guidelines. Four to six microarrays were used for each group, with RNA from one randomly selected mouse per group used per array. Microarrays were exposed to X-ray film for 30s, 1 min, 2 min and 5 min to identify the exposure time which produced the largest possible dynamic range in the individual signals. Images were captured using a Fluor-S multi-imager and saved as 16 bit TIFF images. Image analysis and data acquisition was performed using the GEArray Expression Analysis Suite (www.geasuite.com). The full list of genes included in the array is shown in Table 1. Data was normalised to the arithmetic mean of the housekeeping genes, Rps27a (Ribosomal protein S27a), B2m (Beta-2 microglobulin), Hspcb (Heat shock protein 1 beta) and Ppia (Peptidylprolyl isomerase A).

Table 1.

Full list of genes that were included in the microarray analysis

Mediators of the Response to Stress: Inflammatory Response: Apoa2, Ccl11, Ccl2, Ccl20, Ccl5, Ccr1, Ccr2, Cxcl1, Ifng, Il1a, Il1b, Il2, Itgb2, Pparg, Selp, Spp1, Tgfb1, Tnf. Response to Pest, Pathogen or Parasite: Fn1, Il10, Il2, Il4, Il6, Spp1. Other Genes Related to Stress Response: Apoe, Bax, Bcl2l1, Sod1, Sod2.

Apoptosis Anti-apoptosis: Bcl2, Bcl2l1, Birc3, Il10, Spp1, Vegfa. Induction of Apoptosis: Apoe, Bax, Tnfrsf6. Other Genes Related to Apoptosis: Bcl2a1a, Bid, Cflar, Ifng, Il6, Nfkb1, Sod1, Tnfaip3.

Blood Coagulation and Circulation: Apoe, F7, Npy, Ptgs1, Ptgs2, Vwf.

Adhesion Molecules: Cell-cell Adhesion: Cdh5, Icam1, Icam2, Vcam1. Cell-matrix Adhesion: Ctgf, Itga2, Itga5, Itgax, Itgb2, Itgb3, Itgb5, Itgb7, Spp1. Other Genes Involved in Adhesion: Cd36, Cd44, Eng, Fn1, Lama1, Scarb1, Sele, Sell, Selp, Selpl, Snn, Thbs4.

Extracellular Matrix (ECM) Molecules: ECM Protease Inhibitors: F7, Serpinb2, Serpine1. ECM Proteases: Ace, F7, Mmp13, Mmp1a, Mmp3, Mmp9, Serpinb2, Serpine1. Extracellular Matrix Structural Constituents: Col3a1, Eln, Lama1. Other Extracellular Molecules: Apoa1, Apoa2, Apoa4, Apoe, Ccl11, Ccl2, Ccl20, Ccl5, Cdh5, Csf1, Csf2, Csf3, Ctgf, Cxcl1, Dtr, Eng, Fga, Fgb, Fgf2, Fn1, Icam2, Ifnar2, Ifng, Il10, Il13, Il1a, Il1b, Il1r1, Il1r2, Il1rl1, Il2, Il3, Il4, Il5, Il6, Il7, Itga2, Itga5, Itgb2, Itgb5, Itgb7, Kdr, Lcat, Ldlr, Lif, Lpl, Npy, Pdgfa, Pdgfb, Pdgfrb, Ptgs1, Ptgs2, Sele, Selp, Selpl, Spp1, Tgfb1, Tgfb2,Tgfb3, Thbs4, Tnc, Vcam1, Vegfa, Vwf.

Lipid Transport and Metabolism: Cholesterol Metabolism: Abca1, Apoa1, Apoa2, Apoa4, Apoe, Il4, Lcat, Ldlr, Soat2. Fatty Acid Metabolism: Apoa2, Apob, Lypla1, Ppara, Ptgs1, Ptgs2. Lipid Transport: Abca1, Adfp, Apoa1, Apoa2, Apoa4, Apob, Apoe, Fabp3, Ldlr, Lpl, Msr1. Lipoprotein Metabolism: Abca1, Apoa1, Apoa2, Apoa4, Apoe, Ldlr, Lpl, Msr1, Olr1. Steroid Metabolism: Nr1h3, Ppara, Ppard, Pparg, Rxra, Soat2.

Cell Growth and Proliferation: Growth Factors and Receptors: Csf1, Csf2, Csf3, Ctgf, Cxcl1, Dtr, Fgf2, Il10, Il1a, Il1b, Il2, Il3, Il4, Il5, Il6, Il7, Kdr, Lif, Pdgfa, Pdgfb, Pdgfrb, Spp1, Tgfb1, Tgfb2, Tgfb3, Vegfa. Regulation of the Cell Cycle: Fgf2, Il1a, Il1b, Pdgfa, Pdgfb, Tgfb1, Tgfb2, Tgfb3, Vegfa. Other Genes Involved in Cell Growth and Proliferation: Eln, Eng, Fn1, Ifnar2, Ifng, Itga5, Itgb3, Ppard.

Regulators of Transcription: Nuclear Receptors: Nr1h3, Ppara, Ppard, Pparg, Rxra. Other Regulators of transcription: Ccl5, Egr1, Ifnar2, Ifng, Klf2, Nfkb1, Sod2.

Determination of mRNA expression

Quantitative PCR was performed as a follow up to the microarray studies. Hepatic RNA was extracted using the TRIzol® method (Invitrogen), according to manufacturer’s guidelines. cDNA was synthesised using MML-V Reverse Transcriptase (Promega) and quantitative RT-PCR was performed using a Roche Light Cycler 480® (Roche Diagnostics). Flurogenic probes were labelled with FAM (6-carboxy-fluorescin) at the 5′ end and with TAMRA (6-carboxy-tetramethyl-rhodamine) at the 3′ end. A negative template control and a relative standard curve were included on every PCR run. The standard curve was prepared from a pool of sample cDNA over a range of dilutions. Relative target quantity was calculated from the standard curve and all samples were normalised against the geometric mean of four housekeeping genes, β-actin, GAPDH, 36B4 and HPRT (hypoxanthine phosphoribosyl-transferase)¹⁴. Sequences of primers and probes used for RT-PCR are shown in Table 2.

Table 2. Probe and primer sequences for RT-PCR studies.

Gene	Sequences 5′ to 3′	Tm °C	Accession No.
36B4	F: GCTTCATTGTGGGAGCAGACA R: CATGGTGTTCTTGCCCATCAG Probe: TGGGAGGCCATCACAATTGTGGC	59.8 59.8 66.1	NM_007475
β-actin	Supplied by Applied Biosystems		NM_007393
GAPDH	F: GAACATCATCCCTGCATCCA R: CCAGTGAGCTTCCCGTTCA Probe: CTTGCCCACAGCCTTGGCAGC	65.9 66.5 75.1	DQ403055
HPRT	F: TTGCTCGAGATGTCATGAAGGA R: TGAGAGATCATCTCCACCAATAACTT Probe: TGGGAGGCCATCACAATTGTGGC	58.4 60.1 64.2	NM_013556
human apoE	F: CGTTGCTGGTCACATTCCTG R: GCTGTCTCTCCACCGCTTG Probe: CAGGATGCCAGGCCAAGGTGGA	59.4 61.0 65.8	NM_000041
mouse apoE	F: GCCCTGCTGTTGGTCACA R: TGATCTGTCACCTCCGGCTC Probe: TGCTGACAGGATGCCTAGCCGAGG	58.2 61.4 67.8	NM_009696
LDLr	F: GCATCAGCTTGGACAAGGTGT R: GGGAACAGCCACCATTGTTG Probe: CACTCCTTGATGGGCTCATCCGACC	59.8 59.4 67.9	NM_010700
LRP-1	F: TGGTCTGATGTGCGGACTCA R: AACAGATTTCGGGAGACCCAG Probe: TCTGCAGACTTGCCCAACGCCC	59.4 59.8 65.8	NM_008512
SREBP-1a	F: AGGCGGCTCTGGAAACAGA R: ATGTCGTTCAAACCGCTGTGT Probe: TGGCCGAGATGTGCGAACTGGA	67.3 66.6 76.1	NM_011480
SREBP-1c	F: ATCGGCGCGGAAGCTGTCGGGGTAGCGTC R: ACTGTCTTGGTTGTTGATGAGCTGGAGCAT Probe: CGGAGCCATGATTGCACATTTGA	85.5 74.9 75.2	NM_011480
SREBP-2	F: CAAGTCTGGCGTTCTGAGGAA R: ATGTTCTCCTGGCGCAGCT Probe: CCATTGATTACATCAATATCTGCAGCAGGTCAA	66.6 67.3 74.3	NM_033218
VLDLr	F: GCGAGAGCCTGCCTCCA R: CGCCCCAGTCTGACCAGT Probe: CTGTGGATCCGTTGTCGGGCTTTGT	60.0 60.5 66.3	NM_013703

Statistical Analysis

All data are presented as mean ± SEM. Unless stated otherwise in the text, data were analysed using a mixed model analysis using SPSS version 14.0. In the case of plasma triglycerides, cholesterol and mean atherosclerotic lesion area maternal diet, postnatal diet and genotype were the fixed factors and the results adjusted for within litter effects¹⁵. This adjustment removed the influence of having littermates within some of the groups and is an analytical approach we have used in our previous studies of programming^16,17. For microarray gene expression data and quantitative RT-PCR expression data, where only apoE*3 Leiden offspring were studied, maternal diet and postnatal diet were the fixed factors and results adjusted for within litter effects. It was not possible to identify differences between specific groups where the difference may have arisen through an interaction of two or more factors. Post-hoc tests were not performed where ANOVA indicated interactive effects.

RESULTS

Pregnant C67Bl/6J mice fed control or low protein diets gave birth to litters of similar size (control, 5.4±0.4 pups per litter, LP, 5.1±0.4 pups per litter). The ratio of males to females was similar in both prenatal dietary groups (control 0.92, low protein 0.90). The proportion of ApoE*3 Leiden mice produced by the pregnant mice was not significantly different (chi squared test, P>0.05) in the two maternal dietary groups (control, 37.3% transgenic, low protein 33.8% transgenic). Maternal food intake was similar in control and LP pregnancies (data not shown). Offspring were not weighed at birth in order to avoid maternal stress and rejection of pups, but as shown in Figure 1A, there were influences of maternal diet by the time the animals were weaned at 28d. Offspring exposed to low protein diets in utero were heavier (P=0.002) than those from control diet-fed dams. There were no differences in weight between animals of different genotypes, and weights of animals allocated to postnatal chow, or atherogenic diets were similar at the start of the feeding trial (Figure 1A). At the end of the 3 month feeding period the low protein-exposed offspring remained heavier than the prenatal controls (P=0.002), although this effect appeared to be confined to the C57Bl/6J strain (Figure 1B). At cull perirenal and gonadal fat pads were collected and carefully weighed. The sum of these fat pads, corrected for body weight, was used as a measure of abdominal fat deposition. It was noted that mice exposed to low protein diet in utero had more fat at these sites than controls (effect of maternal diet P=0.023). Feeding of the postnatal atherogenic diet increased fat depot size relative to body weight in C57Bl/6J mice (Figure 2), but this effect was not observed in the ApoE*3 Leiden mice (interaction of pre- and postnatal diets P=0.002).

Figure 1. Body weight at weaning and at cull.

Figure 1A: Body weight at weaning. Figure 1B: Body weight after 3 months of feeding chow or atherogenic diet. CON;maternal control diet, LP; maternal low protein diet. Data are shown as mean±SEM for n observations. Wild-type C57Bl/6J mice; Control chow n=10, Control atherogenic n=10, LP chow n=11, LP atherogenic n=13. Transgenic ApoE*3 Leiden mice; Control chow n=5, Control atherogenic n=8, LP chow n=6, LP atherogenic n=6. At weaning effect of maternal diet P=0.002. At end of trial effect of maternal diet P=0.002. * shows significant difference to control animals of same sex and genotype and fed the same postnatal diet (P<0.05).

Figure 2. Perirenal and gonadal fat depot size.

Total perirenal and gonadal fat depot weights were corrected for body weight to provide an indicator of relative fat depot size. Data are shown as mean±SEM. N-as described in Figure 1. Effect of maternal diet (P=0.023). Interaction of maternal and postnatal diets (P=0.002). * shows significant difference to control animals of same sex and genotype and fed the same postnatal diet (P<0.05).

The mice were culled after 3 months postnatal feeding, for collection of blood and tissues. As shown in Figure 3, the plasma cholesterol and triglyceride concentrations in the ApoE*3 Leiden mice were generally similar to wild-type C57Bl/6J offspring, when fed the chow diet. Females of the ApoE*3 Leiden strain developed a massive hypercholesterolaemic response to atherogenic diet (P<0.001). We observed an interactive effect of maternal diet and postnatal diet (P=0.029), indicating that ApoE*3 Leiden females exposed to low protein diet had higher total cholesterol concentrations following atherogenic diet, than those exposed to control diet in utero. Plasma triglyceride concentrations were higher in female ApoE*3 Leiden mice than in wild-type animals. As with cholesterol, the response to atherogenic diet was greater in the low protein exposed group than in the controls (genotype × maternal × postnatal diet interaction, P=0.047).

Figure 3. Cholesterol and triglyceride concentrations.

Figure 3A: Total plasma cholesterol. Figure 3B: Plasma triglycerides. Data are shown as mean ± SEM. N- as described in Figure 1. Analysis of variance indicated significant effects of maternal diet (P<0.001), atherogenic diet (P<0.001) and genotype (P<0.001) and interactions of maternal diet with diet and genotype (P<0.05) on both variables. * shows significant difference to control animals of same sex and genotype and fed the same postnatal diet (P<0.05).

The degree of atherosclerosis observed in female ApoE*3 Leiden offspring is shown in Figure 4. Wild-type animals showed no effects of either maternal diet or atherogenic diet (data not shown). However, when we considered lesion area in the ApoE*3 Leiden females it was clear that the atherogenic diet induced lesions to a significantly greater extent (2.61-fold) in the animals exposed to a low protein diet in utero than in those exposed to the control diet (P=0.005). In ApoE*3 Leiden animals, lesion area was strongly correlated with plasma cholesterol concentration (r=0.791, P<0.001, Pearsons correlation). The effects of both the prenatal protein restriction and the postnatal atherogenic diet were observed only in female offspring. This sex-specificity is a well-established feature of the ApoE*3 Leiden strain resulting from differences between males and females in terms of VLDL production and clearance rates within the liver¹¹. Thus, whilst females develop profound hypercholesterolaemia in response to cholesterol in the diet, the males are largely unaffected. Interestingly among humans carrying the same Leiden mutation, dysbetalipoproteinaemia is seen in both sexes¹⁸.

Figure 4. Area of intima exhibiting atherosclerotic lesions in female ApoE*3 Leiden mice.

Data are shown as mean ± SEM. N-as described in Figure 1. CON;maternal control diet, LP; maternal low protein diet. Analysis of variance indicated significant effects of maternal diet (P=0.001), atherogenic diet (P<0.001) and genotype (P<0.001) and interactions of maternal diet with diet and genotype (P<0.05). * shows significant difference to control animals of same sex and genotype and fed the same postnatal diet (P<0.05).

Animals exposed to a low protein diet in utero exhibited dysregulated lipid metabolism resulting in increased levels of circulating plasma lipids. The liver is the major organ in the control of lipid homeostasis, and so, to assess the potential mechanisms that caused the profound hypercholesterolaemia and increased lesion area in the aortic arch, we employed a targeted DNA Microarray to analyse any changes in hepatic gene expression (Oligo GEArray® DNA Microarray: Mouse Atherosclerosis, SuperArray). Total RNA isolated from the livers of female ApoE*3 Leiden mice was used to synthesize cRNA, which was hybridized to a pathway-specific microarray profiling the expression of 113 key genes involved in atherosclerosis. Table 3 shows the expression of genes from this array significantly affected by either prenatal or postnatal dietary challenges. Criteria for acceptance as a candidate gene for further investigation were observation of expression above minimum threshold levels, a fold change ≥2, or fold change ≤0.5, comparing maternal control and low protein diets and significance at P<0.05, derived from two-way ANOVA of n=4-6 array measurements per group. Using this fold change approach we identified 12 genes which were significantly regulated by prenatal undernutrition and a postnatal atherogenic diet. Expression of all of these targets was suppressed in low protein exposed, compared to maternal control diet exposed offspring. The majority of gene expression changes were to cytokines, growth factors and their receptors (9 out of 12 genes). The role of these genes in the liver in relation to atherosclerosis is questionable. Suppressed expression of the low density lipoprotein receptor (LDLr) and retinoid X receptor (RXR) in low-protein exposed livers was of greater interest, given their established roles in the hepatic metabolism of cholesterol and fatty acids^19,20.

Table 3. Microarray analysis of changes in gene expression with maternal protein restriction and atherogenic diet in livers from female ApoE*3 Leiden mice. Data are shown as fold changes of means for n=4 to 6 observations per group.

Gene Name	Symbol	GenBank I.D.	Fold Change (LP vs control) on chow diet	Fold Change (LP vs control) on atheroge nic diet	Effect of prenatal diet P	Fold Change Atheroge nic vs chow diet	Effect of postnatal die P	Prenatal × postnatal diet interaction P
Chemokine (C-C motif) ligand 2	Ccr2	NM_009915	0.31	0.37	0.004	0.67	0.737	0.004
Intracellular adhesion molecule 2	Icam2	NM_010494	0.32	0.53	0.023	0.50	0.630	0.023
Interleukin 10	Il10	NM_010548	0.26	0.34	0.003	0.61	0.036	0.004
Interleukin 1 receptor, type 1	Il1r1	NM_008362	0.31	0.54	0.014	0.63	0.864	0.014
Kinase insert domain protein receptor	Kdr	NM_010612	0.31	0.33	0.005	1.14	0.868	0.005
Low density lipoprotein receptor	Ldlr	NM_010700	0.33	0.34	0.032	0.73	0.807	0.032
Leukemia inhibitory factor	Lif	NM_008501	0.45	0.24	0.029	0.63	0.589	0.029
Platelet derived growth factor a	Pdgfa	NM_008808	0.24	0.39	0.045	0.64	0.340	0.045
Retinoid X receptor	Rxra	NM_011305	0.34	0.24	0.027	0.64	0.000	0.027
Superoxide dimutase 1, soluble	Sod1	XM_128337	0.46	0.48	0.018	0.28	0.000	0.018
Transforming growth factor, beta 3	Tgfb3	NM_009368	0.41	0.38	0.005	0.80	0.010	0.005
Tumor necrosis factor	Tnf	NM_013693	0.31	0.28	0.007	0.51	0.007	0.007

Given the observed association between plasma cholesterol concentration and the degree of atherosclerosis noted in the mice, we chose LDLr, as a candidate for further investigation following the microarray results. LDLr is a cell-surface receptor responsible for the endocytosis of cholesterol-rich low density lipoprotein (LDL). LDLr recognises ApoB100 on LDL particles, ApoE on chylomicron remnants and very low density lipoprotein (VLDL) particles. LDL is directly involved in the pathogenesis of atherosclerosis due to the accumulation of LDL-cholesterol in the blood²¹. Microarray analysis revealed a significant interactive effect of prenatal protein restriction and postnatal atherogenic diet on LDLr gene expression (mRNA expression down-regulated by 66% in low protein exposed mice; P=0.032). This result was partly verified by quantitative real-time PCR analysis of LDLr gene expression in the livers of female ApoE*3 Leiden mice (P=0.05, Figure 5A). Although there was no significant interaction between pre- and postnatal dietary influences observed, there was a trend towards decreased LDLr mRNA expression in the animals with increased atherosclerosis, that approached statistical significance (P=0.058). To further elucidate possible mechanisms that could contribute to the elevated plasma cholesterol concentrations, we also investigated changes in mRNA expression of two other members of the LDLr family of lipoprotein receptors, which were not included on the targeted DNA microarray; LDLr related-protein 1 (LRP-1) and very low density lipoprotein receptor (VLDLr), as shown in Figure 5A. Both of these latter receptors are important for the metabolism of ApoE-containing, triacylglycerol-rich lipoproteins. There was no significant effect of prenatal or postnatal dietary manipulations on VLDLr mRNA expression in the liver. There was however a significant interactive effect of protein restriction during pregnancy and postnatal atherogenic diet on expression of liver LRP-1 mRNA (P=0.009), which was reduced in animals exposed to a protein restricted diet in utero, particularly in those fed a chow diet postnatally.

Figure 5. RT-PCR quantification of hepatic mRNA levels in female ApoE*3 Leiden mice.

Figure 5A: Relative mRNA levels of liver LDLr, LRP-1 and VLDLr. Figure 5B: Relative mRNA levels of liver SREBP-2 and SREBP-1c. Data were normalised to the geometric mean of four housekeeping genes and are shown as mean ± SEM for n observations per group: Control chow n=5, Control atherogenic n=7, Low protein chow n=5, Low protein atherogenic n=6. CON; maternal control diet, LP; maternal low protein diet. Mixed model analysis indicated significant effects of maternal diet on LDLr (P=0.05), SREBP-1c (P=0.009) and LRP-1 (P=0.009), of atherogenic diet on LDLr (P=0.042) and SREBP-1c (P=0.035) and interactions of maternal diet with atherogenic diet on SREBP-1c (P=0.005) and LRP-1 (P=0.009). * shows significant difference to control animals of same sex and genotype and fed the same postnatal diet (P<0.05).

Sterol regulatory element binding proteins (SREBPs) are transcription factors with a pivotal role in the regulation of genes involved in lipid and lipoprotein metabolism²². Of the three isoforms expressed, SREBP-1c and SREBP-2 are the predominant forms in liver. SREBP-2 has been shown to regulate the majority of enzymes involved in the cholesterol synthetic pathway²³. Previous studies suggest that SREBP-2 is a primary regulator of LDLr gene expression²⁴ and that SREBP1c may be a target for programming by maternal protein restriction¹⁶. We measured the gene expression of all three SREBP isoforms in the liver. These genes were not present on the DNA microarray (Table 1, Figure 5B). There was no significant effect of either prenatal protein restriction or postnatal atherogenic diet on either SREBP-1a (data not shown) or SREBP-2 (Figure 5B). The expression of SREBP1c mRNA in liver was significantly lower in mice exposed to low protein diet in utero and fed chow in postnatal life, but similar in both groups of offspring fed the atherogenic diet (interaction of pre- and postnatal diet P=0.005). Quantitative real-time PCR confirmed that there was no significant effect of prenatal or postnatal diets on mouse or human ApoE mRNA expression (data not shown). Importantly, it can be concluded that the increased atherosclerosis noted in ApoE*3 Leiden mice exposed to low protein diet in utero was not a result of programming of increased expression of the transgene.

DISCUSSION

The key finding of this study is that the feeding of a maternal low protein diet programmes cholesterol metabolism and/or transport in the female atherosclerosis-prone ApoE*3 Leiden mouse. These metabolic changes appeared to be directly linked to the formation of a greater area of atherosclerotic lesions within the aortic arch. These findings are of major importance as this is the first demonstration using an animal model, that maternal undernutrition, as opposed to over-nutrition^5,6, can programme the outcome of cardiovascular disease, as opposed to simply cardiovascular risk factors. As such the study provides evidence to support for Barker’s developmental origins of adult disease hypothesis².

The mechanisms that link the maternal diet to development of atherosclerosis are, as yet, not well understood. It is clear from the current study that the programming of atherosclerosis and associated changes in lipid profile are specific metabolic and physiological effects of the low protein diet. There was no impact of the low protein diet upon litter size, upon the ratio of male to female animals, the ratio of wild-type to transgenic mice or postnatal survival. This allows us to rule out effects of protein undernutrition upon intrauterine or perinatal survival as drivers of later responses to the atherogenic diet. We also noted that the low protein-exposed mice appeared to have better growth to weaning and were slightly fatter than offspring of mice fed the control diet in pregnancy. In this study offspring were not weighed at birth in order to avoid disturbing the suckling mothers. Although the study lacks this important data, we would assert that our findings are unlikely to be the result of undernutrition followed by catch-up growth and is instead due to specific mechanisms impacting on lipid metabolism and transport. It has consistently been shown that exposure to moderate protein restriction during pregnancy (9% by weight) results in low-normal birth weight in rats^10,26,27. The finding of similar patterns of hepatic gene expression in these mice and in rats¹⁶ following exposure to low protein diets in utero, suggests that species differences have little impact upon the programmed responses that follow protein undernutrition in rodent pregnancy.

This paper has attempted to clarify potential mechanisms that result in the increased concentrations of plasma cholesterol and the degree of atherosclerotic injury. Certainly there appears to be fetal programming of cholesterol metabolism, as the low protein exposed mice exhibited a greater degree of hypercholesterolaemia in reponse to the atherogenic diet. Correlations and regression analysis indicated that plasma cholesterol concentrations were directly related to the extent of atherosclerosis (P<0.001). Our microarray studies indicated a potential role for the LDL receptor, although this was not entirely confirmed by quantitative PCR. Follow-up studies were suggestive of a role for another member of the LDLr family, LRP-1 and transcription factors that regulate lipoprotein metabolism in mediating the greater extent of disease. The LDLr and LRP-1 have well-established hepatic roles in the removal of pro-atherogenic lipoproteins from the plasma²⁵. A step-wise linear regression model suggested that although changes in LDLr, LRP-1 and SREBP-1c mRNA expression in the liver were not directly associated with lesion area, LRP-1 expression was significantly related to plasma cholesterol concentrations (P=0.027). This suggests that changes in hepatic gene expression in response to maternal protein restriction, particularly that of LRP-1, modulated the circulating levels of cholesterol, which in turn drove the increase in atherosclerosis. Loss of LRP-1 expression in the livers of mice lacking expression of LDLr, leads to accumulation of cholesterol-rich lipoproteins in the plasma²⁵. We noted under-expression of LDLr and suppression of LRP-1 in the livers of low-protein exposed mice, which also displayed a hyperlipidemic plasma (lipid) profile. We hypothesise that the programming effects of the low protein diet upon hepatic gene expression observed in the chow fed animals, may represent the baseline phenotype against which the atherogenic diet exerts disease-inducing effects. Whilst mice fed an atherogenic diet postnatally showed few significant differences between control and low protein exposed offspring, this is likely to reflect adaptations to three months of consuming a diet with a higher fat content. Further studies that consider a time course of responses to the atherogenic diet will be necessary to test this hypothesis as gene expression measurements were only made at 16 weeks of age, after 12 weeks of feeding postnatal diets. Given that the mRNA analyses provide only preliminary evidence of likely mechanisms, it would also be desirable to confirm changes in gene expression at the protein level.

We have previously shown in rats, that many aspects of lipid metabolism, including expression of SREBP1c, are programmed by fetal protein restriction, and that plasma total cholesterol is elevated in older female offspring¹¹. Other studies have suggested that maternal hypercholesterolaemia during pregnancy may programme atherosclerosis in the offspring of rabbits and LDLr knockout mice^5,6,28,29. These studies provide important information about the mechanisms that link maternal over-nutrition to development of atherosclerosis in the developing fetus.. It is unlikely that the undernutrition experienced during pregnancy by the mice in our study would programme disease through the same mechanisms, since all mothers used within the study were of the wild-type C57BL/6 background strain which are relatively resistant to the development of lipid abnormalities, even when fed a diet rich in cholesterol and saturated fat (see Figure 3). It is also unlikely that a mild-moderate restriction of protein against a 10% corn oil diet containing no cholesterol would impact upon maternal plasma lipid profiles. However we do acknowledge that one of the limitations of this study was that no measurements were made of the maternal metabolic profile whilst consuming the low protein diet. It would be of considerable interest to test whether this diet could modify lipid profiles and mediate increased risk of atherosclerosis in the offspring through the same mechanism as noted in the rabbit and LDLr models. It should be noted, however, that our experience from studies of pregnant rats fed the same diet is that triglyceride and total cholesterol concentrations do not change with low protein feeding (Engeham and Langley-Evans, unpublished observations).

We have shown that the development of atherosclerosis is dependent on the interaction of genotype, prenatal diet and postnatal diet. This highlights the importance of gene-nutrient interactions at very early stages of life in the etiology of disease, and indicates that the nature of those interactions influences the responses made to dietary challenges at later stages. This is the first study to demonstrate, experimentally, that undernutrition during fetal life can determine the risk of developing atherosclerosis in adulthood. As such it provides strong support for the developmental origins of health and disease hypothesis^1,7. It is important to note that within the study we only examined the effects of a single level of protein restriction upon development of atherosclerosis. Further studies will need to examine whether there is a linear dose-response relationship, or whether as with hypertension in rats subject to protein restriction, there is a simple threshold at which programmed responses occur¹⁰. The ApoE*3 Leiden mouse is a unique resource, in that the postnatal diet rich in cholesterol is an absolute requirement for the appearance of the atherosclerotic phenotype. This mirrors the etiology of human atherosclerosis and as such makes the ApoE*3 Leiden mouse an ideal model for further explanation of the mechanistic basis of fetal programming. Given that a high proportion of adults in countries currently undergoing economic and nutritional transition will have been exposed to suboptimal nutrition in utero, these findings may have major implications for global public health.