Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jul 23.
Published in final edited form as: Vaccine. 2008 May 23;26(31):3853–3859. doi: 10.1016/j.vaccine.2008.05.007

Immunological diversity within a family of cutinase-like proteins of Mycobacterium tuberculosis

Nicholas P West a,*, Teresa M Wozniak a, Jesus Valenzuela b, Carl G Feng c, Alan Sher c, Jose MC Ribeiro b, Warwick J Britton a,d
PMCID: PMC2671993  NIHMSID: NIHMS103222  PMID: 18565629

Abstract

Secreted proteins of Mycobacterium tuberculosis play key roles in the assembly of the mycobacterial cell wall, with many being major targets of the host immune response. To date, meaningful characterization of a significant proportion of this important group of proteins is lacking. Among the group of putatively secreted proteins of M. tuberculosis are 7 cutinase-like proteins (CLP), not previously characterized in terms of their immunogenicity or vaccine protective efficacy. Although the CLP vary in the degree of homology with one another, they all share a similar active catalytic triad, closely homologous to that of the cutinase of Fusarium solani. By construction of DNA vaccines of all 7 CLP, and expression and purification of soluble, recombinant CLP, this study addresses the immunological responses to these proteins. Clp1, 2, 3 and 6 were found to elicit significant IFN-γ secretion in DNA immunized mice, with the antigens also demonstrating specificity in terms of CLP-generated T cell IFN-γ release, with minimal cross reactivity of humoral responses. Finally, following delivery of DNA vaccines, Clp1, 2 and 6, conferred a moderate yet reproducible and significant level of protection in a murine aerosol model of M. tuberculosis infection.

Keywords: Tuberculosis, Cuntinase, Vaccine, Immunology

1. Introduction

Mycobacterium tuberculosis continues to be one of the leading causes of death owing to an infectious disease. Approximately 2 billion people are infected with the bacteria with 8 million developing active disease per year [1,2]. In order to understand the process of M. tuberculosis pathogenesis and host immune activation, a great deal of attention has been given to those proteins destined for secretion. This has arisen from the fact that a large number of proteins are secreted from M. tuberculosis at key stages of host infection, such as within the macrophage phagosome, as well as during in vitro culture [3]. An array of key virulence determinants and immunogens are secreted by many pathogenic bacterial species. Examples of these include the well described and intricate systems of Gram-negative bacteria but also other intracellular, Gram-positive bacteria. M. tuberculosis possesses multiple systems dedicated to the export of proteins, secreting at least 250 [4,5]. In addition to the classical SecA dependant system, by which the well described, immunogenic antigen 85 complex is exported [6], M. tuberculosis also contains a second SecA protein, namely SecA2, which is necessary for full virulence through the translocation of SodA in response to oxidative stress [7]. Additionally, the SecA2 pathway is necessary for replication of the bacterium in murine macrophages ex vivo [8]. Furthermore, M. tuberculosis possesses an additional novel secretion mechanism, encoded by the ESX-1 locus, by which other important virulence determinants and immunologically dominant antigens are secreted by M. tuberculosis, i.e. early secreted antigen T cell 6 (ESAT-6) and culture filtrate protein 10 (CFP10) [9]. Although advances have been made in appreciating the repertoire of secreted proteins by analysis of the proteome [10,11], these methods are limited to the identification of proteins expressed under particular experimental in vitro conditions, which may not fully reflect the extent of secretion possibilities that may occur during in vivo survival. To utilize the abundant information offered by the annotated genome sequence [12] we have undertaken a bioinformatic approach to identify proteins with the potential for secretion in any condition. Our analysis identified a family of 7 cutinase-like proteins (CLP), 6 with putative secretion signals and sharing 17–63% homology with one another. All CLP have a similar predicted functional site as that of the well characterised cutinase from Fusarium solani [13], a feature which also had them grouped in a recent separate study [14]. Cutinases are serine hydrolases, which cleave complex glycolipid polymers, and are important secreted virulence factors in fungal pathogens of plants [15]. The role of bacterial cutinases, however, is not well described, with those identified to date being largely confined to saprophytic species and those pathogenic to plants, such as the pseudomonads [16,17]. We have prepared DNA vaccines expressing all 7 family member proteins and tested their ability to confer protection in a murine aerosol TB challenge model. Four of the M. tuberculosis CLP were selected and purified following expression in Escherichia coli and utilized to examine immunogenic potential. These studies reveal immunological diversity between the members of this family.

2. Materials and methods

2.1. Bacterial growth conditions

M. tuberculosis H37Rv (ATCC 27294) was grown in Proskauer and Beck liquid medium for 14 days and M. bovis was grown in Middlebrook 7H9 broth supplemented with ADC (Difco Laboratories, Detroit, MI) for 14 days at 37 °C. The bacteria were enumerated on OADC enriched Middlebrook 7H11 agar and stored in 30% glycerol/Phosphate buffered saline (PBS) at −70 °C. For plasmid preparations, Escherichia coli was grown in Luria-Bertani (LB) broth or on LB agar. Ampicillin (100 μg/ml) was supplemented as necessary.

2.2. Bioinformatic procedures

The proteome of M. tuberculosis H37Rv was downloaded from the Sanger site at http://www.sanger.ac.uk/Projects/Mtuberculosis/ and batch submitted to the SignalP server [18] (http://www.cbs.dtu.dk/services/SignalP/) to identify putative signal peptides indicative of secretion using both the neural network and hidden Markov models of prediction applied to Gram-positive bacteria. The proteome was compared to the COG and CDD databases [19,20] using the program rpsblast [21] and to the non-redundant protein database of the National Centre for Biotechnology Information using the program blastp with the low complexity filter off. The output of all programs above was piped into a hyperlinked Excel spreadsheet by tailored programs written in Visual Basic 6.0 (Microsoft Corp., Redmond, CA). The program clustalW [22] was used to align the protein sequences and to produce the phylogenetic tree.

2.3. DNA vaccines

The individual clp genes were amplified from M. tuberculosis H37Rv genomic DNA by PCR with primers listed in Table 1. Amplified products were cloned directly into VR1002-TOPO [23], a mammalian expression vector modified from VR1020 [24], which utilizes the tissue plasminogen activator signal peptide and the human cytomegalovirus promotor for expression. Clones were sequenced prior to use to confirm integrity and orientation.

Table 1.

Primers used in DNA vaccine construction and recombinant protein expression

Primer Sequence 5′–3′ 1st CLP aa
C1dnaFOR GATCCGTGTTCGGACATCGCG D33
C1dnaREV ACAACAGTCTTTGATCATCCGGCG
C2dnaFOR GCCTGCCCCGACGCCG A33
C2dnaREV GAAAGCGTGAAGCAAAGACTCGC
C3dnaFOR GATGGATGCCCGGACGCCGAAG D27
C3dnaREV TCACCCCGATGAACCTCATGACGC
C4dnaFOR CCACCGGCATCGGCGGGCTGCC P41
C4dnaREV GGCGGCGCAGCCGTTGCTTAGCC
C5dnaFOR ATGCCGGGGCGGTTCAGAG M1
C5dnaREV TCACGACGTCCGATCGGTG
C6dnaFOR CTGGTCATCGTGGCCGTGGTG L27
C6dnaREV CGCCGCCTAGCGTCCATCG
C7dnaFOR GCGTCGGAGGACTGTTCGTC A11
C7dnaREV TGGGGTGGCAGCGCAGTTC
C1protFOR TGCGGATCCGTGTTCGGAC A32
C1protREV ATTGGATCCAGCGGTATAGGGACAACAGTC
C2protFOR ATTGGATCCCACTGCAGCCTGCCCCG T31
C2protREV ATTGGATCCTATTGCAGCTTTCCGGC
C3protFOR ATTCTCGAGGTTGCCTTCGCCGATGG V23
C3protREV ATTCTCGAGTCACCCCGATGAACCTCATGAC
C6protFOR ATGGATCCGCCGTGGTGATCATGCTG A31
C6protREV ATGGATCCTAGCGTCCATCGTC
Open in a new tab

Restriction sites used for cloning are underlined and the first CLP specific codon indicated in bold with the resultant amino acid and its position in the unprocessed protein also shown.

2.4. Protein expression and purification of inclusion bodies

CLP were cloned without putative signal sequences, when present, into an E. coli expression vector (pET19b, Novagen) following amplification of each from H37Rv genomic DNA using the primers listed in Table 1. Protein expression was driven by the T7 promotor, induced with 0.5 mM IPTG and incubated at 37 °C for 4–16 h depending on protein. This resulted in over-expression of N-terminally His-tagged cytoplasmic proteins, which aggregated as insoluble inclusion bodies. Inclusion bodies containing the recombinant proteins were purified as follows. The cell pellet recovered from an overnight, E. coli BL21 (DE3) expression culture was resuspended in 20 ml buffer (50 mM HEPES pH 7.5, 0.5 M NaCl, 10 mM EDTA, 5 mM DTT, 0.35 mg/ml lysozyme, 1 mM PMSF) per litre of culture and slowly agitated at RT for 30 min. Triton-X-100 was added (1%, v/v) and cells ruptured with 3 freeze/thaw cycles in liquid nitrogen. Chromosomal DNA was sheared by sonication and extract treated with DNase I (0.03 mg/ml) for 2 h at 37 °C. Inclusion bodies were pelleted following centrifugation at 30,000 × g for 30 min and washed 2–3 times (PBS with 1% Triton-X-100 and 1 mM EDTA), spinning as above between each wash. Following the final spin, the pelleted inclusion bodies were solubilised in 2 ml of buffer (50 mM HEPES pH 7.5, 6 M guanidine HCl, 25 mM DTT) for a minimum of 2 h. In order to remove remaining aggregates, a final high speed spin (100,000 × g) was necessary. Solubilised inclusion bodies were purified by Talon (Clontech), Co2+ charged immobilized metal affinity chromatography (IMAC) according to manufactures instructions. Briefly, a batch/gravity format was conducted where His-tagged proteins are bound and washed to the resin in ‘batch’ with gentle agitation. Following this the resin was transferred to a 20 ml disposable column for one last wash and elution by ‘gravity’. The His-tagged proteins were eluted by the addition of 150 mM imidazole containing buffer.

2.5. Protein refolding

Proteins were refolded by a rapid dilution (20×), at 4 °C, into a set of 15 buffers prepared as described in the Quick Fold Protein Refolding kit manual (AthenaES, Baltimore). Proteins were then analyzed for solubility to identify the protein specific, optimal refolding conditions. A buffer composed of 50 mM Tris (pH 8.5), 9.6 mM NaCl, 0.4 mM KCl, 0.4 M sucrose, 0.05% PEG 3550, 0.5% Triton-X-100, 2 mM MgCl2, 2 mM CaCl2, with 1 mM GSH and 0.1 mM GSSH was selected to fold all proteins. Proteins were allowed to fold overnight with gentle stirring.

2.6. PAGE and Western blot

Protein samples were separated on a 12% SDS-polyacrylamide resolving gel and stained with coomassie blue. For Western blot, equivalent amounts of the protein samples were loaded along with prestained molecular weight standards (BioRad) and transferred to PVDF membrane. Blots were probed with anti-His (Qiagen) or anti-CLP (1:100) antibodies as required. HRP-conjugated secondary antibodies were used and blot developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce) and visualized on a Kodak 4000 mm Image Station (Eastman Kodak, Rochester, NY).

2.7. Immunization

Six to eight weeks old C57BL/6 female mice were obtained from Animal Resources Centre (Perth, Australia) and maintained in specific pathogen free conditions. Mice were immunized with 100 μg DNA vaccine encoding each CLP (1, 2, 3, 4, 5, 6, 7) or control vector, pcDNA3 (Invitrogen), by intramuscular (im) injection of 50 μl into each tibialis anterior muscle. Control mice were immunized subcutaneously with Mycobacterium bovis (bacille Calmette Guerin, BCG) at least 100 days prior to challenge at a dose of 5 × 105 CFU.

2.8. M. tuberculosis challenge

Six weeks following final DNA immunization, mice were challenged with aerosol M. tuberculosis H37Rv with an infective dose of approximately 100 CFU per lung using a Middlebrook airborne infection apparatus (Glas-Col, Terre Haute, Ind.). At four weeks post challenge, selected organs were homogenized, and plated as 10-fold dilutions on supplemented Middlebrook 7H11 Bacto agar.

2.9. Antibody measurement

Serum CLP-specific antibody levels were detected by ELISA as previously described [25]. Briefly, plates were coated with purified recombinant Clp1, 2, 3 or 6 (2 μg/ml) and sera of immunized and control mice was titrated five-fold to completion. Levels of anti-CLP Ab were detected with alkaline phosphate conjugated IgG, and subsequent development with n-nitrophenyl phosphate (1 mg/ml) (Sigma). The mean absorbance plus three standard deviations of normal mouse sera, diluted at 1:100, was adopted as the cut-off absorbance for determining antibody titers.

2.10. ELIspot for IFN-γ-producing cells

Antigen-specific IFN-γ secreting cells were measure by ELIspot. The anti-IFN-γ antibody, AN18 (Endogen, Woburn, MA) was coated onto 96 well, Immobilon-P plates (Millipore, Bedford, MA). Splenocyte samples were seeded at 2 × 105 cells per well and incubated with purified Clp1, 2, 3 or 6 (10 μg/ml) or media alone. Following 16 h of incubation at 37 °C, the plates were washed and incubated for 1 h with biotinylated anti-IFN-γ antibody, XMG 1.2 (Endogen) followed by streptavidin–alkaline phosphate conjugate. The number of spot forming cells were enumerated with an automated ELIspot reader system (AID, Strasburg, Germany)

2.11. Statistical analysis

Statistical analysis of the results from log10 transformed data was carried out using analysis of variance (ANOVA). Fisher’s Protected Least Significant Difference ANOVA post hoc test was used for pair-wise comparison of multi-grouped data sets. Differences with p < 0.05 were considered to be significant.

3. Results

3.1. Cutinase identification and classification

The signalP server [18] was queried to identify the presence of putative secretion signals in the M. tuberculosis proteome. Those proteins determined to have secretion potential were grouped by possible functional similarities. Seven proteins clustered with homologies ranging from 17 to 63% at an amino acid level (Table 2). Two of these proteins have been previously identified in filtrates of M. tuberculosis cultures, i.e. Cfp21 (Rv1984c) and Cfp25 (Rv2301), which are reported here as Clp1 and Clp2 respectively [26]. These proteins, as other members of the family, share homology to a fungal cutinase and have therefore been classed as a family of cutinase-like proteins.

Table 2.

Percentage homology of mature cutinase-like proteins (CLP) of M. tuberculosis as determined by clustalW

Clp1 Clp2 Clp3 Clp4 Clp5 Clp6 Clp7
Rv1984c Clp1 100
Rv2301 Clp2 44 100
Rv3451 Clp3 49 39 100
Rv3452 Clp4 53 54 63 100
Rv1758 Clp5 49 39 36 45 100
Rv3802c Clp6 20 22 17 21 18 100
Rv3724 Clp7 49 38 35 46 56 27 100
Open in a new tab

3.2. Expression and purification

Four CLP were cloned into an E. coli expression vector that resulted in an N-terminally His tagged protein. Following over-expression, purification of chemically solublized CLP was achieved using Co2+ charged immobilized metal affinity chromatography (IMAC). The CLP were then refolded in a buffer series, which varied in their components, so as to address critical and unique physiochemical refolding conditions for the proteins, including pH, oxidation state, ionic strength, as well as the presence of chaotropic and polar agents. This resulted in refolded, soluble and pure recombinant proteins (Fig. 1), allowing further characterization of the individual proteins immunologically.

Fig. 1.

Fig. 1

Open in a new tab

Purified, refolded recombinant CLP. Coomassie stained CLP shown following E. coli expression and HIS-tag purification. Lane 1: Clp1; lane 2: Clp2; lane 3: Clp3; lane 4: Clp6.

3.3. Immunogenicity

The humoral response to immunization with DNA vaccines expressing CLP was analyzed by Western blot and an anti-Clp IgG antibody ELISA. Western blot analysis of the four purified CLP demonstrated specificity of the anti-CLP antisera. When blots of purified Clp1, Clp2, Clp3 and Clp6 were probed with antiserum raised against the product of each CLP DNA vaccine, only the protein specific for its own immune serum was detected indicating a lack of cross reactivity between the antiserum, at least at the limits of detection by Western blot (Fig. 2). A more accurate evaluation of the specificity of serological responses was determined by IgG antibody ELISA and were also shown to be distinct and specific for each antigen (Table 3). High titers were observed for all four CLP with Clp1 and Clp3 being the highest with titers greater than 10,000. Sera from clp1, clp2, and clp3 immunized mice demonstrated IgG titers at least 20 fold higher for their respective antigens compared to the next highest cross reacting antigen, indicating a surprising degree of specificity for proteins of the same enzymatic class that share a significant level of homology (39–49%) between them.

Fig. 2.

Fig. 2

Open in a new tab

Antigen specificity determined by Western blot. (a) Western blot of Clp1, 2, 3 and 6 loaded in lanes 1–4 respectively and probed with anti-Clp2. (b) Composite figure of the positive detection of Clp1, 3 and 6 resulting from their relative immune sera. As in (a), no detection of other CLP family members was observed with antisera from another immunizing antigen (lanes not shown). Molecular weight standards (M) with sizes (kDa) are shown to the left.

Table 3.

Serological responses of mice immunized with DNA vaccines expressing CLP

Mouse Serum Protein antigens
Clp1 Clp2 Clp3 Clp6
Anti-Clp1 >10000 ND 3000 150
Anti-Clp2 250 1800 300 150
Anti-Clp3 500 ND 10000 ND
Anti-Clp6 ND ND 2200 6500
Open in a new tab

Data represent the mean IgG titers for five mice, at a cut-off three times the level for non-immunized sera and are representative of two experiments.

For cell-mediated immunological responses spleens were harvested from DNA vaccinated mice and antigen specific T cells determined by an ex vivo ELIspot assay. DNA immunization stimulated a strong T cell response, with the most vigorous IFN-γ-secreting T cell responses being elicited predominately for their specific recall antigen (Fig. 3). In particular, clp1 and clp2 immunized mice both responded with approximately 1000 IFN-γ cells per 106 splenocytes when recalled to Clp1 and Clp2 respectively (Fig. 3A and B), indicating that 0.1% of splenocytes were antigen specific T cells. Immunization with clp3 and clp6 also generated specific IFN-γ-secreting T cells, albeit to a lesser degree than those with clp1 and clp2. The T cells of clp3-immunized mice were stimulated by Clp3 and Clp6 with the reciprocal relationship existing for clp6 immunized mice also, in that splenocytes respond strongly to Clp3 and Clp6. This suggests that a dominant T cell epitope in C57BL/6 mice is shared between Clp3 and Clp6.

Fig. 3.

Fig. 3

Open in a new tab

Antigen-specific T cell responses from CLP immunized mice. IFN-γ secreting cells were enumerated by ELIspot following recall to antigens at 10 μg/ml, for mice immunized with DNA vaccines expressing: (A) Clp1; (B) Clp2; (C) Clp3; (D) Clp6. The IFN-γ T cell responses in splenocytes from control vector immunized mice, stimulated with each of the CLP antigens were subtracted from the corresponding samples of DNA vaccine immunized mice. These values were: Clp1 protein, 190; Clp2 protein, 42; Clp3 protein, 194; Clp6 protein, 254. Data are the means and standard errors for five mice and are representative of one of two experiments. Statistical significance was determined by ANOVA; **p < 0.001, ***p < 0.0001, NS; not significant, ND; not detected

3.4. CLP as protective antigens

Many of the secreted proteins of M. tuberculosis tested as possible vaccine antigens have proven to be protective, of which the best-known examples are members of the antigen 85 complex and ESAT-6. To determine if the individual CLP could confer protective immunity, C57BL/6 mice were immunized with DNA vaccines encoding each of the 7 genes. Plasmid clp1, 2, and 6 immunized mice repeatedly demonstrated a significant level of protection as evidenced by a reduced bacterial load in the lungs, up to a 0.5 log10 reduction, compared to mice immunized with control plasmid (p < 0.001) (Fig. 4). Immunization with plasmid clp3, clp4, clp5 and clp7 did not induce a consistently significant level of protection in biological repeats of the experiment (data not shown). Furthermore, immunization with plasmids encoding CLP genes did not prevent dissemination of M. tuberculosis into the spleens of infected mice.

Fig. 4.

Fig. 4

Open in a new tab

CLP DNA vaccination protects mice from TB challenge. Immunization with DNA vaccines expressing the Clp1, 2 and 6 confers partial protection against M. tuberculosis H37Rv infection following aerosol challenge. Parental vector (Cont) and BCG were used as negative and positive controls respectively. Data are the means ± S.E.M. for five mice and are representative of duplicate experiments. Statistical significance was determined by ANOVA; *p < 0.001, **p < 0.0001.

4. Discussion

In the present study we have initiated the immunological characterization of the putatively secreted family of cutinase-like proteins of M. tuberculosis and revealed immunological diversity between its members. Some CLP elicit distinct immune responses in both the cell mediated and humoral compartments and some members are shown to protect mice partially from challenge with virulent M. tuberculosis.

The importance of various secreted gene products of M. tuberculosis, in terms of immunogenic potential is established, with some being frequently included in multi-component vaccines, such as Ag85, ESAT-6 and CFP10 [27–29]. The success of these secreted proteins in vaccines drives the search for further immunogenic and protective antigens. By utilizing an efficient set of bioinformatic algorithms we highlighted the family of cutinase-like proteins from M. tuberculosis, and produced soluble, refolded recombinant CLP allowing the characterization reported here.

The first description of cutinase-like proteins in M. tuberculosis were as short term (7 day), culture filtrate proteins (CFP), Cfp21 and Cfp25, here termed Clp1 and Clp2 respectively [26]. These antigens were potent inducers of IFN-γ from memory T lymphocytes from M. tuberculosis-infected mice and elicited strong delayed type hypersensitivity response in M. tuberculosis-sensitized guinea pigs [26]. Subsequent studies revealed that Clp1 vaccination resulted in cytotoxic T lymphocyte activity in mice [30] and further, one or both of these antigens were also recognized by tuberculosis patients [31,32]. The current study demonstrates that Clp1, Clp2, Clp3 and Clp6, when delivered as DNA vaccines, induced potent IFN-γ secreting T lymphocyte and strong specific IgG responses in immunized mice. Overall, the T cell response was specific to the individual CLP, with limited cross reactivity. For example, splenocytes from mice immunized with Clp1 did not respond to reactivation with the other CLP. Clp3 and Clp6, however, did appear to share a T cell epitope in H-2b mice, even though these two proteins have the least aa homology within the group (Table 1). Regions of high homology do exist between the proteins, and further experimental work is required to determine if one or more of these regions may contain this epitope.

Direct evidence for secretion of the CLP family members is lacking. Secretion of Clp1 and Clp2 into the culture supernatant has been demonstrated previously [26], and indeed this observation has been confirmed by us by immunoblotting with anti-CLP antiserum (results not shown). However we were not able to detect other CLP in M. tuberculosis CFP. Clp4 has recently been reported to be secreted into culture supernatant by Mycobacterium smegmatis yet reside only within the cell wall of M. tuberculosis [14]. One member of the family, Clp5, lacks the classical secretion signal and would appear to be restricted to the cytoplasm unless secreted by another mechanism. Secretion of several CLP may be occurring at a very low concentration, below the detection possible offered by the anti-CLP antibodies generated by DNA vaccination. Further work is needed with improved reagents and more sensitive assays to clarify the actual secretion potential of these proteins and if so, by which mechanism.

DNA vaccination has been demonstrated to result in legitimate protein folding within the cells that take up and express the vaccine vector, particularly for viral antigens [33,34]. Although conformational epitopes might exist, the IgG epitopes of the CLP would be polyclonal and predominantly linear. This assumption is made based on the Western blot containing reduced proteins, thereby exposing linear epitopes only. Conformational epitopes may represent some of the labeling seen in the ELISA analysis as these were performed with in vitro refolded proteins as target.

The positive immunogenicity seen translated into protection when DNA immunized mice were challenged with virulent M. tuberculosis. DNA immunization with plasmids expressing Clp1, Clp2 and Clp6 consistently stimulated a significant, albeit a moderate, level of protection against aerosol M. tuberculosis challenge similar to that observed with DNA vaccines expressing other M. tuberculosis proteins [35]. Further this level correlates with protection reported when Clp1 was administered as protein, adjuvanted with DDA [30]. CLP have also been included in multivalent vaccines. Immunization with vaccines containing Clp1 as a component, either as DNA [28] or protein delivered with monophosphoryl lipid (MPL) and/or dimethyl-dioctadecylammonium (DDA) [29], stimulated protective immunity against M. tuberculosis. A multivalent protein vaccine containing Clp2 also stimulated a similar degree of protection [31]. It is however difficult to ascertain the contribution of the CLP in these studies as they were partnered by well defined, immuno-dominant mycobacterial antigens. We believe this study demonstrates that the CLP may have played a role in conferring protection in these previous studies and taken together, indicate the potential of CLP as future vaccine components. Further work is underway to establish whether the CLP members can demonstrate superior protective effects when administered as either single or multiple proteins with the appropriate adjuvants.

The real value of subunit vaccines, such as DNA encoded vaccines, may be in their use as boosting vaccines following BCG immunizations [36]. It is interesting to note that not all CLP are present in all strains of BCG. Clp1 is encoded within RD2, a 10.7 kb chromosomal region deleted from the original BCG Pasteur strain sometime after its derivation [37]. With the exception of Clp1, BCG Pasteur (ATCC 35734) encodes all CLP, so their use as homologous boosting antigens may reactivate effective memory immune responses. Including Clp1 in a subunit vaccine would potentially have a similar effect in those vaccinated with RD2 containing BCG strains but further, may act as a priming antigen when used as a heterologous boost in BCGΔRD2 vaccinated individuals. Further work is required to define the potential use of CLP as BCG boosting vaccines.

Unlike the Antigen 85 complex, which are known to associate with the mycobacterial cell wall where they are required for its assembly [38], the functions of most CLP are not yet defined. Homology searches identify the CLP as potential serine esterases belonging to the α/β-hydrolase superfamily [39] and as such may possess lipolytic and/or esterase activities. Phospholipase A activity has recently been attributed to Clp4 [14], indicating yet a further potential substrate range for the CLP family. Due to their secretion potential it could be hypothesized that one or more CLP are involved in synthesis or maintenance of the cell wall and/or nutrient scavenging, thereby having a direct role in the virulence of M. tuberculosis. The number of CLP in the M. tuberculosis genome and the conservation of this enzymatic class in other Mycobateria may indicate an important role for these proteins and might therefore highlight their potential as vaccine constituents or drug targets and is the subject of ongoing work.

Acknowledgments

This study was supported by the National Health and Medical Research Council of Australia and the NSW Government through its infrastructure grant to the Centenary Institute. We thank N. Field and V. Roknic for their technical assistance.

References

  • 1.Dye C. Global epidemiology of tuberculosis. Lancet. 2006;367(9514):938–40. doi: 10.1016/S0140-6736(06)68384-0. [DOI] [PubMed] [Google Scholar]
  • 2.Meya DB, McAdam KP. The TB pandemic: an old problem seeking new solutions. J Intern Med. 2007;261(4):309–29. doi: 10.1111/j.1365-2796.2007.01795.x. [DOI] [PubMed] [Google Scholar]
  • 3.Beatty WL, Russell DG. Identification of mycobacterial surface proteins released into subcellular compartments of infected macrophages. Infect Immun. 2000;68(12):6997–7002. doi: 10.1128/iai.68.12.6997-7002.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wiker HG, Mustafa T, Malen H, Riise AM. Vaccine approaches to prevent tuberculosis. Scand J Immunol. 2006;64(3):243–50. doi: 10.1111/j.1365-3083.2006.01815.x. [DOI] [PubMed] [Google Scholar]
  • 5.Malen H, Berven FS, Fladmark KE, Wiker HG. Comprehensive analysis of exported proteins from Mycobacterium tuberculosis H37Rv. Proteomics. 2007;7(10):1702–18. doi: 10.1002/pmic.200600853. [DOI] [PubMed] [Google Scholar]
  • 6.Wiker HG, Harboe M. The antigen 85 complex: a major secretion product of Mycobacterium tuberculosis. Microbiol Rev. 1992;56(4):648–61. doi: 10.1128/mr.56.4.648-661.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Braunstein M, Espinosa BJ, Chan J, Belisle JT, Jacobs WR., Jr SecA2 functions in the secretion of superoxide dismutase A and in the virulence of Mycobacterium tuberculosis. Mol Microbiol. 2003;48(2):453–64. doi: 10.1046/j.1365-2958.2003.03438.x. [DOI] [PubMed] [Google Scholar]
  • 8.Kurtz S, McKinnon KP, Runge MS, Ting JP, Braunstein M. The SecA2 secretion factor of Mycobacterium tuberculosis promotes growth in macrophages and inhibits the host immune response. Infect Immun. 2006;74(12):855–64. doi: 10.1128/IAI.01022-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Fortune SM, Jaeger A, Sarracino DA, Chase MR, Sassetti CM, Sherman DR, et al. Mutually dependent secretion of proteins required for mycobacterial virulence. Proc Natl Acad Sci U S A. 2005;102(30):10676–81. doi: 10.1073/pnas.0504922102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sonnenberg MG, Belisle JT. Definition of Mycobacterium tuberculosis culture filtrate proteins by two-dimensional polyacrylamide gel electrophoresis, N-terminal amino acid sequencing, and electrospray mass spectrometry. Infect Immun. 1997;65(11):4515–24. doi: 10.1128/iai.65.11.4515-4524.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jungblut PR, Schaible UE, Mollenkopf HJ, Zimny-Arndt U, Raupach B, Mattow J, et al. Comparative proteome analysis of Mycobacterium tuberculosis and Mycobacterium bovis BCG strains: towards functional genomics of microbial pathogens. Mol Microbiol. 1999;33(6):1103–17. doi: 10.1046/j.1365-2958.1999.01549.x. [DOI] [PubMed] [Google Scholar]
  • 12.Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998;393(6685):537–44. doi: 10.1038/31159. [DOI] [PubMed] [Google Scholar]
  • 13.Egmond MR, de Vlieg J. Fusarium solani pisi cutinase. Biochimie. 2000;82(11):1015–21. doi: 10.1016/s0300-9084(00)01183-4. [DOI] [PubMed] [Google Scholar]
  • 14.Parker SK, Curtin KM, Vasil ML. Purification and characterization of mycobacterial phospholipase A: an activity associated with mycobacterial cutinase. J Bacteriol. 2007;189(11):4153–60. doi: 10.1128/JB.01909-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Schafer W. The role of cutinase in fungal pathogenicity. Trends Microbiol. 1993;1(2):69–71. doi: 10.1016/0966-842x(93)90037-r. [DOI] [PubMed] [Google Scholar]
  • 16.Fett WF, Wijey C, Moreau RA, Osman SF. Production of cutinolytic esterase by filamentous bacteria. Lett Appl Microbiol. 2000;31(1):25–9. doi: 10.1046/j.1472-765x.2000.00752.x. [DOI] [PubMed] [Google Scholar]
  • 17.Fett WF, Gerard HC, Moreau RA, Osman SF, Jones LE. Screening of nonfilamentous bacteria for production of cutin-degrading enzymes. Appl Environ Microbiol. 1992;58(7):2123–30. doi: 10.1128/aem.58.7.2123-2130.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 1997;10(1):1–6. doi: 10.1093/protein/10.1.1. [DOI] [PubMed] [Google Scholar]
  • 19.Marchler-Bauer A, Panchenko AR, Shoemaker BA, Thiessen PA, Geer LY, Bryant SH. CDD: a database of conserved domain alignments with links to domain three-dimensional structure. Nucl Acids Res. 2002;30(1):281–3. doi: 10.1093/nar/30.1.281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, et al. The COG database: an updated version includes eukaryotes. BMC Bioinform. 2003;11:4–41. doi: 10.1186/1471-2105-4-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res. 1997;25(17):3389–402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res. 1994;22(22):4673–80. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Oliveira F, Kamhawi S, Seitz AE, Pham VM, Guigal PM, Fischer L, et al. From transcriptome to immunome: identification of DTH inducing proteins from a Phlebotomus ariasi salivary gland cDNA library. Vaccine. 2006;24(3):374–90. doi: 10.1016/j.vaccine.2005.07.085. [DOI] [PubMed] [Google Scholar]
  • 24.Valenzuela JG, Belkaid Y, Garfield MK, Mendez S, Kamhawi S, Rowton ED, et al. Toward a defined anti-Leishmania vaccine targeting vector antigens: characterization of a protective salivary protein. J Exp Med. 2001;194(3):331–42. doi: 10.1084/jem.194.3.331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kamath AT, Hanke T, Briscoe H, Britton WJ. Co-immunization with DNA vaccines expressing granulocyte-macrophage colony-stimulating factor and mycobacterial secreted proteins enhances T-cell immunity, but not protective efficacy against Mycobacterium tuberculosis. Immunology. 1999;96(4):511–6. doi: 10.1046/j.1365-2567.1999.00703.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Weldingh K, Rosenkrands I, Jacobsen S, Rasmussen PB, Elhay MJ, Andersen P. Two-dimensional electrophoresis for analysis of Mycobacterium tuberculosis culture filtrate and purification and characterization of six novel proteins. Infect Immun. 1998;66(8):3492–500. doi: 10.1128/iai.66.8.3492-3500.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kamath AT, Feng CG, Macdonald M, Briscoe H, Britton WJ. Differential protective efficacy of DNA vaccines expressing secreted proteins of Mycobacterium tuberculosis. Infect Immun. 1999;67(4):1702–7. doi: 10.1128/iai.67.4.1702-1707.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Grover A, Ahmed MF, Singh B, Verma I, Sharma P, Khuller GK. A multivalent combination of experimental antituberculosis DNA vaccines based on Ag85B and regions of difference antigens. Microbes Infect. 2006;8(9–10):2390–9. doi: 10.1016/j.micinf.2006.04.025. [DOI] [PubMed] [Google Scholar]
  • 29.Hovav AH, Fishman Y, Bercovier H. Gamma interferon and monophosphoryl lipid A-trehalose dicorynomycolate are efficient adjuvants for Mycobacterium tuberculosis multivalent acellular vaccine. Infect Immun. 2005;73(1):250–7. doi: 10.1128/IAI.73.1.250-257.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Grover A, Ahmed MF, Verma I, Sharma P, Khuller GK. Expression and purification of the Mycobacterium tuberculosis complex-restricted antigen CFP21 to study its immunoprophylactic potential in mouse model. Protein Expr Purif. 2006;48(2):274–80. doi: 10.1016/j.pep.2006.03.010. [DOI] [PubMed] [Google Scholar]
  • 31.Sable SB, Verma I, Khuller GK. Multicomponent antituberculous subunit vaccine based on immunodominant antigens of Mycobacterium tuberculosis. Vaccine. 2005;23(32):4175–84. doi: 10.1016/j.vaccine.2005.03.040. [DOI] [PubMed] [Google Scholar]
  • 32.Weldingh K, Andersen P. Immunological evaluation of novel Mycobacterium tuberculosis culture filtrate proteins. FEMS Immunol Med Microbiol. 1999;23(2):159–64. doi: 10.1111/j.1574-695X.1999.tb01235.x. [DOI] [PubMed] [Google Scholar]
  • 33.Montgomery DL, Ulmer JB, Donnelly JJ, Liu MA. DNA vaccines. Pharmacol Ther. 1997;74(2):195–205. doi: 10.1016/s0163-7258(97)82003-7. [DOI] [PubMed] [Google Scholar]
  • 34.Tung WS, Bakar SA, Sekawi Z, Rosli R. DNA vaccine constructs against enterovirus 71 elicit immune response in mice. Genet Vaccines Ther. 2007;5:6. doi: 10.1186/1479-0556-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Britton WJ, Palendira U. Improving vaccines against tuberculosis. Immunol Cell Biol. 2003;81(1):34–45. doi: 10.1046/j.0818-9641.2002.01143.x. [DOI] [PubMed] [Google Scholar]
  • 36.Skeiky YA, Sadoff JC. Advances in tuberculosis vaccine strategies. Nat Rev Microbiol. 2006;4(6):469–76. doi: 10.1038/nrmicro1419. [DOI] [PubMed] [Google Scholar]
  • 37.Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J Bacteriol. 1996;178(5):1274–82. doi: 10.1128/jb.178.5.1274-1282.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science. 1997;276(5317):1420–2. doi: 10.1126/science.276.5317.1420. [DOI] [PubMed] [Google Scholar]
  • 39.Ollis DL, Cheah E, Cygler M, Dijkstra B, Frolow F, Franken SM, et al. The alpha/beta hydrolase fold. Protein Eng. 1992;5(3):197–211. doi: 10.1093/protein/5.3.197. [DOI] [PubMed] [Google Scholar]

RESOURCES