Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 1.
Published in final edited form as: Microbiology (Reading). 2009 Jan;155(Pt 1):165–173. doi: 10.1099/mic.0.023168-0

The two-component system BfrAB regulates expression of ABC transporters in Streptococcus gordonii and Streptococcus sanguinis

Yongshu Zhang 1, Marvin Whiteley 2, Jens Kreth 1, Yu Lei 1, Ali Khammanivong 1, Jamie N Evavold 1, Jingyuan Fan 1, Mark C Herzberg 1,3,*
PMCID: PMC2672948  NIHMSID: NIHMS103635  PMID: 19118357

Abstract

The putative two-component system BfrAB is involved in Streptococcus gordonii biofilm development. Here, we provide evidence that BfrAB regulates the expression of bfrCD and bfrEFG, which encode two ABC transporters, and bfrH, which encodes a CAAX amino-terminal protease family protein. BfrC and BfrE are ATP-binding proteins and BfrD, BfrF and BfrG are homologous membrane- spanning polypeptides. Similarly, BfrABss, the BfrAB homologous system in S. sanguinis controls the expression of two bfrCD-homologous operons (bfrCDss and bfrXYss), a bfrH-homologous gene (bfrH1ss) and another CAAX amino- terminal protease family protein gene (bfrH2ss). Furthermore, we demonstrate that the purified BfrA DNA-binding domain from S. gordonii binds to the promoter regions of bfrCD, bfrEFG, bfrH, bfrCDss, bfrXYss, and bfrH1ss in vitro. Finally, we show that the BfrA DNA-binding domain recognizes a conserved DNA motif with a consensuses sequence of TTTCTTTAGAAATATTTTAGAATT. These data suggest, therefore, that S. gordonii BfrAB could control biofilm formation by regulating multiple ABC-transporter systems.

Keywords: Two-component system, BfrAB, gene expression, streptococci

INTRODUCTION

Dental plaque is a polymicrobial biofilm of the saliva-coated tooth surface that can cause caries, gingivitis and periodontal diseases (Rosan & Lamont, 2000). Streptococcus gordonii is a pioneer colonizer of dental plaque, preferentially adhering to cleaned saliva-coated tooth surfaces (Nyvad & Kilian, 1987; Nyvad & Kilian, 1990). S. gordonii also colonizes other oral sites and is not normally harmful in the human oral cavity (Frandsen et al., 1991; Socransky et al., 1998). When introduced into the blood, however, S. gordonii, like other oral streptococci, can be involved in the development of infective endocarditis (Bayliss et al., 1983; Herzberg, 1996; Manford et al., 1992).

To colonize several intraoral sites or to enter the circulating blood and infect heart valves, oral streptococci must adapt to environmental changes. Gene regulation by two-component systems (TCSs) is a common mechanism used by bacteria to modulate cell behavior in response to environmental changes (Stock et al., 2000). TCSs are involved in the regulation of biofilm development in several species, including Escherichia coli (Dorel et al., 1999; Otto & Silhavy, 2002; Prigent-Combaret et al., 1999), Pseudomonas aeruginosa (Parkins et al., 2001), Staphylococcus aureus (Fournier & Hooper, 2000; Toledo-Arana et al., 2005), Streptococcus mutans (Bhagwat et al., 2001; Li et al., 2002; Shemesh et al., 2007) and Enterococcus faecalis (Hancock & Perego, 2004). A TCS is typically composed of a histidine kinase and a response regulator. The response regulator generally acts to regulate transcription. After detection of the environmental signal, the histidine kinase undergoes autophosphorylation of a conserved histidine residue. The phosphoryl group is subsequently transferred to a conserved aspartate residue of a cognate response regulator. Aspartate phosphorylation of the response regulator alters the binding affinity for target sites and leads to changes in gene expression.

In S. gordonii, the two-component system ComDE is involved in competence, regulating DNA uptake (Havarstein et al., 1996; Lunsford, 1998), and is required for biofilm formation in vitro (Loo et al., 2000). The signal is a secreted competence-stimulating peptide (CSP), encoded by comC, which is a member of a three-gene operon comCDE. The extracellular CSP binds the histidine kinase ComD, which subsequently phosphorylates the response regulator ComE. ComE transcriptionally regulates expression of over 100 genes (Vickerman et al., 2007).

We previously characterized the role of a two-component system, BfrAB, in S. gordonii biofilm development (Zhang et al., 2004). In the present study, we identify genes regulated by the BfrAB two-component system in S. gordonii. Using DNA microarray analysis, RT-PCR, and electrophoretic mobility shift assays, we show that under the tested conditions BfrAB regulates the expression of bfrCD and bfrEFG operons, which encode two ABC transporters, and one additional gene bfrH, which encodes a homologue to the CAAX amino-terminal protease family. We also provide evidence that bfrAB and bfrAB-homologous systems share common roles as regulators of bfrCD and bfrCD-homologous operons in S. gordonii and S. sanguinis. These results suggest that BfrAB could control biofilm formation by regulating multiple ABC-transporter systems.

METHODS

Bacterial strains and culture conditions

Strains of S. gordonii V288 and S. sauguinis SK36 (listed in Table 1) were routinely grown in chemically defined synthetic media (FMC) (K2HPO4, 300 μg ml−1; KH2PO4, 440 μg ml−1; Na2HPO4, 3.15 mg ml−1; NaH2PO4, 2.05 mg ml−1; (NH4)2SO4 0.6 mg ml−1; sodium citrate, 225 μg ml−1; riboflavin, 0.4 μg ml−1; biotin, 0.01 μg ml−1; folic acid, 0.1 μg ml−1; pantothenate, 0.8 μg ml−1; p-aminobenzoic acid, 0.1 μg ml−1; thiamine, 0.4 μg ml−1; nicotinamide, 2.0 μg ml−1; pyridoxamine, 0.8 μg ml−1; D-glucose, 20 mg ml−1; sodium acetate, 6 mg ml−1; adenine, 35 μg ml−1; guanine, 27 μg ml−1; uracil, 30 μg ml−1; MgSO4, 200 μg ml−1; NaCl, 10 μg ml−1; FeSO4, 10 μg ml−1; MnSO4, 10 μg ml−1; glutamine, 5 μg ml−1; L-glutamic acid, 300 μg ml−1; L-valine, 100 μg ml−1; 110 μg ml−1 of L-lysine, L-asparate, L-isoleucine, L-methionine, L-serine, L-phenylalanine and 200 μg ml−1 of L-alanine, L-cystine, L-histidine, glycine, L-hydroxyproline, L-proline, L-tryptophan and L-tyrosine, pH 6.5) (Terleckyj & Shockman, 1975; Terleckyj et al., 1975) at 37°C in 5% CO2. E. coli DH5α cells were grown aerobically at 37°C in Luria-Bertani (LB) medium. When required, antibiotics were added to the medium at the following concentrations: erythromycin (Em), 10 μg ml−1 (S. gordonii and S. sanguinis); kanamycin (Km), 50 μg ml−1 (E. coli), 250 μg ml−1 (S. gordonii and S. sanguinis); and tetracycline (Tc) 10 μg ml−1 (S. gordonii).

Table 1.

Bacterial strains and plasmids used in this study

Strain/plasmid Relevant characteristics Source/reference
E. coli
DH5α F′Iq F′ proA+B+ lacIq Δ(lacZ)M15 zzf::Tn10 (TetR)/fhuA2Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 New England Biolabs
S. gordonii
V288 Wild-type G. Dunny, Univ. Minnesota
MG288–1015 bfrAB::tet(Tcr) (Zhang et al., 2004)
V288bfr− Δ(bfrAB)::ermAM (Emr) This study
V288bfr+ Δ(bfrAB)::ermAM (pDL276 bfrAB) (Emr, Kmr) This study
S. sanguinis
SK36 Wild-type (Kilian & Holmgren, 1981)
SK36bfr− Δ(ssA_0401–402)::ermAM (Emr) This study
SK36bfr+ Δ(ssA_0401–402)::ermAM (pDL276 ssA_0401–402) (Emr, Kmr) This study
Plasmids
pPCR-Amp SK (+) 3.0 kb; ApR; pUCori Stratagene
pDL276 6.9 kb; KmR, ColE1ori, E. coli-streptococcal shuttle vector (Dunny et al., 1991)
pVA891 5.4 kb; EmR, CmR; pACYCori; E. coli- streptococcal shuttle vector (Macrina et al., 1983)
pQE80L 4.7 kb; ApR; ColE1ori, E. coli expression vector QIAGEN
Open in a new tab

Genetic manipulations

Standard recombinant DNA techniques were employed as described (Sambrook, 1989). Plasmids (listed in Table 1) were purified from E. coli cells using the QIAquick Spin Miniprep Purification Kit (QIAGEN, Valencia, CA). Chromosomal DNA was prepared as described previously (Zhang et al., 2004). Oligonucleotides (listed in Table S1, Supplementary Materials) were synthesized by Integrated DNA Technologies (Coralville, IA). PCR products were purified using the High Pure PCR Product Purification Kit (Roche, Indianapolis, IN). DNA restriction and modification enzymes were used as specified by the manufacturer (Promega, Madison, WI).

The bfrAB operons of S. gordonii V288 and S. sanguinis SK36 were inactivated by allelic exchange with the erythromycin resistance determinant, ermAM. The ermAM was amplified from the plasmid pVA891 (Macrina et al., 1983) and cloned into pPCR-Amp SK (+) (Stratagene, Cedar Creek, TX). Two DNA fragments constituting the flanking sequences of the bfr operons were then amplified and fused with the ermAM genes sequentially (Nobbs et al., 2007). The fused construct was then PCR-amplified, purified and transformed into S. gordonii V288 or S. sanguinis SK36 as described previously (Tao & Herzberg, 1999), generating the deletion mutants, S. gordonii V288bfr− and S. sanguinis SK36bfr−. The insertions were confirmed by PCR amplification and sequencing.

To complement the bfrAB deletion mutant, a DNA fragment encompassing the entire bfrAB operon was amplified by PCR and cloned into the E. coli-streptococcal shuttle vector, pDL276 (Dunny et al., 1991). The construct was amplified in E. coli, purified and used to transform the S. gordonii V288bfr− mutant to obtain the complemented strain V288bfr+. Predicted insertions were confirmed by PCR amplification and sequencing. Complementation was confirmed by detection of the bfr RNA transcript. The complemented strain of S. sanguinis SK36bfr+ was constructed using the same method.

RNA extraction and cDNA synthesis

RNA extraction from bacterial cultures, confirmation of RNA integrity and estimation of purity on agarose gels, and cDNA synthesis were performed as described previously (Zhang et al., 2004; Zhang et al., 2005). For each RNA sample, a control cDNA reaction in the absence of reverse transcriptase was performed to check for DNA contamination.

DNA microarray design, cDNA labeling and hybridization

Fresh FMC media containing appropriate antibiotics was inoculated with 10% of the overnight cultures of S. gordonii strains and incubated at 37°C in 5% CO2. After 6 hours, bacterial cells reached early stationary phase (OD620 nm ~ 1.8). RNA was then isolated. DNA contamination was assessed by PCR amplification of the clpX gene, and RNA integrity was monitored with agarose gel electrophoresis of glyoxylated samples (Ambion, Austin, TX). RNA was prepared for hybridization to a custom S. gordonii Affymetrix GeneChip microarray as previously described (Brown & Whiteley, 2007; Palmer et al., 2005). Probes for the GeneChip were designed for each open reading frame using the S. gordonii genome sequence available at http://www.ncbi.nlm.nih.gov (probe sequences available from the authors). Washing, staining and scanning of the GeneChips was performed at the University of Iowa DNA core facility using an Affymetrix Fluidics Station. GeneChips were hybridized in duplicate for each condition. Data analysis was performed using GeneChip Operating Software version 1.4 to compare between two conditions and reported as differentially regulated (p ≤ 0.05, n = 2) based on pairwise statistical analysis as described previously (Brown & Whiteley, 2007). The microarray data has been deposited in the database MIAMEXPRESS (http://www.ebi.ac.uk/microarray). The accession number is E-MEXP-1712.

Semiquantitative PCR

To compare the specific gene expression levels among the wild-type S. gordonii V288, V288bfr− and V288bfr+, and among the wild-type S. sanguinis SK36, SK36bfr− and SK36 bfr+, a semiquantitative RT-PCR (Nambu et al., 2003) was used. Four-fold serial dilutions (1:4, 1:16, 1:64, and 1:256) of cDNA were prepared in deionized water. Each PCR reaction was performed in a total volume of 25 μl containing 1x Green GoTaq Flexi Buffer (Promega), 0.2 mM of each dNTP, 1.0 μM of each upstream primer and downstream primer, GoTaq DNA polymerase (Promega, Madison, WI) and 3 μl of diluted cDNA. The 16S rRNA gene was used as an internal control for RT-PCR as reported previously (Zhang et al., 2005). The PCR conditions for protein-encoding genes were (i) 95 °C for 5 min; (ii) 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and (iii) 72°C for 4 min. Sixteen amplification cycles were performed for the PCR of the 16s rRNA gene. The PCR products (5 μl) were analyzed on 1.7% agarose gels and stained with ethidium bromide.

Expression and purification of the DNA-binding domain of BfrA

The DNA fragment (327 bp) encoding the DNA-binding domain of BfrA was amplified by PCR. The PCR products were digested with BamHI and SalI, ligated into the BamHI/SalI sites within the expression vector pQE80L (QIAGEN, Valencia, CA) in the reading frame of the 5′ (His)6-encoding sequence, and transformed into NEB DH5α F′Iq competent E. coli cells (New England Biolabs, Ipswich, MA). The construct was confirmed by DNA sequencing. The resulting cells were cultured in LB medium until growth reached an A600nm ~ 0.5 – 0.6. In these cultures, expression of the His-tagged DNA-binding domain of BfrA (His6DBBfrA) was induced by incubation with 1 mM isopropyl-β-D-thiogalactoside (IPTG) for 4 h at 37 °C. Cells were lysed and inclusion bodies were isolated using the B-PER Bacterial Protein Extraction Reagent (Pierce, Rockford, IL) following the manufacturer’s instructions. The isolated inclusion bodies were dissolved in 6 M guanidine hydrochloride and purified using a Ni-NTA Superflow (QIAGEN) column under denaturing conditions as described in The QIAexpressionist, fifth edition (QIAGEN). The peak fractions were adjusted to pH 8.0 by 1 M Tris base. The refolding buffers were first optimized using the Protein Refolding kit (Athena Environmental Sciences, Baltimore, MD). The refolding was then performed in the selected buffer (50 mM Tris-Cl, pH 8.5, 9.6 mM NaCl, 0.4 mM KCl, 1 mM EDTA, 0.5% Triton X-100 and 1 mM DTT) following the manufacturer’s instructions.

Electrophoretic mobility shift assay (EMSA)

A non-isotopic EMSA kit (Molecular Probes, Carlsbad, CA) was used to test the interactions of the His6DBBfrA and the upstream promoter-containing regions of the target genes. The upstream intergenic regions of the target genes were amplified by PCR. The purified PCR product (40 ng) was then mixed with the refolded His6DBBfrA in 1x binding buffer (10 mM Tris-Cl, pH 8.0, 50 mM KCl, 0.5 mM DTT, 0.05 mM EDTA, 1 mM MgCl2 and 5% glycerol) in a total reaction volume of 20 μl. The mixture was incubated for 30 min at room temperature and then mixed with 4 μl of 6 x loading buffer. The DNA-protein complexes (20 μl per lane) were then examined by electrophoresis using 5% nondenaturing polyacrylamide gels stained with SYBR Green and visualized using a 314 nm UV transilluminator following the manufacturer’s protocol.

An isotopic EMSA was used to test for interactions of His6DBBfrA with the synthesized double-strand DNA probes. The probes were 5′-end-labeled with [γ32P]-ATP by T4 polynucleotide kinase (PROMEGA, Madison, WI) and purified using Mini Quick Spin Oligo Spin Columns (Roche, Indianapolis, IN). 32P-labeled probes (10,000 CPM) were mixed with the refolded His6DBBfrA in 1x binding buffer (10 mM Tris-Cl, pH 8.0, 50 mM KCl, 0.5 mM DTT, 0.05 mM EDTA, 1 mM MgCl2, 5% glycerol, 0.025 mg/ml poly (dI-dG) and 0.5 mg/ml BSA) in a total reaction volume of 20 μl. In a competition binding assay, 6 pmol of the unlabeled competitor DNA probe or noncompetitor probe was added. The mixture was incubated for 30 min at room temperature and then mixed with 4 μl of 6x loading buffer. The DNA-protein complexes (20 μl per lane) were then examined by electrophoresis using 8% nondenaturing polyacrylamide gels and visualized by autoradiography.

Gene sequences

The annotated genomes of S. gordonii (NC_009785) and S. sanguinis (NC_009009) are available at http://www.ncbi.nlm.nih.gov.

RESULTS

Identification of genes regulated by the BfrAB two-component system in S. gordonii

To identify BfrAB-regulated genes in S. gordonii, a transcriptome analysis was performed for S. gordonii V288 wild type and two bfr-negative mutants using a custom Affymetrix GeneChip microarray. Two bfrAB mutants, an insertional mutant (MG288–1015) (Zhang et al., 2004) and a deletion mutant (V288bfr−) constructed for this study, were utilized to ensure that any genes identified as differentially regulated were not specific to either mutant. For DNA microarray assays, RNA was extracted from early stationary phase cells because at this phase the bfrA promoter exhibits higher activity than during log phase (Zhang et al., 2004). Seven putative genes (designated as bfrC, bfrD, bfrE, bfrF, bfrG, bfrH and bfrX; Table 2) were expressed at lower levels in either of the mutants than in the wild-type S. gordonii V288 (the complete microarray data is available in the MIAMEXPRESS database; accession number: E-MEXP-1712). Since the altered expression of these genes was not specific to either bfr mutant, their reduced expression levels more likely resulted from the impaired functions of bfrAB. These genes, therefore, were selected for further characterization in this study.

Table 2.

Genes differentially expressed in the S. gordonii V288 wild type and the Bfr− mutants

Gene name and function (Gene Bank accession number; Microarray probe ID) Fold-change in gene expression relative to V288 wild type
V288bfr− MG288–1015
bfrC: ABC transporter, ATP-binding protein (ABV10088; SG1561) −8.9 −5.5
bfrD: Unknown (ABV09959; SG1560) −8.7 −6.7
bfrE: ABC transporter, ATP-binding protein (ABV11086; SG1564) −11.7 −6.3
bfrF: Unknown (ABV10645; SG1563) −12.2 −8.9
bfrG: Unknown (ABV10185; SG1562) −12.6 −9.8
bfrH: CAAX amino-terminal protease protein family (ABV10380; SG0950) −3.4 −4.9
bfrX: ABC transporter, ATP-binding protein (ABV09881; SG1558) −3.0 −4.4
Open in a new tab

The chromosomal location of the bfrH gene, which encodes a CAAX amino-terminal protease family protein, is remote from the bfr locus (Fig. 1A). The other six genes are located immediately downstream of bfrAB (Fig. 1A) and transcribed in the direction opposite to bfrAB. The bfrC and bfrD are separated by a 12 bp intergenic sequence, which suggested that bfrC and bfrD were co-transcribed as an operon. The co-transcription of bfrC and bfrD was confirmed by RT-PCR (data not shown). The bfrE and bfrF are separated by a 16 bp intergenic sequence, and bfrF and bfrG are separated by a short 37 bp intergenic sequence. The co-transcription of bfrEF and bfrFG were confirmed also by RT-PCR (data not shown). Thus, bfrEFG forms a three-gene operon. Similarly, bfrX and its immediate downstream gene, bfrY, are separated by a 6 bp intergenic sequence, and are co-transcribed (data not shown). Protein sequence analysis suggested that bfrXY, bfrCD and bfrEFG encoded three putative ABC transporters. Among these genes, bfrX, bfrC and bfrE encode three Walker-motif-containing ATP-binding proteins with high similarities; bfrY, bfrD, bfrF and bfrG encode four homologous transmembrane polypeptides. Bioinformatic analysis using the SOSUI server (http://bp.nuap.nagoya-u.ac.jp/sosui/) predicts that BfrH, BfrY, BfrD, BfrF and BfrG each contain six transmembrane helices.

Fig. 1. Genetic loci regulated by BfrAB and BfrABss.

Fig. 1

Open in a new tab

Gray arrows: genes regulated by BfrAB/BfrABss systems based on data from this study. White arrows: genes not regulated by BfrAB/BfrABss systems based on data from this study.

To validate the data from DNA microarray experiments, semiquantitative RT-PCR experiments were performed. In agreement with the data from the DNA microarray results, the RT-PCR experiments showed that the S. gordonii V288bfr− strain expressed lower levels of bfrCD, bfrEFG and bfrH than the wild type (Fig. 2A). However, the decreased expression of bfrX in S. gordonii V288bfr− seen in DNA microarray analysis was not observed using semiquantitative RT-PCR (Fig. 2A).

Fig. 2. Semi-quantitive RT-PCR of selected genes.

Fig. 2

Open in a new tab

(A) Expression of selected genes in S. gordonii V288 wild type, V288bfr− and V288bfr+. (B) Expression of selected genes in S. sanguinis SK36 wild type, SK36bfr− and SK36bfr+. The 16S rRNA gene was used as an internal control for RT-PCR. Four-fold serial dilutions (represented by the declining slope of the triangles) of cDNAs were used as PCR templates to amplify the indicated transcripts. All data shown are representative of two independent experiments.

To determine whether the altered expression of bfrCD, bfrEFG and bfrH was directly associated with the inactivation of the BfrAB two-component system, a strain complemented for the deletion of bfr was constructed by transforming the V288bfr− strain with the shuttle vector pDL276 harboring the bfrAB operon. The expression levels of bfrCD, bfrEFG and bfrH were largely restored in the complementary strain V288bfr+ (Fig. 2A), indicating that BfrAB is involved in the regulation of these genes.

Identification of BfrAB-homologous two-component systems in S. sanguinis

Using the BLASTP program (Altschul et al., 1997; Schaffer et al., 2001), we searched the nonredundant sequence database (http://www.ncbi.nlm.nih.gov) using BfrA and BfrB protein sequences to find Bfr-homologous two-component systems in other bacterial species. The S. sanguinis two-component system of SSA_0401–0402 (BfrABss) showed the highest similarity (~ 90%) to BfrAB. In addition, the S. sanguinis genome contains genes homologous to BfrC, BfrD, BfrE, BfrF, BfrG, BfrH, BfrX and BfrY.

As in S. gordonii, the bfrH-homologous gene ssA_0253 (bfrH1ss) in S. sanguinis was outside of the bfr-homologous locus (Fig. 1B). However, bfrABss is immediately followed by ssA_0403 (bfrH2ss), which encodes another CAAX amino-terminal protease family protein, and ssA_0405, which encodes a xenobiotic response element (XRE) family transcriptional regulator (Fig. 1B). The XRE family proteins interact with cognate DNA sequences through their helix-turn-helix (HTH) motifs. Both bfrH2ss and ssA_0405 have their own putative promoters, which were identified using the program “Neural Network Promoter Prediction” (http://www.fruitfly.org/seq_tools/promoter.html), and are transcribed in the same direction as bfrABss operon. Three bfrCD/bfrEFG/bfrXY-homologous operons, ssA_0407-0406 (bfrXYss), ssA_0409-0408 (bfrCDss) and ssA_0412-0411-0410 (bfrEFGss), are located in close proximity downstream of ssA_0405 and transcribed in the opposite direction (Fig. 1B). The co-transcription of bfrXss/bfrYss, bfrCss/bfrDss, and bfrEss/bfrFss/bfrGss was confirmed by RT-PCR (data not shown).

Identification of genes regulated by TCS BfrABss in S. sanguinis

The high similarity of the protein sequences between BfrAB S. gordonii and BfrABss in S. sanguinis suggests that the functions of the two-component systems might be conserved in the two species. To identify genes regulated by BfrABss in S. sanguinis, we constructed a deletion mutant of by allelic exchange. The expression of a set of selected genes was first compared between the bfrABss deletion mutant strain (SK36bfr−) and the S. sanguinis wild type. SK36bfr− expressed substantially less bfrH1ss, bfrH2ss and the two operons bfrXYss and bfrCDss than the wild type (Fig. 2B). However, the expression levels of ssA_0405 and the operon bfrEFGss were similar between SK36bfr− and the parent wild-type strain (data not shown). Furthermore, we constructed a complemented strain for SK36bfr− to confirm whether the altered expression of these genes was the direct result of inactivation of the BfrABss TCS. The expression levels of bfrH1ss, bfrH2ss and of the operons bfrXYss and bfrCDss were restored in the complementary strain SK36bfr+(Fig. 2B), indicating that the BfrABssTCS is involved in the regulation of these genes in S. sanguinis.

Binding of the BfrA DNA-binding domain to the upstream promoter-containing regions of BfrAB-regulated genes in vitro

The response regulator BfrA comprises of two conserved domains, including an N-terminal signal receiver domain (amino acid residues 5–116) and a C-terminal DNA-binding domain (residues 129–223). Our results indicated that BfrAB is involved in the regulation of multiple genes in S. gordonii. We then examined whether BfrA could bind to the upstream promoter-containing regions of these genes, thus directly controlling their transcription activities. First, a fusion protein (His6DBBfrA), including a C-terminal fragment of the BfrA protein (DBBfrA, 118–226 aa) and an N-terminal 6x histidine tag, was overexpressed in E. coli and purified. The interactions of the purified His6DBBfrA with the upstream promoter-containing regions of selected genes were then tested by the electrophoretic mobility shift assay (EMSA).

Purified His6DBBfrA bound to the upstream promoter-containing regions of bfrCD, bfrEFG and bfrH as shown by EMSA (Fig. 3). In contrast, His6DBBfrA protein could not bind to the upstream promoter-containing regions of S. gordonii sthAB operon (Fig. 3) or comCDE operon (data not shown). Since BfrA and its S. sanguinis counterpart BfrAss share high similarity (Fig. 4), we tested the interactions of His6DBBfrA with the upstream promoter-containing regions of BfrABss-regulated genes in S. sanguinis. His6DBBfrA bound to the upstream promoter-containing regions of bfrXYss, bfrCDss and bfrH1ss (Fig. 3). His6DBBfrA, however, did not bind to the upstream promoter-containing regions of bfrH2ss (Fig. 3). In addition, binding to His6DBBfrA by the promoter-containing regions of bfrCD, bfrEFG, bfrH, bfrXYss, bfrCDss and bfrH1ss were all His6DBBfrA dose-dependent (Fig. 3), which also suggested that His6DBBfrA interacted selectively with these six promoter-containing regions.

Fig. 3. Non-isotopic electrophoretic mobility shift analysis of binding of His6DBBfrA to the upstream promoter-containing regions of selected genes.

Fig. 3

Open in a new tab

The upstream promoter-containing regions of the selected genes were amplified by PCR, purified and used to test the interactions with varied amounts of purified His6DBBfrA. The reaction mixtures were separated on 5% non-denaturing polyacrylamide gels, stained with SYBR Green and visualized using a 314 nm UV transilluminator. Control: His6DBBfrA protein only control.

Fig. 4. Comparison of the primary sequences of BfrA, BfrAss and SMU.1038c.

Fig. 4

Open in a new tab

S. gordonii BfrA and homologous genes in S. sanguinis (BfrAss) and S. mutans (SMU.1038c) have been aligned using ClustaIW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html). The ‘*”, ‘:’, and “.” represent identical residues, highly conserved residues and weakly conserved residues, respectively.

Identification of the DNA motif recognized by BfrA

To identify the potential DNA motif recognized by BfrA, we aligned the upstream promoter-containing regions of bfrH, bfrC, bfrE, bfrXYss, bfrCDss and bfrH1ss (Fig. 5). A 24-bp conserved DNA motif with a consensuses sequence of TTTCTTTAGAAATATTTTAGAATT was identified. This conserved motif contains two direct repeats of TTTAGAA, which are separated by a 4 bp intervening sequence. This 24-bp conserved motif is not found in the upstream promoter- containing regions of bfrH2ss, S. gordonii sthAB operon and comCDE operon. As described above, the upstream promoter-containing regions of bfrH2ss, S. gordonii sthAB operon and comCDE operon were not recognized by His6DBBfrA.

Fig. 5.

Fig. 5

Open in a new tab

Alignment of the His6DBBfrA-recognized promoter sequences. His6DBBfrA binds to the upstream regulatory regions of bfrC, bfrE, bfrH, bfrCss, bfrH1ss, and bfrXss. To identify the potential common motif recognized by His6DBBfrA, the upstream regulatory regions of bfrC, bfrE, bfrH, bfrCss, bfrH1ss, and bfrXss were aligned using ClustaIW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html). The conserved 24-bp DNA motif among these regulatory regions is underlined. The specific interaction between His6DBBfrA and this conserved 24-bp DNA motif was then confirmed by electrophoretic mobility shift analysis (Fig. 6). The bold “ATG”: start codon.

Purified His6DBBfrA protein could bind to and retard the mobility of the 24-bp conserved DNA motif found in bfrCD (Fig. 6A, lane 2). In contrast, an 18-bp DNA fragment, TTTAGAAATATTTTAGAA, which is located in the 24-bp conserved motif and includes the two direct repeats of TTTAGAA and a 4 bp intervening sequence, could not complex with His6DBBfrA (Fig. 6B, lane 2). The presence of excess unlabeled 24-bp conserved DNA motif could effectively inhibit the His6DBBfrA-mediated gel shift (Fig. 6A, lane 3). However, the presence of the excess unlabeled 18-bp DNA fragment had no effect on the complex formation of His6DBBfrA and the 24-bp DNA motif (Fig. 6A, lane 4). Similarly, purified His6DBBfrA protein could interact with the 24-bp conserved DNA motifs found in bfrEFG (Fig. 6C) and bfrH (Fig. 6D). These results suggested that His6DBBfrA could specifically recognize this 24-bp conserved DNA motif.

Fig. 6.

Fig. 6

Open in a new tab

Electrophoretic mobility shift analysis to identify the DNA motif recognized by His6DBBfrA. The 32P-labeled probes were mixed with purified His6DBBfrA, incubated and separated on 8% non-denaturing polyacrylamide gels. The gel was visualized by autoradiography. (A) The 32P-labeled 24-bp conserved DNA motif of bfrCD. (B) The 32P-labeled 18-bp DNA fragment containing two direct repeats of TTTAGAA. (C) The 32P-labeled 24-bp conserved DNA motif of bfrEFG. (D) The 32P-labeled 24-bp conserved DNA motif of bfrH. Lane 1: Reaction mixtures contained 32P-labeled probe alone. Lane 2: The 32P-labeled probe with purified His6DBBfrA protein. Lane 3: The 32P-labeled probe with purified His6DBBfrA protein and excess unlabeled probe. Lane 4: The 32P-labeled probe with purified His6DBBfrA protein and excess of unlabeled 18-bp DNA fragment containing two direct repeats of TTTAGAA.

DISCUSSION

We have previously identified a putative two-component system BfrAB, which is involved in the development of oral biofilms. To further characterize the functions of this system, efforts were made in this study to identify the genes regulated by BfrAB in S. gordonii. As shown by DNA microarray analysis and confirmed by RT-PCR, six genes were downregulated in two bfrAB mutants when compared with S. gordonii wild type.

Among the genes regulated by bfrAB in S. gordonii, bfrCD and bfrEFG encode two homologous ABC transporters. BfrC and BfrE are putative ATP-binding proteins, and BfrD, BfrF and BfrG are putative transmembrane proteins. ABC transporters exist in all species (Decottignies & Goffeau, 1997; Holland & Blight, 1999), and serve to transport substrates across the cell membrane, driven by energy from ATP hydrolysis. The typical ABC transporter comprises two hydrophilic domains, which bind and hydrolyze ATP to facilitate the transportation process, and two hydrophobic domains, which translocate the substrate across the membrane and may determine substrate specificity (Higgins, 1992; Jones & George, 2004). An ABC transporter can be composed of homo- or heterodimers of ATP-binding domains and membrane-spanning domains. In bacteria, these domains are often produced as separate polypeptides (Higgins, 1992). BfrD, BfrF and BfrG all contain six membrane-spanning segments, the structure that typically characterizes these transmembrane domains/polypeptides. Another gene regulated by BfrAB, bfrH, encodes a CAAX amino-terminal protease family protein. Members of this protein family are grouped based on the sequence alignment, and are putative membrane-bound metalloproteases (Pei & Grishin, 2001).

BfrC and BfrE share high degree homology with the members of the BcrA subfamily ABC transporters. The ABC transporter BcrABC is responsible for the bacitracin resistance of Bacillus licheniform (Podlesek et al., 1995). BcrA is an ATP-binding protein, and BcrB and BcrC are integral membrane proteins. BfrD, BfrF and BfrG, however, do not share high homology with BcrB and BcrC or other function-known proteins. Since BfrCD, BfrEFG and BfrH, a putative membrane protease, are all regulated by BfrAB, we speculate that these membrane components are involved in the transport of some proteins/peptides, which may be required by S. gordonii for biofilm development. BfrH may process the protein/peptides, while BfrCD and BfrEFG may be responsible for the transport.

The TCS with the highest similarity to S. gordonii BfrAB was identified in S. sanguinis. As reported previously (Zhang et al., 2004), another TCS (SMU.1038c-1037c) with significant similarity to BfrAB was identified in another oral streptococcus, S. mutans. In S. mutans, the counterpart of BfrAB, SMU.1038c-1037c, is involved in the regulation of a bfrCD-homologous operon, which is located directly downstream of smu.1038c-1037c (Kreth et al., unpublished data). The S. sanguinis chromosome encodes three operons for putative ABC transporters homologous to bfrCD and bfrEFG, bfrCDss, bfrEFGss, and bfrXYss. Among them, bfrCDss and bfrXYss are regulated by S. sanguinis BfrABss. These results suggest that the BfrAB-homologous systems are organized similarly in oral streptococci to regulate the conserved ABC transporters. We have previously reported that S. gordonii biofilm-associated cells express higher levels of bfrAB than free-growing cells (Zhang et al., 2004). Furthermore, S. mutans sessile cells also express higher levels of bfrAB-homologous smu.1038c-1037c than free-growing cells (Shemesh et al., 2007). BfrAB-homologous systems, therefore, may be commonly involved in biofilm development by oral streptococci.

Two genes, bfrH1ss and bfrH2ss, encoding CAAX amino-terminal protease family proteins are regulated by BfrABss in S. sanguinis. Differing from bfrH1ss, the upstream promoter-containing region of bfrH2ss cannot be recognized by BfrA, suggesting that BfrABss does not directly regulate bfrH2ss transcription. On the other hand, the reduced expression level of bfrH2ss in SK36bfr− strain is restored in the complemented strain SK36bfr+, in which bfrABss is expressed in a shuttle vector. Hence, altered expression of bfrH2ss in the SK36bfr− strain is unlikely to be caused by a polar effect of the disruption of BfrABss. Further studies will clarify the mechanism how BfrABss is involved in the regulation of bfrH2ss.

Dental plaque is initiated by the adherence of pioneer colonizers to saliva-coated tooth surfaces. Pioneer colonizers in the early plaque interact with and facilitate incorporation of later colonizers. Among the later colonizers, P. gingivalis is implicated as a pathogen in periodontal infections, and can interact with S. gordonii (Brooks et al., 1997; Chung et al., 2000; Kuboniwa et al., 2006; Lamont et al., 2002; McNab et al., 2003; Park et al., 2005; Simionato et al., 2006). Interestingly, S. gordonii bfrC and bfrG appear to be required for the maturation of dual-species biofilms with P. gingivalis (Kuboniwa et al., 2006; McNab et al., 2003). We now plan to define the role of BfrAB in the development of S. gordonii-P. gingivalis biofilms.

In conclusion, we provide evidence that bfrAB and bfrAB-homologous systems share common roles as regulators of the ABC transporters in S. gordonii and S. sanguinis. Studies are ongoing to identify the substrates transported by the BfrAB-regulated ABC transporters and to explore potential signals sensed by the BfrAB two-component system. These data will provide valuable information for the molecular dissection of the regulatory pathways for development of oral streptococcal biofilms.

Supplementary Material

Acknowledgments

This work was supported by NIH grant R01 DE08590.

References

  1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bayliss R, Clarke C, Oakley CM, Somerville W, Whitfield AG, Young SE. The microbiology and pathogenesis of infective endocarditis. Br Heart J. 1983;50:513–519. doi: 10.1136/hrt.50.6.513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bhagwat SP, Nary J, Burne RA. Effects of mutating putative two-component systems on biofilm formation by Streptococcus mutans UA159. FEMS Microbiol Lett. 2001;205:225–230. doi: 10.1111/j.1574-6968.2001.tb10952.x. [DOI] [PubMed] [Google Scholar]
  4. Brooks W, Demuth DR, Gil S, Lamont RJ. Identification of a Streptococcus gordonii SspB domain that mediates adhesion to Porphyromonas gingivalis. Infect Immun. 1997;65:3753–3758. doi: 10.1128/iai.65.9.3753-3758.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brown SA, Whiteley M. A novel exclusion mechanism for carbon resource partitioning in Aggregatibacter actinomycetemcomitans. J Bacteriol. 2007;189:6407–6414. doi: 10.1128/JB.00554-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chung WO, Demuth DR, Lamont RJ. Identification of a Porphyromonas gingivalis receptor for the Streptococcus gordonii SspB protein. Infect Immun. 2000;68:6758–6762. doi: 10.1128/iai.68.12.6758-6762.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Decottignies A, Goffeau A. Complete inventory of the yeast ABC proteins. Nat Genet. 1997;15:137–145. doi: 10.1038/ng0297-137. [DOI] [PubMed] [Google Scholar]
  8. Dorel C, Vidal O, Prigent-Combaret C, Vallet I, Lejeune P. Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol Lett. 1999;178:169–175. doi: 10.1111/j.1574-6968.1999.tb13774.x. [DOI] [PubMed] [Google Scholar]
  9. Dunny GM, Lee LN, LeBlanc DJ. Improved electroporation and cloning vector system for gram-positive bacteria. Appl Environ Microbiol. 1991;57:1194–1201. doi: 10.1128/aem.57.4.1194-1201.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fournier B, Hooper DC. A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus. J Bacteriol. 2000;182:3955–3964. doi: 10.1128/jb.182.14.3955-3964.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Frandsen EV, Pedrazzoli V, Kilian M. Ecology of viridans streptococci in the oral cavity and pharynx. Oral Microbiol Immunol. 1991;6:129–133. doi: 10.1111/j.1399-302x.1991.tb00466.x. [DOI] [PubMed] [Google Scholar]
  12. Hancock LE, Perego M. The Enterococcus faecalis fsr two-component system controls biofilm development through production of gelatinase. J Bacteriol. 2004;186:5629–5639. doi: 10.1128/JB.186.17.5629-5639.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Havarstein LS, Gaustad P, Nes IF, Morrison DA. Identification of the streptococcal competence-pheromone receptor. Mol Microbiol. 1996;21:863–869. doi: 10.1046/j.1365-2958.1996.521416.x. [DOI] [PubMed] [Google Scholar]
  14. Herzberg MC. Platelet-streptococcal interactions in endocarditis. Crit Rev Oral Biol Med. 1996;7:222–236. doi: 10.1177/10454411960070030201. [DOI] [PubMed] [Google Scholar]
  15. Higgins CF. ABC transporters: from microorganisms to man. Annu Rev Cell Biol. 1992;8:67–113. doi: 10.1146/annurev.cb.08.110192.000435. [DOI] [PubMed] [Google Scholar]
  16. Holland IB, Blight MA. ABC-ATPases, adaptable energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J Mol Biol. 1999;293:381–399. doi: 10.1006/jmbi.1999.2993. [DOI] [PubMed] [Google Scholar]
  17. Jones PM, George AM. The ABC transporter structure and mechanism: perspectives on recent research. Cell Mol Life Sci. 2004;61:682–699. doi: 10.1007/s00018-003-3336-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kilian M, Holmgren K. Ecology and nature of immunoglobulin A1 protease-producing streptococci in the human oral cavity and pharynx. Infect Immun. 1981;31:868–873. doi: 10.1128/iai.31.3.868-873.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kuboniwa M, Tribble GD, James CE, Kilic AO, Tao L, Herzberg MC, Shizukuishi S, Lamont RJ. Streptococcus gordonii utilizes several distinct gene functions to recruit Porphyromonas gingivalis into a mixed community. Mol Microbiol. 2006;60:121–139. doi: 10.1111/j.1365-2958.2006.05099.x. [DOI] [PubMed] [Google Scholar]
  20. Lamont RJ, El-Sabaeny A, Park Y, Cook GS, Costerton JW, Demuth DR. Role of the Streptococcus gordonii SspB protein in the development of Porphyromonas gingivalis biofilms on streptococcal substrates. Microbiology. 2002;148:1627–1636. doi: 10.1099/00221287-148-6-1627. [DOI] [PubMed] [Google Scholar]
  21. Li YH, Lau PC, Tang N, Svensater G, Ellen RP, Cvitkovitch DG. Novel two-component regulatory system involved in biofilm formation and acid resistance in Streptococcus mutans. J Bacteriol. 2002;184:6333–6342. doi: 10.1128/JB.184.22.6333-6342.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Loo CY, Corliss DA, Ganeshkumar N. Streptococcus gordonii biofilm formation: identification of genes that code for biofilm phenotypes. J Bacteriol. 2000;182:1374–1382. doi: 10.1128/jb.182.5.1374-1382.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lunsford RD. Streptococcal transformation: essential features and applications of a natural gene exchange system. Plasmid. 1998;39:10–20. doi: 10.1006/plas.1997.1323. [DOI] [PubMed] [Google Scholar]
  24. Macrina FL, Evans RP, Tobian JA, Hartley DL, Clewell DB, Jones KR. Novel shuttle plasmid vehicles for Escherichia-Streptococcus transgeneric cloning. Gene. 1983;25:145–150. doi: 10.1016/0378-1119(83)90176-2. [DOI] [PubMed] [Google Scholar]
  25. Manford M, Matharu J, Farrington K. Infective endocarditis in a district general hospital. J R Soc Med. 1992;85:262–266. doi: 10.1177/014107689208500507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. McNab R, Ford SK, El-Sabaeny A, Barbieri B, Cook GS, Lamont RJ. LuxS-based signaling in Streptococcus gordonii: autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis. J Bacteriol. 2003;185:274–284. doi: 10.1128/JB.185.1.274-284.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nambu Y, Sugai M, Gonda H, Lee CG, Katakai T, Agata Y, Yokota Y, Shimizu A. Transcription-coupled events associating with immunoglobulin switch region chromatin. Science. 2003;302:2137–2140. doi: 10.1126/science.1092481. [DOI] [PubMed] [Google Scholar]
  28. Nobbs AH, Vajna RM, Johnson JR, Zhang Y, Erlandsen SL, Oli MW, Kreth J, Brady LJ, Herzberg MC. Consequences of a sortase A mutation in Streptococcus gordonii. Microbiology. 2007;153:4088–4097. doi: 10.1099/mic.0.2007/007252-0. [DOI] [PubMed] [Google Scholar]
  29. Nyvad B, Kilian M. Microbiology of the early colonization of human enamel and root surfaces in vivo. Scand J Dent Res. 1987;95:369–380. doi: 10.1111/j.1600-0722.1987.tb01627.x. [DOI] [PubMed] [Google Scholar]
  30. Nyvad B, Kilian M. Comparison of the initial streptococcal microflora on dental enamel in caries-active and in caries-inactive individuals. Caries Res. 1990;24:267–272. doi: 10.1159/000261281. [DOI] [PubMed] [Google Scholar]
  31. Otto K, Silhavy TJ. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl Acad Sci U S A. 2002;99:2287–2292. doi: 10.1073/pnas.042521699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Palmer KL, Mashburn LM, Singh PK, Whiteley M. Cystic fibrosis sputum supports growth and cues key aspects of Pseudomonas aeruginosa physiology. J Bacteriol. 2005;187:5267–5277. doi: 10.1128/JB.187.15.5267-5277.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Park Y, Simionato MR, Sekiya K, et al. Short fimbriae of Porphyromonas gingivalis and their role in coadhesion with Streptococcus gordonii. Infect Immun. 2005;73:3983–3989. doi: 10.1128/IAI.73.7.3983-3989.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Parkins MD, Ceri H, Storey DG. Pseudomonas aeruginosa GacA, a factor in multihost virulence, is also essential for biofilm formation. Mol Microbiol. 2001;40:1215–1226. doi: 10.1046/j.1365-2958.2001.02469.x. [DOI] [PubMed] [Google Scholar]
  35. Pei J, Grishin NV. Type II CAAX prenyl endopeptidases belong to a novel superfamily of putative membrane-bound metalloproteases. Trends Biochem Sci. 2001;26:275–277. doi: 10.1016/s0968-0004(01)01813-8. [DOI] [PubMed] [Google Scholar]
  36. Podlesek Z, Comino A, Herzog-Velikonja B, Zgur-Bertok D, Komel R, Grabnar M. Bacillus licheniformis bacitracin-resistance ABC transporter: relationship to mammalian multidrug resistance. Mol Microbiol. 1995;16:969–976. doi: 10.1111/j.1365-2958.1995.tb02322.x. [DOI] [PubMed] [Google Scholar]
  37. Prigent-Combaret C, Vidal O, Dorel C, Lejeune P. Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli. J Bacteriol. 1999;181:5993–6002. doi: 10.1128/jb.181.19.5993-6002.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rosan B, Lamont RJ. Dental plaque formation. Microbes Infect. 2000;2:1599–1607. doi: 10.1016/s1286-4579(00)01316-2. [DOI] [PubMed] [Google Scholar]
  39. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: a Laboratory Manual. 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  40. Schaffer AA, Aravind L, Madden TL, Shavirin S, Spouge JL, Wolf YI, Koonin EV, Altschul SF. Improving the accuracy of PSI-BLAST protein database searches with composition-based statistics and other refinements. Nucleic Acids Res. 2001;29:2994–3005. doi: 10.1093/nar/29.14.2994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shemesh M, Tam A, Steinberg D. Differential gene expression profiling of Streptococcus mutans cultured under biofilm and planktonic conditions. Microbiology. 2007;153:1307–1317. doi: 10.1099/mic.0.2006/002030-0. [DOI] [PubMed] [Google Scholar]
  42. Simionato MR, Tucker CM, Kuboniwa M, Lamont G, Demuth DR, Tribble GD, Lamont RJ. Porphyromonas gingivalis genes involved in community development with Streptococcus gordonii. Infect Immun. 2006;74:6419–6428. doi: 10.1128/IAI.00639-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL., Jr Microbial complexes in subgingival plaque. J Clin Periodontol. 1998;25:134–144. doi: 10.1111/j.1600-051x.1998.tb02419.x. [DOI] [PubMed] [Google Scholar]
  44. Stock AM, Robinson VL, Goudreau PN. Two-component signal transduction. Annu Rev Biochem. 2000;69:183–215. doi: 10.1146/annurev.biochem.69.1.183. [DOI] [PubMed] [Google Scholar]
  45. Tao L, Herzberg MC. Identifying in vivo expressed streptococcal genes in endocarditis. Methods Enzymol. 1999;310:109–116. doi: 10.1016/s0076-6879(99)10009-0. [DOI] [PubMed] [Google Scholar]
  46. Terleckyj B, Shockman GD. Amino acid requirements of Streptococcus mutans and other oral streptococci. Infect Immun. 1975;11:656–664. doi: 10.1128/iai.11.4.656-664.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Terleckyj B, Willett NP, Shockman GD. Growth of several cariogenic strains of oral streptococci in a chemically defined medium. Infect Immun. 1975;11:649–655. doi: 10.1128/iai.11.4.649-655.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Toledo-Arana A, Merino N, Vergara-Irigaray M, Debarbouille M, Penades JR, Lasa I. Staphylococcus aureus develops an alternative, ica-independent biofilm in the absence of the arlRS two-component system. J Bacteriol. 2005;187:5318–5329. doi: 10.1128/JB.187.15.5318-5329.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Vickerman MM, Iobst S, Jesionowski AM, Gill SR. Genome-wide transcriptional changes in Streptococcus gordonii in response to competence signaling peptide. J Bacteriol. 2007;189:7799–7807. doi: 10.1128/JB.01023-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang Y, Lei Y, Khammanivong A, Herzberg MC. Identification of a novel two-component system in Streptococcus gordonii V288 involved in biofilm formation. Infect Immun. 2004;72:3489–3494. doi: 10.1128/IAI.72.6.3489-3494.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang Y, Lei Y, Nobbs A, Khammanivong A, Herzberg MC. Inactivation of Streptococcus gordonii SspAB alters expression of multiple adhesin genes. Infect Immun. 2005;73:3351–3357. doi: 10.1128/IAI.73.6.3351-3357.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS103635-supplement-supplement_1.pdf (127.6KB, pdf)

RESOURCES