Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 May 15.
Published in final edited form as: J Immunol. 2009 Feb 15;182(4):2476–2484. doi: 10.4049/jimmunol.0802059

Lactate Boosts TLR4 Signaling and NF-κB Pathway-Mediated Gene Transcription in Macrophages via Monocarboxylate Transporters and MD-2 Up-Regulation1

Devadoss J Samuvel †, Kamala P Sundararaj †, Alena Nareika †, Maria F Lopes-Virella *,†, Yan Huang *,†,2
PMCID: PMC2673542  NIHMSID: NIHMS82444  PMID: 19201903

Abstract

It has been shown that lactate induces insulin resistance. However, the underlying mechanisms have not been well understood. Based on our observation that lactate augments LPS-stimulated inflammatory gene expression, we proposed that lactate may enhance TLR4 signaling in macrophages, which has been shown to play an important role in insulin resistance in adipocytes. In this study, we demonstrated that lactate stimulated MD-2, a coreceptor for TLR4 signaling activation, NF-κB transcriptional activity, and the expression of inflammatory genes in human U937 histiocytes (resident macrophages). Similar enhancement of the inflammatory gene expression by lactate was also observed in human monocyte-derived macrophages. The essential role of MD-2 in lactate-augmented TLR4 signaling was confirmed by observation that the suppression of MD-2 expression by small interfering RNA led to significant inhibition of inflammatory gene expression. To further elucidate how lactate treatment enhances TLR4 activation, we showed that the augmentation of inflammatory gene expression by lactate was abrogated by antioxidant treatment, suggesting a critical role of reactive oxygen species in the enhancement of TLR4 activation by lactate. Finally, we showed that α-cyano-4-hydroxycinnamic acid, a classic inhibitor for monocarboxylate transporters, blocked lactate-augmented inflammatory gene expression and nuclear NF-κB activity, indicating that lactate transport through monocarboxylate transporters is required for lactate-enhanced TLR4 activation. Collectively, this study documents that lactate boosts TLR4 activation and NF-κB-dependent inflammatory gene expression via monocarboxylate transporters and MD-2 up-regulation.

Lactate is the end product of nonoxidative glycolysis. It is known that the blood lactate concentration is increased in patients with obesity, hypertension, and type 2 diabetes (1). Lactate level is also elevated locally in tissues suffering injury, infection, inflammation, or ischemia (2). Although tissue hypoxia plays a role in the elevation of lactate concentration, the high activity of aerobic glycolysis in activated macrophages and adipose tissue is the major cause for high lactate production (1, 3). Lactate has been shown to be not only an important intermediary in metabolic processes, but also an active player in inflammation (4–7). Our laboratory has demonstrated that lactate enhanced LPS-stimulated cytokine expression by macrophages, indicating that lactate promotes the innate immune activation (8).

It has been well documented that elevated plasma lactate is a marker for cellular stress (9–12) and an independent risk factor for type 2 diabetes (13). To delineate how lactate is associated with type 2 diabetes, it was demonstrated that lactate induced insulin resistance (1). It was further reported that lactate treatment inhibited insulin action by inhibiting insulin receptor substrate 1- and 2-mediated PI3K and Akt/protein kinase B (14, 15). Recently, the role of TLR4, a receptor involved in the innate immune activation, in insulin resistance has been reported by a number of laboratories (16–20). For example, Flier and colleagues showed that TLR4 knockout mice had protection against high fat diet-induced insulin resistance (16). Similarly, Saad and coworkers showed that mice with natural loss-of-function mutation in TLR4 had significant reduction of high fat diet-induced insulin resistance as compared with wild-type mice (17). Moreover, the role of TLR4 expression by macrophages in insulin resistance was studied in a macrophage-adipocyte coculture system, which showed that inflammatory cytokines released by macrophages as a result of TLR4 activation blocked insulin action in adipocytes by inhibiting glucose transporter 4 and insulin receptor substrate 1 (21, 22). Based on these findings and our observations that lactate enhances LPS-stimulated expression of inflammatory genes in macrophages (8), we hypothesized that lactate promotes TLR4 activation and subsequent inflammatory gene expression in macrophages, which has been shown to induce insulin resistance.

In the present study, we examined the effect of lactate on TLR4 activation and the downstream NF-κB signaling and transcriptional activity. We demonstrated that lactate stimulated MD-2, a TLR4 coreceptor (23), NF-κB signaling, and the downstream inflammatory gene transcription, and that MD-2 played an essential role in lactate-augmented inflammatory gene expression. We also demonstrated that the action of lactate on inflammatory gene expression is antioxidant-sensitive and monocarboxylate transporter (MCT)3-dependent.

Materials and Methods

Cell culture

U937 histiocytes (resident macrophages) (24) were purchased from American Type Culture Collection. The cells were cultured in a 5% CO2 atmosphere in RPMI 1640 medium (Invitrogen) containing 10% FCS, 1% MEM nonessential amino acid solution, and 0.6 g/100 ml of HEPES. The medium was changed every 2–3 days. Human monocytes were isolated, cultured, and differentiated to macrophages as described previously (25). U937 cells or human macrophages were pretreated with 20 mM sodium L-lactate (pH 7.5) (Sigma-Aldrich) for 24 h. After the medium was changed, the cells were treated with the same concentration of sodium lactate and 100 ng/ml LPS (Sigma-Aldrich) for another 24 h.

PCR array

First-strand cDNA was synthesized from RNA using an RT2 first-strand kit (SuperArray Bioscience). The expression of genes related to TLR-mediated signal transduction was profiled using the human TLR Signaling Pathway RT2 Profiler PCR array (catalog no. PAHS-018, SuperArray Bioscience) by following the instructions from the manufacturer.

Real-time PCR

Total RNA was isolated from cells using the RNeasy Mini kit (Qiagen). First-strand cDNA was synthesized with the iScript cDNA synthesis kit (Bio-Rad) using 20 μl of reaction mixture containing 0.25 μg of total RNA, 4 μl of 5X iScript reaction mixture, and 1 μl of iScript reverse transcriptase. The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (Bio-Rad/MJ Research). The reverse transcription reaction mixture was then diluted 1/10 with nuclease-free water and used for PCR amplification of cDNA in the presence of the primers. The Beacon designer software (Premier Biosoft International) was used for primer designing (Table I). Primers were synthesized (Integrated DNA Technologies), and real-time PCR was performed in duplicate using 25 μl of reaction mixture containing 1.0 μl of reverse transcription mixture, 0.2 μM of both primers, and 12.5 μl of iQ SYBR Green Supermix (Bio-Rad Laboratories). Real-time PCR was run in the iCycler real-time detection system (Bio-Rad) with a two-step method. The hot-start enzyme was activated (95°C for 3 min) and cDNA was then amplified for 40 cycles consisting of denaturation at 95°C for 10 s and annealing/extension at 53°C for 45 s. A melt curve assay was then performed (55°C for 1 min and then temperature was increased by 0.5°C every 10 s) to detect the formation of primer-derived trimers and dimers. GAPDH served as a control. Data were analyzed with the iCycler iQ software. The average starting quantity of fluorescence units was used for analysis. Quantification was calculated using the starting quantity of targeted cDNA relative to that of GAPDH cDNA in the same sample.

Table I.

Sequences of the primers used in real-time PCR

Genes Forward Primer Reverse Primer
IL-1β CTGTACGATCACTGAACTGC CACCACTTGTTGCTCCATATC
IL-6 AACAACCTGAACCTTCCAAAGATG TCAAACTCCAAAAGACCAGTGATG
CSF2 ACTTTCTGCTTGTCATCCC CTTCTGCCATGCCTGTATC
CXCL10 CTTAGACATATTCTGAGCCTAC GTTGATTACTAATGCTGATGC
MD-2 CACCATGAATCTTCCAAAGC CTTGAAGGAGAATGATATTGTTG
GAPDH CTGAGTACGTCGTGGAGTC AAATGAGCCCCAGCCTTC
Open in a new tab

ELISA

IL-6 in conditioned medium was quantified using sandwich ELISA kits according to the protocol provided by the manufacturer (R&D Systems).

Immunoblotting of MD-2 and TLR4

Cytoplasma protein (50 μg) in each sample was electrophoresed in a 10% polyacrylamide gel. After transferring proteins to a polyvinylidene difluoride membrane, MD-2 and TLR4 were immunoblotted with primary Abs and HRP-conjugated secondary Ab (Santa Cruz Biotechnology). MD-2 and TLR4 were detected by incubating the membrane with chemiluminescence reagent (NEN Life Science Products) for 1 min and exposing it to x-ray film for 1 min.

MD-2 small interfering RNA (siRNA) trnasfection

U937 cells were transfected with 200 nM of stealth MD-2 siRNA (CGCAAAGAAGUUAUUUGCCGAGGAU) (GenBank accession no. NM_015364) or control siRNA (CGCAAGAAUUGGUUUAGCCGAAGAU) (Invitrogen) for 24–36 h using Lipofectamine 2000 (Invitrogen) as the transfection reagent by following the manufacturer’s instruction.

NF-κB reporter assay

U937 cells grown in 12-well plates with RPMI 1640 medium containing 10% FBS were transfected with 1 μg of NF-κB promoter-firefly/Renilla luciferase (40/1) reporter constructs (SuperArray Bioscience) using Lipofectamine 2000 (Invitrogen) for 18–20 h. The cells were then treated with fresh medium containing 100 ng/ml LPS, 20 mM of sodium lactate, or both for 24 h. After the treatment, the cells were rinsed with cold PBS and lysed with reporter lysis buffer (Promega). The lysate was centrifuged at 15,000 × g for 5 min at 4°C, and the supernatant was harvested. Both firefly and Renilla luciferase levels were measured in a luminometer using the dual-luciferase reporter assay reagents according to the instructions from the manufacturer (SuperArray Bioscience). The firefly luciferase levels were normalized to the Renilla luciferase levels.

Treatment of U937 cells with antioxidants and MCT inhibitor α-cyano-4-hydroxycinnamic acid (α-CHCA)

To determine whether the augmentation of inflammatory cytokine IL-6 by sodium lactate and LPS was mediated by reactive oxygen species, U937 cells were treated with sodium lactate, LPS, or both in the presence or absence of antioxidant N-acetyl-L-cysteine (NAC) (0–10 mM) or DMSO (0–1%) (Sigma-Aldrich) for 24 h. To block MCT, U937 cells were pre-treated with 2 mM of α-CHCA (Sigma-Aldrich) for 30 min and then treated with lactate, LPS, or both in the presence of α-CHCA for 18 h. The concentration of α-CHCA (2 mM) applied in our present study is similar to or lower than those used in the previous studies (26–28). Our pilot studies showed that this concentration did not inhibit cell viability.

Statistic analysis

Data were presented as means ± SD. Student’s t tests were performed to determine the statistical significance of cytokine expression among different experimental groups. A value of p < 0.05 was considered significant.

Results

Lactate and LPS acted in concert to stimulate inflammatory gene expression

In the first experiment, we employed a TLR pathway-focused gene array to study the effect of lactate and LPS on inflammatory gene expression by U937 mononuclear cells. Results showed that LPS stimulated 10 genes in the array by 2-fold or more (Table II). Most of these genes are inflammatory cytokines such as GM-CSF (CSF2), IL-6, and IL-1β, and chemokines such as MCP-1, IL-8, and CXCL10. These genes also included MD-2, which is a co-receptor for TLR4 (23); C-type lectin domain family 4, member E (CLEC4E), which is a macrophage-inducible C-type lectin involved in infection and inflammation (29); cyclooxygenase 2 (COX2); and TLR6. Interestingly, the genes stimulated by lactate overlapped with most of the genes stimulated by LPS (7 of 10). Although the stimulatory effect of lactate on these genes was relatively less potent than that of LPS, lactate markedly augmented LPS-stimulated gene expression (Table II). For example, lactate and LPS stimulated IL-1β by 2.78- and 7.03-fold, respectively, but the combination of lactate and LPS up-regulated IL-1β by 59.2-fold (Table II). Similar synergism by lactate and LPS was observed on the expression of MCP-1, CXCL10, IL-8, and CLEC4E. Furthermore, although lactate had no effect on CSF2, IL-6, and TNF-α by itself, it enhanced the effect of LPS on these genes by 5.2-, 7.3-, and 2.9-fold, respectively, as compared with LPS alone (Table II). To confirm the observations from the above gene array analysis, we performed real-time PCR analysis. Results showed the similar synergistic effect of lactate and LPS on the expression of IL-1β, IL-6, CSF2, CXCL10, and IL-8 (Fig. 1, A—E).

Table II.

Lactate enhances LPS signal pathway-mediated gene expressiona

Genes LPS/Control Lactate/Control Lactate +
LPS/Control		 Lactate +
LPS/LPS
MD-2 2.95 2.88 10.46 3.5
CD86 1.16 2.78 4.56 3.9
MCP-1 4.18 2.34 21.67 5.2
CXCL10 7.58 2.98 48.08 6.3
IL-8 9.27 3.54 63.45 6.8
CLEC4E (C-type lectin
 domain family 4)		 14.55 2.18 72.88 5.0
CSF2 (GM-CSF) 17.91 1.21 92.89 5.2
IL-1β 7.03 2.78 59.20 8.4
IL-6 4.03 0.89 29.60 7.3
JUN (Jun oncogene) 1.43 1.90 4.40 3.1
COX2 3.39 1.54 20.22 6.0
TNF-α 1.2 1.34 3.45 2.9
TLR6 2.02 2.18 5.61 2.8
Open in a new tab
a

U937 cells were pretreated with 20 mM of sodium lactate (pH 7.4) for 24 h. After the medium was changed, the cells were treated with 100 ng/ml LPS, 20 mM of lactate, or both for another 24 h. The RNA was isolated and subjected to the PCR array as described in Materials and Methods. The data presented are the averages of duplicate samples. All the gene expressions were normalized to the expression of the housekeeping gene GAPDH prior to the calculation of the ratios.

FIGURE 1.

FIGURE 1

Open in a new tab

The effect of lactate on LPS-stimulated inflammatory gene expression by U937 histiocytes. U937 cells were pretreated with 20 mM of sodium lactate for 24 h and then treated with 20 mM of sodium lactate and 100 ng/ml LPS in fresh medium for another 24 h. After the treatment, RNA was isolated and converted to cDNA that was subjected to real-time PCR to quantify IL-1β (A), IL-6 (B), CSF2 (C), CXCL10 (D), and IL-8 (E). F, U937 cells were pretreated with 0, 5, 10, and 20 mM of sodium lactate for 24 h and then treated with 100 ng/ml LPS in the presence of same concentration of sodium lactate for 24 h. The IL-6 released by cells into culture medium was quantified using ELISA. The data (mean ± SD) presented are from one of three independent experiments with similar results.

To show the effect of lactate on LPS-stimulated inflammatory cytokine expression at the protein level, we selected IL-6 as a representative cytokine. Results showed that lactate augmented LPS-stimulated IL-6 protein expression in a concentration-dependent manner, and 10 and 20 mM of lactate augmented LPS-stimulated IL-6 protein expression by 61% and 107%, respectively (Fig. 1F).

Lactate augmented LPS-stimulated inflammatory gene expression by human monocyte-derived macrophages (HMDMs)

To determine whether human normal macrophages have similar responses to lactate and LPS as U937 cells, the expression of IL-1β, IL-6, CXCL10, and IL-8 in HMDMs was quantified using real-time PCR after cells were challenged with lactate, LPS, or both. Results showed that although lactate by itself had no effect on IL-1β, IL-6, and IL-8 expression, it significantly augmented LPS-stimulated expression of these genes (Fig. 2, A—C). For CXCL10, both lactate and LPS stimulated its expression, and their combination led to a synergism of its expression (Fig. 2D). Although the stimulatory effect of lactate and LPS on HMDMs was not as strong as that on U937 cells, the differences of the gene expression between HMDMs treated with lactate plus LPS and those with LPS alone were statistically significant.

FIGURE 2.

FIGURE 2

Open in a new tab

The effect of lactate on LPS-stimulated inflammatory gene expression by HMDMs. HMDMs were pretreated with 20 mM of sodium lactate for 24 h and then treated with 20 mM of sodium lactate and 100 ng/ml LPS in fresh medium for another 24 h. After the treatment, RNA was isolated and converted to cDNA that was subjected to real-time PCR to quantify IL-1β (A), IL-6 (B), CXCL10 (C), and IL-8 (D). The data (mean ± SD) presented are from one of three independent experiments with similar results.

Lactate enhanced NF-κB activity

It is known that TLR4 activation by LPS elicits NF-κB signaling that mediates inflammatory gene expression in macrophages (30). Since lactate augmented LPS-stimulated inflammatory gene expression, we examined the effect of lactate on NF-κB activation. First, we determined the cellular level of IκBα and IκBβ, the endogenous inhibitors of NF-κB, since increased degradation of IκBα and IκBβ leads to more free NF-κB and increased NF-κB transcriptional activity in nucleus (31). Results (Fig. 3) showed that after treatment for 2 h, LPS reduced the IκBα level while lactate reduced the IκBβ level, and the combination of LPS and lactate reduced both IκBα and IκBβ levels. After treatment for 4 h, either LPS or lactate reduced the IkBα level, and the combination of LPS and lactate further decreased IκBα level. Second, we determined the NF-κB transcriptional activity. Results (Fig. 4) showed that either lactate or LPS stimulated NF-κB transcriptional activity, although lactate was less potent than LPS, and the combination of both had a synergistic effect. In contrast, lactate, LPS, or both had no effect on CREB, which has been shown to play an important role in the inflammation (32).

FIGURE 3.

FIGURE 3

Open in a new tab

The effect of lactate, LPS, or lactate plus LPS on cellular IkBα and IkBβ levels. U937 cells were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both for 2 and 4 h. After the treatment, cells were lysed and cellular IκBα and IκBβ levels were determined using immunoblotting as described in Materials and Methods. The blot presented is from one of two independent experiments with similar results.

FIGURE 4.

FIGURE 4

Open in a new tab

NF-κB transcriptional activity in U937 cells treated with lactate, LPS, or both. U937 cells were transfected with NF-κB or CREB promoter-luciferase reporter construct as described in Materials and Methods. After the transfection, cells were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both for 24 h and the cellular luciferase activity was then determined. The data presented are from one of three independent experiments with similar results.

Synergism of lactate and LPS on MD-2 expression

Our gene expression array analysis showed that lactate and LPS stimulated MD-2, a TLR4 coreceptor (23), by 2.88- and 2.95-fold, and the combination of lactate and LPS led to a 10.46-fold synergistic stimulation (Table II). Since MD-2 is a coreceptor for TLR4 and is essential for TLR4 signaling activation, we performed real-time PCR and immunoblotting to confirm the observation from the array analysis. Results showed a similar synergistic effect of lactate and LPS on MD-2 gene expression at the mRNA level (Fig. 5A) and protein level (Fig. 5B). In contrast, no stimulation by lactate, LPS, or both on TLR4 expression was observed (Fig. 5B).

FIGURE 5.

FIGURE 5

Open in a new tab

The effect of lactate, LPS, or lactate plus LPS on MD-2 mRNA (A) and protein (B) expression. U937 cells were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both for 24 h. After the treatment, RNA and protein were isolated and the MD-2 mRNA and protein were determined using real-time PCR and immunoblotting, respectively, as described in Materials and Methods. TLR4 protein was also detected using immunoblotting.

MD-2 was essential for the augmentation of LPS-stimulated IL-6 expression by lactate

Given that MD-2 plays a key role in TLR4 signaling (23), we hypothesized that MD-2 was essential for the augmentation of LPS-stimulated inflammatory cytokine expression by lactate. To test this hypothesis, we suppressed cellular MD-2 expression using the siRNA technique before challenging cells with lactate and LPS. Results showed that the transfection of U937 cells with MD-2 siRNA led to a marked inhibition of MD-2 expression (Fig. 6A). In response to LPS, the cells transfected with MD-2 siRNA had a 78% decrease in IL-6 secretion as compared with those transfected with the control siRNA (Fig. 6B). In response to lactate plus LPS, the cells transfected with MD-2 siRNA had a 61% decrease in IL-6 secretion as compared with those transfected with the control siRNA (Fig. 6B). By combining the results shown in Figs. 5 and 6, it suggests that lactate augmented LPS-stimulated IL-6 expression via MD-2 up-regulation.

FIGURE 6.

FIGURE 6

Open in a new tab

Inhibition of lactate-augmented IL-6 secretion by suppression of MD-2 expression using siRNA. A, U937 macrophages were transfected with MD-2 siRNA or control siRNA using Lipofectamine 2000 as the transfection reagent for 24–36 h, and the expression of MD-2 was then determined using immunoblotting. B, After the transfection, the cells were pretreated with 20 mM of sodium lactate for 24 h and medium was changed. The cells were treated with 20 mM of sodium lactate in the presence or absence of 100 ng/ml LPS for another 24 h. The conditioned medium was collected for quantification of IL-6 using ELISA.

The stimulatory effect of lactate and LPS on inflammatory gene expression was antioxidant-sensitive

In our effort to further explore the mechanisms whereby lactate and LPS synergistically stimulate inflammatory cytokine gene expression, we found that both NAC and DMSO, two well-known antioxidants, inhibited lactate and LPS-stimulated IL-6 secretion in a concentration-dependent manner (Fig. 7). NAC at 10 mM and DMSO at 1% of the culture medium inhibited lactate and LPS-stimulated IL-6 secretion by 95% and 78%, respectively, suggesting the involvement reactive oxygen species (ROS) in the up-regulation of inflammatory gene expression by lactate and LPS.

FIGURE 7.

FIGURE 7

Open in a new tab

The effect of antioxidants on lactate-augmented IL-6 gene expression. U937 cells were treated with 20 mM of sodium lactate and 100 ng/ml LPS in the presence or absence of different concentrations of NAC (A) or DMSO (B) for 24 h. After the treatment, culture medium was collected for ELISA to quantify IL-6. The data (mean ± SD) presented are from one of four independent experiments with similar results.

Augmentation of IL-6 expression and NF-κB transcription by lactate was MCT-dependent

It is known that the proton-linked MCTs facilitate lactate transport through the plasma membrane (33, 34). To determine whether lactate transport across the plasma membrane through MCTs is required for the action of lactate on NF-κB signaling and down-stream gene expression, U937 cells were treated with lactate, LPS, or both in the presence or absence of α-CHCA, a classic MCT inhibitor. Results showed that α-CHCA at 2 mM had no effect on LPS-stimulated IL-6 secretion as expected, but significantly inhibited the augmentation of LPS-stimulated IL-6 expression by lactate (Fig. 8). Furthermore, results showed that α-CHCA had no effect on the baseline and LPS-stimulated NF-κB transcriptional activity, but that it inhibited lactate-augmented NF-κB transcriptional activity (Fig. 9).

FIGURE 8.

FIGURE 8

Open in a new tab

The effect of MCT inhibitor on the synergistic effect of lactate and LPS on IL-6 secretion. U937 cells were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both in the presence or absence of 2 mM of MCT inhibitor α-CHCA for 24 h, and IL-6 released into medium was quantified using ELISA. The data (mean ± SD) presented are from one of three independent experiments with similar results.

FIGURE 9.

FIGURE 9

Open in a new tab

The effect of MCT inhibitor on NF-κB transcriptional activity. U937 cells were transfected with NF-κB promoter-luciferase reporter construct as described in Materials and Methods. After the transfection, U937 cells were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both in the presence or absence of 2 mM of MCT inhibitor α-CHCA for 24 h and the cellular luciferase activity was then determined. The data (mean ± SD) presented are from one of three independent experiments with similar results.

Inhibition of lactate-increased MD-2 expression by MCT inhibitor and antioxidant

The above studies indicated that MD-2 played an essential role in lactate-augmented TLR4 signaling (Fig. 6), and that MCT inhibitor and antioxidants inhibited lactate-boosted LPS signaling (Figs. 7–9). However, it remains unclear if MCT inhibitor and antioxidants inhibited lactate-augmented LPS signaling by suppressing MD-2 gene expression. Thus, we investigated the effect of α-CHCA and NAC on lactate-increased MD-2 expression. Results showed that α-CHCA and NAC inhibited the stimulatory effect of lactate on MD-2 expression by 50% and inhibited the stimulatory effect of lactate plus LPS on MD-2 expression by 79% and 53%, respectively (Fig. 10). These results suggest that MD-2 is a target of α-CHCA and NAC for their inhibition on TLR4 signaling.

FIGURE 10.

FIGURE 10

Open in a new tab

Inhibition of lactate-augmented MD-2 expression by α-CHCA and NAC. U937 macrophages were treated with 20 mM of sodium lactate, 100 ng/ml LPS, or both in the presence or absence of 2 mM of α-CHCA or 5 mM of NAC for 24 h. After the treatment, RNA was isolated from the cells and reversely transcribed into cDNA, which was used for real-time PCR to quantify MD-2 mRNA expression. The data (mean ± SD) presented are from one of two independent experiments with similar results.

Discussion

It has been well documented that both macrophages and adipocytes have high glycolytic activity and high lactate secretion (1, 35, 36). In adipose tissue, the fat cell size is positively correlated with the conversion of glucose to lactate. Fat cells from obese or diabetic rats or humans can metabolize as much as 50–70% of the glucose taken up to lactate (1). A study of patients also showed that type 2 diabetes was associated with an increased lactate production in adipocytes (1). Thus, macrophages in adipose tissue of patients with obesity or type 2 diabetes are likely to be exposed to a high concentration of lactate. Given the importance of macrophage TLR4 in insulin resistance in adipose tissue as reported by recent studies (16–22), it is appealing to appraise the role of lactate in macrophage TLR4 activation. The elucidation of lactate action on TLR4 activation would help understand how lactate promotes inflammation that has been shown to be involved in insulin resistance in previous studies (1, 14, 15).

In the present study, we utilized a TLR pathway-focused gene expression array in our initial investigation to examine the effect of lactate on the TLR4-dependent gene expression. Most of the findings from the array analysis were confirmed by subsequent experiments using real-time PCR analysis, ELISA, and immunoblots. From these analyses, we were able to demonstrate that lactate augmented TLR4-dependent expression of inflammatory genes in both U937 histiocytes and HMDMs. Furthermore, we showed that lactate boosted TLR4 activation by augmenting LPS-induced MD-2 expression and NF-κB signaling.

MD-2 is an accessory protein of TLR4, necessary for assembling a receptor complex to sense LPS to trigger innate immune responses (37). It has been shown that mice lacking MD-2 did not respond to LPS and survived experimentally induced endotoxin shock (38). Thus, MD-2 expression and its association with TLR4 are critical for TLR4 activation. The role of MD-2 in inflammation is further suggested by the findings that the expression of MD-2 is up-regulated by inflammatory cytokine IL-6 and IFN-γ (37). In the present study, we first demonstrated that lactate not only increased MD-2 expression by itself, but also augmented LPS-stimulated MD-2 expression (Fig. 5). In contrast, lactate had no effect on TLR4 expression (Fig. 5B), indicating that lactate specifically stimulates MD-2 expression. Second, our studies showed that the suppression of MD-2 expression using MD-2 siRNA led to a significant reduction of IL-6 secretion by cells treated with LPS or lactate plus LPS (Fig. 6). Given the crucial role of MD-2 in TLR4 signaling, these findings explain how lactate boosts TLR4 activation and NF-κB-mediated down-stream inflammatory gene expression.

It is striking to find that preexposure of U937 cells to lactate led to a robust augmentation of LPS-stimulated expression of many inflammatory genes such as IL-1β, IL-6, TNF-α, CSF2, MCP-1, CXCL10, and IL-8. Some of these cytokines such as IL-6 and TNF-α have been reported to play a critical role in insulin resistance (21, 22). It is also expected that the enhanced up-regulation of chemokines such as MCP-1, CXCL10, and IL-8 by lactate would facilitate the recruitment of more monocytes into adipose tissue and thus promote inflammation. In addition to monocytes, MCP-1 also recruits T lymphocytes, eosinophils, and basophils (39), while CXCL10, known as IFN-γ-induced protein, recruits T lymphocytes (40). IL-8 is a major chemokine released by mononuclear cells in response to TLR4 and induces recruitment of neutrophil and macrophage activation (41). Moreover, our data from the gene expression array analysis also showed that although lactate by itself did not stimulate COX2, it markedly augmented LPS-stimulated COX2 by 6-fold (Table II). This is an interesting finding since COX2 is a key enzyme involved in the biosynthesis of eicosanoids that are mediators for inflammation (42). A clinical study has shown that the inhibition of COX2 led to increased insulin sensitivity (43). The role of lactate in COX2 expression and the underlying mechanisms are currently under investigation in our laboratory. Clearly, our data have underscored the importance of lactate in the activation of the innate immunity that has been shown to contribute to insulin resistance.

The diffusion of monocarboxylates such as lactate and pyruvate across the plasma membrane of mammalian cells is facilitated by MCTs, a family of integral membrane transporter proteins (33, 34). Presently, at least 14 putative members of this family have been reported, although to date only 4 of these, MCT1–4, have been functionally verified to transport H+ and lactate (44). The lactate transport across the plasma membrane depends on the gradients of both H+ and lactate across the plasma membrane. In our experiments, since the cells were incubated with 20 mM of sodium lactate, which was much higher than the intracellular lactate concentration, it was expected that lactate was transported from extracellular into intracellular compartment through MCTs. To confirm that lactate transport through MCTs is required for its action on TLR4 activation, we used α-CHCA, a classic MCT inhibitor. Our results showed that 2 mM of α-CHCA significantly inhibited lactate-enhanced NF-κB transcriptional activity and IL-6 expression (Figs. 8 and 9), suggesting that the lactate transport through MCTs is crucial for the action of lactate on TLR4 activation and inflammatory gene expression. Furthermore, our results showed that α-CHCA inhibited lactate-stimulated MD-2 expression (Fig. 10), suggesting that lactate transport is required for MD-2 up-regulation, which leads to an increase in TLR4 signaling.

It has been shown that ROS modulates NF-κB-dependent transcription of inflammatory gene expression through their involvement in the early TLR4-mediated cellular responses (45, 46). In the present study, we demonstrated that antioxidants NAC and DMSO effectively inhibited lactate-augmented IL-6 expression (Fig. 7), suggesting that the cellular event for enhancing TLR4 signaling triggered by lactate is oxidation-dependent. Our additional experiments showed that NAC inhibited MD-2 expression significantly (Fig. 10), indicating that lactate-stimulated MD-2 expression is also oxidation-dependent. From the collective results, it appears that lactate transport across the membrane results in an increase in ROS production and MD-2 expression that augments LPS signaling and downstream expression of inflammatory genes. Antioxidation had been considered as a new approach in treatment of insulin resistance since it is known that oxidative stress-related generation of ROS plays an important role in insulin resistance (47). Given the critical role of TLR4 in insulin resistance and the effectiveness of antioxidants in inhibiting TLR4-mediated inflammatory gene expression, our present study further supports that antioxidants have potential to be used in the treatment of insulin resistance.

Lactate not only serves as a fuel source and gluconeogenic precursor, but it also acts as a signaling molecule (48). Brooks and coworkers demonstrated that lactate increased ROS production and up-regulated 673 genes, many known to be responsive to ROS, in L6 myogenic cells (49). Their findings are consistent with our observation that ROS is involved in the augmentation of LPS-stimulated inflammatory gene expression by lactate. It is known that bacterial infection and LPS increase lactate production (2, 50), and lactate boosted LPS signaling-mediated inflammatory gene expression as shown by the present study. These findings, therefore, reveal a molecular mechanism by which the actions of LPS and lactate lead to a vicious cycle that promotes TLR4-mediated inflammation and contributes to a number of diseases, including type 2 diabetes and cardiovascular disease.

Acknowledgments

We gratefully acknowledge the assistance of Yanchun Li for drawing blood and isolation of human monocytes.

Footnotes

Disclosures The authors have no financial conflicts of interest.

1

This work was supported by National Institutes of Health Grant DE16353 and a Merit Review Grant from the Department of Veterans Affairs (to Y.H.).

3
Abbreviations used in this paper
MCT
monocarboxylate transporter
α-CHCA
α-cyano-4-hydroxycinnamic acid
COX2
cyclooxygenase 2
HMDM
human monocyte-derived macrophage
NAC
N-acetyl-L-cysteine
ROS
reactive oxygen species
siRNA
small interfering RNA

References

  • 1.DiGirolamo M, Newby FD, Lovejoy J. Lactate production in adipose tissue: a regulated function with extra-adipose implications. FASEB J. 1992;6:2405–2412. doi: 10.1096/fasebj.6.7.1563593. [DOI] [PubMed] [Google Scholar]
  • 2.Jensen JC, Buresh C, Jeffrey AN. Lactic acidosis increases tumor necrosis factor secretion and transcription in vitro. J. Surg. Res. 1990;49:350–353. doi: 10.1016/0022-4804(90)90036-2. [DOI] [PubMed] [Google Scholar]
  • 3.Beckert S, Farrahi F, Aslam R, Scheuenstuhl H, Konigsrainer A, Hussain Z, Hunt TK. Lactate stimulates endothelial cell migration. Wound Repair Regen. 2006;14:321–324. doi: 10.1111/j.1743-6109.2006.00127.x. [DOI] [PubMed] [Google Scholar]
  • 4.Hiederman R, Zhang J, Kashke S. Short-chain carboxylic-acid-stimulated, PMN-mediated gingival inflammation. Crit. Rev. Oral Biol. Med. 1997;8:269–290. doi: 10.1177/10454411970080030301. [DOI] [PubMed] [Google Scholar]
  • 5.Iscra F, Gullo A, Biolo G. Bench-to-bedside review: lactate and the lung. Crit. Care. 2002;6:327–329. doi: 10.1186/cc1519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hunt TK, Conlly WB, Aronson SB, Goldstein P. Anaerobic metabolism and wound healing: a hypothesis for the initiation and cessation of collagen synthesis. Am. J. Surg. 1978;135:328–332. doi: 10.1016/0002-9610(78)90061-2. [DOI] [PubMed] [Google Scholar]
  • 7.Roth S, Droge W. Regulation of interleukin 2 production, interleukin 2 mRNA expression and intracellular glutathione levels in ex vivo derived T lymphocytes by lactate. Eur. J. Immunol. 1991;21:1933–1937. doi: 10.1002/eji.1830210823. [DOI] [PubMed] [Google Scholar]
  • 8.Nareika A, He L, Game BA, Slate EH, Sanders JJ, London SD, Lopes-Virella MF, Huang Y. Sodium lactate increases LPS-stimulated MMP and cytokine expression in U937 histiocytes by enhancing AP-1 and NFκB transcriptional activities. Am. J. Physiol. 2005;289:E534–E542. doi: 10.1152/ajpendo.00462.2004. [DOI] [PubMed] [Google Scholar]
  • 9.Miller AM, Nolan MJ, Choi J, Koga T, Shen X, Yue BYJT, Knepper PA. Lactate treatment causes NF-κB activation and CD44 shedding in cultured trabecular meshwork cells. Invest. Ophthalmol. Visual Sci. 2007;48:1615–1621. doi: 10.1167/iovs.06-1086. [DOI] [PubMed] [Google Scholar]
  • 10.Moorcroft J, Dodd ME, Morris J, Webb AK. Symptoms, lactate and exercise limitation at peak cycle ergometry in adults with cystic fibrosis. Eur. Respir. J. 2005;25:1050–1056. doi: 10.1183/09031936.05.00011404. [DOI] [PubMed] [Google Scholar]
  • 11.Bartsch T, Alfke K, Wolff S, Rohr A, Jansen O, Deuschl G. Focal MR spectroscopy of hippocampal CA-1 lesions in transient global amnesia. Neurology. 2008;70:1030–1035. doi: 10.1212/01.wnl.0000306633.06027.33. [DOI] [PubMed] [Google Scholar]
  • 12.Mizock BA. Significance of hyperlactatemia without acidosis during hypermetabolic stress. Crit. Care Med. 1997;25:1780–1781. doi: 10.1097/00003246-199711000-00009. [DOI] [PubMed] [Google Scholar]
  • 13.Ohlson LO, Larsson B, Bjorntorp P, Eriksson H, Svardsudd K, Welin L, Tibblin G, Wilhelmsen L. Risk factors for type 2 (non-insulin-dependent) diabetes mellitus: thirteen and one-half years of follow-up of the participants in a study of Swedish men born in 1913. Diabetologia. 1988;31:798–805. doi: 10.1007/BF00277480. [DOI] [PubMed] [Google Scholar]
  • 14.Lombardi AM, Fabris R, Bassetto F, Serra R, Leturque A, Federspil G, Girard J, Vettor R. Hyperlactatemia reduces muscle glucose uptake and GLUT-4 mRNA while increasing (E1a) PDH gene expression in rat. Am. J. Physiol. 1999;276:E922–E929. doi: 10.1152/ajpendo.1999.276.5.E922. [DOI] [PubMed] [Google Scholar]
  • 15.Choi CS, Kim YB, Lee FN, Zabolotny JM, Kahn BB, Youn JH. Lactate induces insulin resistance in skeletal muscle by suppressing glycolysis and impairing insulin signaling. Am. J. Physiol. 2002;283:E233–E240. doi: 10.1152/ajpendo.00557.2001. [DOI] [PubMed] [Google Scholar]
  • 16.Shi H, Kokoeva MV, Inouye K, Tzameli I, Yin H, Flier JS. TLR4 links innate immunity and fatty acid-induced insulin resistance. J. Clin. Invest. 2006;116:3015–3025. doi: 10.1172/JCI28898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara SM, Schenka AA, Araujo EP, Vassallo J, Curi R, Velloso LA, Saad MJ. Loss-of-function mutation in Toll-like receptor 4 prevents diet-induced obesity and insulin resistance. Diabetes. 2007;56:1986–1998. doi: 10.2337/db06-1595. [DOI] [PubMed] [Google Scholar]
  • 18.Kim F, Pham M, Luttrell I, Bannerman DD, Tupper J, Thaler J, Hawn TR, Raines EW, Schwartz MW. Toll-like receptor-4 mediates vascular inflammation and insulin resistance in diet-induced obesity. Circ. Res. 2007;100:1589–1596. doi: 10.1161/CIRCRESAHA.106.142851. [DOI] [PubMed] [Google Scholar]
  • 19.Poggi M, Bastelica D, Gual P, Iglesias MA, Gremeaux T, Knauf C, Peiretti F, Verdier M, Juhan-Vague I, Tanti JF, et al. C3H/HeJ mice carrying a Toll-like receptor 4 mutation are protected against the development of insulin resistance in white adipose tissue in response to a high-fat diet. Diabetologia. 2007;50:1267–1276. doi: 10.1007/s00125-007-0654-8. [DOI] [PubMed] [Google Scholar]
  • 20.Song MJ, Kim KH, Yoon JM, Kim JB. Activation of Toll-like receptor 4 is associated with insulin resistance in adipocytes. Biochem. Biophys. Res. Commun. 2006;346:739–745. doi: 10.1016/j.bbrc.2006.05.170. [DOI] [PubMed] [Google Scholar]
  • 21.Permana PA, Menge C, Reaven PD. Macrophage-secreted factors induce adipocyte inflammation and insulin resistance. Biochem. Biophys. Res. Commun. 2006;341:506–514. doi: 10.1016/j.bbrc.2006.01.012. [DOI] [PubMed] [Google Scholar]
  • 22.Lumeng CN, Deyoung SM, Saltiel AR. Macrophages block insulin action in adipocytes by altering expression of signaling and glucose transport proteins. Am. J. Physiol. 2007;292:E166–E174. doi: 10.1152/ajpendo.00284.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Shimazu R, Akashi S, Ogata H, Nagai Y, Fukudome K, Miyake K, Kimoto M. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 1999;189:1777–1782. doi: 10.1084/jem.189.11.1777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sundstrom C, Nilsson K. Establishment and characterization of a human histiocytic lymphoma cell line (U937) Int. J. Cancer. 1976;17:565–577. doi: 10.1002/ijc.2910170504. [DOI] [PubMed] [Google Scholar]
  • 25.Danciger JS, Lutz M, Hama S, Cruz D, Castrillo A, Lazaro J, Phillips R, Premack B, Berliner J. Method for large scale isolation, culture and cryopreservation of human monocytes suitable for chemotaxis, cellular adhesion assays, macrophage and dendritic cell differentiation. J. Immunol. Methods. 2004;288:123–134. doi: 10.1016/j.jim.2004.03.003. [DOI] [PubMed] [Google Scholar]
  • 26.Bui BV, Kalloniatis M, Vingrys AJ. Retinal function loss after monocarboxylate transport inhibition. Invest. Ophthalmol. Visual Sci. 2004;45:584–593. doi: 10.1167/iovs.03-0695. [DOI] [PubMed] [Google Scholar]
  • 27.Watt PW, MacLennan PA, Hundal HS, Kuret CM, Rennie MJ. L+-lactate transport in perfused rat skeletal muscle: kinetic characteristics and sensitivity to pH and transport inhibitors. Biochem. Biophys. Acta. 1988;944:213–222. doi: 10.1016/0005-2736(88)90434-8. [DOI] [PubMed] [Google Scholar]
  • 28.Colen CB, Seraji-Bozorgzad N, Marples B, Galloway MP, Sloan AE, Mathupala SP. Metabolic remodeling of malignant glyomas for enhanced sensitization during radiotherapy: an in vitro study. Neurosurgery. 2006;59:1313–1324. doi: 10.1227/01.NEU.0000249218.65332.BF. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wells CA, Salvage-Jones JA, Li X, Hitchens K, Butcher S, Murray RZ, Beckhouse AG, Lo Y, Manzanero S, Cobbold C, et al. The macrophage-inducible C-type lectin, Mincle, is an essential component of the innate immune response to Candida albicans. J. Immunol. 2008;180:7404–7413. doi: 10.4049/jimmunol.180.11.7404. [DOI] [PubMed] [Google Scholar]
  • 30.Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu. Rev. Immunol. 2003;21:335–376. doi: 10.1146/annurev.immunol.21.120601.141126. [DOI] [PubMed] [Google Scholar]
  • 31.Shoelson SE, Lee J, Yuan M. Inflammation and the IKKβ/IκB/NF-κB axis in obesity- and diet-induced insulin resistance. Int. J. Obes. Relat. Metab. Disord. 2003;27:S49–S52. doi: 10.1038/sj.ijo.0802501. [DOI] [PubMed] [Google Scholar]
  • 32.Ichiki T. Role of cAMP response element binding protein in cardiovascular remodeling: good, bad, or both? Arterioscler. Thromb. Vasc. Biol. 2006;26:449–455. doi: 10.1161/01.ATV.0000196747.79349.d1. [DOI] [PubMed] [Google Scholar]
  • 33.Halestrap AP, Price N. The proton-linked monocarboxylate transporter (MCT) family: structure, function and regulation. Biochem. J. 1999;343:281–299. [PMC free article] [PubMed] [Google Scholar]
  • 34.Hahn EL, Halestrap AP, Gamelli RL. Expression of the lactate transporter MCT1 in macrophages. Shock. 2000;13:253–260. doi: 10.1097/00024382-200004000-00001. [DOI] [PubMed] [Google Scholar]
  • 35.Droge W, Roth S, Altmann A, Mihm S. Regulation of T-cell functions by L-lactate. Cell. Immunol. 1987;108:405–416. doi: 10.1016/0008-8749(87)90223-1. [DOI] [PubMed] [Google Scholar]
  • 36.Roth S, Droge W. Regulation of interleukin 2 production, interleukin 2 mRNA expression and intracellular glutathione levels in ex vivo derived T lymphocytes by lactate. Eur. J. Immunol. 1991;21:1933–1937. doi: 10.1002/eji.1830210823. [DOI] [PubMed] [Google Scholar]
  • 37.Miyake K. Endotoxin recognition molecules, Toll-like receptor 4-MD-2. Semin. Immunol. 2004;16:11–16. doi: 10.1016/j.smim.2003.10.007. [DOI] [PubMed] [Google Scholar]
  • 38.Nagai Y, Akashi S, Nagafuku M, Ogata M, Iwakura Y, Akira S, Kitamura T, Kosugi A, Kimoto M, Miyake K. Essential role of MD-2 in LPS responsiveness and TLR4 distribution. Nat. Immunol. 2002;3:667–672. doi: 10.1038/ni809. [DOI] [PubMed] [Google Scholar]
  • 39.Yoshimura T, Yuhki N, Moore SK, Appella E, Lerman MI, Leonard EJ. Human monocyte chemoattractant protein-1 (MCP-1): full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett. 1989;244:487–493. doi: 10.1016/0014-5793(89)80590-3. [DOI] [PubMed] [Google Scholar]
  • 40.Luster AD, Unkeless JC, Ravetch JV. Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature. 1985;315:672–676. doi: 10.1038/315672a0. [DOI] [PubMed] [Google Scholar]
  • 41.Baggiolini M, Clark-Lewis I. Interleukin-8, a chemotactic and inflammatory cytokine. FEBS Lett. 1992;307:97–101. doi: 10.1016/0014-5793(92)80909-z. [DOI] [PubMed] [Google Scholar]
  • 42.Willians CS, Mann M, DuBois RN. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene. 1999;18:7908–7916. doi: 10.1038/sj.onc.1203286. [DOI] [PubMed] [Google Scholar]
  • 43.Gonzalez-Ortiz M, Martinez-Abundis E, Balcazar-Munoz BR, Robles-Cervantes JA. Inhibition of cyclooxygenase-1 or -2 on insulin sensitivity in healthy subjects. Horm. Metab. Res. 2001;33:250–253. doi: 10.1055/s-2001-14949. [DOI] [PubMed] [Google Scholar]
  • 44.Halestrap AP, Meredith D. The SLC16 gene family-from monocarboxylate transporters (MCTs) to aromatic amino acid transporters and beyond. Eur. J. Physiol. 2004;447:619–628. doi: 10.1007/s00424-003-1067-2. [DOI] [PubMed] [Google Scholar]
  • 45.Asehnoune K, Strassheim D, Mitra S, Kim JK, Abraham E. Involvement of reactive oxygen species in Toll-like receptor 4-dependent activation of NF-κB. J. Immunol. 2004;172:2522–2529. doi: 10.4049/jimmunol.172.4.2522. [DOI] [PubMed] [Google Scholar]
  • 46.Hsu H, Wen M. Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J. Biol. Chem. 2002;277:22131–22139. doi: 10.1074/jbc.M111883200. [DOI] [PubMed] [Google Scholar]
  • 47.Evans JL. Antioxidants: do they have a role in the treatment of insulin resistance? Indian J. Med. Res. 2007;125:355–372. [PubMed] [Google Scholar]
  • 48.Phip A, Macdonald AL, Watt PW. Lactate: a signal coordinating cell and systemic function. J. Exp. Biol. 2005;208:4561–4575. doi: 10.1242/jeb.01961. [DOI] [PubMed] [Google Scholar]
  • 49.Hashimoto T, Hussien R, Oommen S, Gohil K, Brooks GA. Lactate sensitive transcription factor network in L6 cells: activation of MCT1 and mitochondral biogenesis. FASEB J. 2007;21:2602–2612. doi: 10.1096/fj.07-8174com. [DOI] [PubMed] [Google Scholar]
  • 50.Tsai M, Shyue S, Weng C, Chung Y, Liou D, Huang C, Kuo H, Lee M, Chang P, Huang M, et al. Effect of enhanced prostacyclin synthesis by adenovirus-mediated transfer on lipopolysaccharide stimulation in neuron-glia cultures. Ann. NY Acad. Sci. 2005;1042:338–348. doi: 10.1196/annals.1338.031. [DOI] [PubMed] [Google Scholar]

RESOURCES