Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2009 Mar 16;29(11):3151–3162. doi: 10.1128/MCB.01792-08

Leptin Deficiency and Beta-Cell Dysfunction Underlie Type 2 Diabetes in Compound Akt Knockout Mice▿ †

William S Chen 1,‡, Xiao-Ding Peng 1, Yong Wang 2, Pei-Zhang Xu 1, Mei-Ling Chen 1, Yongmei Luo 1, Sang-Min Jeon 1, Kevin Coleman 3, Wanda M Haschek 4, Joseph Bass 5, Louis H Philipson 6, Nissim Hay 1,*
PMCID: PMC2681997  PMID: 19289493

Abstract

Phenotypic analyses of mice null for the individual Akt isoforms suggested that they are functionally distinct and that only Akt2 plays a role in diabetes. We show here that Akt isoforms play compensatory and complementary roles in glucose homeostasis and diabetes. Insulin resistance in Akt2−/− mice was inhibited by haplodeficiency of Pten, suggesting that other Akt isoforms can compensate for Akt2 function. Haplodeficiency of Akt1 in Akt2−/− mice, however, converts prediabetes to overt type 2 diabetes, which is also reversed by haplodeficiency of Pten. Akt3 does not appear to contribute significantly to diabetes. Overt type 2 diabetes in Akt1+/− Akt2−/− mice is manifested by hyperglycemia due to beta-cell dysfunction combined with impaired glucose homeostasis due to markedly decreased leptin levels. Restoring leptin levels was sufficient to restore normal blood glucose and insulin levels in Akt1+/− Akt2−/− and Akt2−/− mice, suggesting that leptin-deficiency is the predominant cause of diabetes in these mice. These results uncover a new mechanism linking Akt to diabetes, provide a therapeutic strategy, and show that diabetes induced as a consequence of cancer therapy, via Akt inhibition, could be reversed by leptin therapy.


Type 2 diabetes mellitus is a polygenic disease. However, loss of function of either insulin receptor, certain insulin receptor substrate (IRS) proteins, or their downstream effector, Akt is implicated in the genesis of diabetes (26), and the deficiency of IRS-2 or Akt2 alone is sufficient to elicit a diabetic phenotype in mice (7, 11, 19, 44).

The serine/threonine kinase Akt, also known as protein kinase B, has a conserved role in mediating the metabolic actions of insulin and IGF1 receptors (43). Akt is a downstream effector of insulin receptor substrate (IRS) proteins and is activated by phosphatidylinositol 3-kinase (PI3K; reviewed in reference 4) and therefore is inactivated by the phospholipid phosphatase PTEN (29). Humans and rodents express three Akt isoforms (Akt1-3) encoded by three separate genes. The three isoforms share a high degree of amino acid identity and appear to have similar substrate specificity in vitro (42). However, whereas Akt1 is the predominant isoform in many mammalian tissues, Akt2 is the most highly expressed isoform in insulin-responsive tissues, and Akt3 is the most highly expressed isoform in brain. Targeted deletion of individual Akt isoforms in the mouse leads to different phenotypes (6-9, 11, 41), which can be partially explained by their relative tissue expression but also suggests functional differences. Unlike mice null for Akt1 (6, 8) or Akt3 (9, 41), Akt2-null mice display a mild diabetic phenotype, manifested by high serum insulin levels and impaired glucose tolerance (7, 11). The severity of this phenotype is strain dependent; whereas Akt2-null 129/C57BL/6 hybrid or C57BL/6 mice display a relatively mild diabetic phenotype (7), the phenotype is more severe in the DBA/1lacJ background (11). However, the exact mechanism by which Akt2 exerts its effect is not clear.

The role of Akt deficiency in human type 2 diabetes is underscored by the discovery of a family with type 2 diabetes associated with an inherited loss of function Akt2 mutation that seems to act in a dominant-negative manner to inhibit other Akt isoforms (13). However, the contribution of other Akt isoforms to diabetes is not known. The mechanisms by which Akt isoforms exert their effect on glucose homeostasis in vivo are also not known. We analyzed here all alive Akt compound mutant mice and show that the different Akt isoforms play both compensatory and complementary roles in the genesis of type 2 diabetes. Haplodeficiency of Pten is sufficient to alleviate hyperinsulinemia and insulin resistance in Akt2−/− mice, indicating that the other Akt isoforms can compensate for Akt2. Mice deficient for both Akt1 and Akt2 cannot live to adulthood and therefore cannot be analyzed for diabetes (31). However, surprisingly, the haplodeficiency of Akt1 is sufficient to convert the mild insulin resistance in Akt2−/− mice to an overt type 2 diabetes, indicating a complementary role of Akt1 in the genesis of type 2 diabetes initiated by the deficiency of Akt2. Akt1 haplodeficiency induces hyperglycemia in Akt2-deificent mice in addition to a marked decrease in serum insulin levels. We found that despite islet size compensation, insulin content is markedly reduced in Akt1+/− Akt2−/− beta cells, as well as GLUT2 expression and translocation. Analyses of islets in vitro show that the impaired insulin secretion is mainly due to the reduced insulin content. However, insulin injection is not sufficient to alleviate the hyperglycemia, suggesting that glucose homeostasis is impaired independently of insulin levels. We had previously shown that Akt deficiency impairs adipogenesis both in vivo and in vitro (31). Consequently, Akt1+/− Akt2− and to some extent Akt2−/− mice display lipoatrophy and therefore reduced leptin levels. We found that restoring leptin levels is sufficient to restore normal glucose and insulin levels and therefore cure diabetes in these mice. Therefore, the predominant cause of type 2 diabetes in Akt1+/− Akt2−/− and Akt2−/− mice is the reduced leptin levels.

Akt is frequently activated in human cancers by multiple mechanisms (reviewed in references 4 and 15). Therefore, it is an attractive target for cancer therapy. However, one major concern is that inhibition of Akt activity could elicit severe diabetes. Our results demonstrate that diabetes as a result of cancer therapy, leading to the inhibition of Akt, could be alleviated by leptin therapy.

MATERIALS AND METHODS

Mice.

The generation of Akt1−/−, Akt2−/−, and Pten+/− mice was previously described (6, 11, 31). Akt3−/− mice were generated by targeted disruption of the Akt3 gene in 129sv embryonic stem cells as described in Fig. S1 in the supplemental material. Mice were backcrossed to a C57BL/6 background and intercrossed to generate the various genotypes.

Measurement of glucose, insulin, and leptin levels.

Glucose levels were determined by using an automatic glucometer (Precision Xtra; Abbott Laboratories). Insulin levels were measured by enzyme-linked immunosorbent assay (ELISA; Linco Research) according to the manufacturer's instructions. Leptin levels were determined by ELISA (Crystal Chem) according to the manufacturer's instructions.

GTT and ITT.

A glucose tolerance test (GTT) was carried out after 16 h of fasting and IP injection of glucose as described previously (6). An insulin tolerance test (ITT) was carried out with nonfasted mice and intraperitoneal injection (0.75 IU/kg of body weight) of human insulin (Eli Lilly). Glucose levels were determined at 0 min before the injection of insulin and at 15, 30, 60, and 120 min after insulin injection.

Body fat mass measurement.

Dual-energy X-ray absorptiometry (DEXA) was used to measure the fat and fat-free mass of the mice. Mice were fixed in 10% formalin for at least 48 h and scanned with pDEXA from Norland Corp. (Fort Atkinson, WI) using pDEXA Sabre software (Orthometrix, Inc., White Plains, NY).

Histopathology, immunostaining, and immunocytochemistry.

Pancreata were removed from mice and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) overnight. Fixed tissue was routinely processed for paraffin embedding, and 5-μm sections were prepared. Sections were subjected to either double immunofluorescence staining for insulin and glucagon or immunoperoxidase staining for GLUT-2. The sections were boiled in citrate buffer (pH 6.0) for antigen retrieval before incubation with blocking reagent. Rabbit anti-glucagon antibody (Zymed Laboratories) at a 1:50 dilution and mouse anti-insulin antibody (Zymed Laboratories) at a 1:50 dilution were the primary antibodies, and fluorescein isothiocyanate-labeled anti-mouse and rhodamine-labeled anti-rabbit antibodies were used as secondary antibodies. The sections were mounted with Vectashield mounting medium with DAPI (4′,6′-diamidino-2-phenylindole; Vector Laboratories), and the images were obtained by using an LSM510 META confocal microscope. For GLUT2 staining, anti-GLUT2 (Calbiochem) at a 1:800 dilution was used, and the immunoperoxidase method was performed using a Vectastain ABC kit (Vector Laboratories).

Immunoblotting.

Pancreatic tissues were ground and lysed in lysis buffer (20 mM HEPES, 1% TX-100, 150 mM NaCl, 1 mM EGTA, 1 mM EDTA) containing phosphatase inhibitors (10 mM sodium pyrophosphate, 20 mM β-glycerophosphate, 100 mM NaF, 5 mM IAA, 20 nM OA) and protease inhibitor cocktail (Roche Applied Science). Solubilized proteins were collected by centrifugation and quantified using protein assay reagent (Bio-Rad). Equal amounts of protein of each sample were resolved by electrophoresis in 8% gel and transferred to polyvinylidene difluoride membranes (Bio-Rad). Immunoblotting was performed using anti-p-p70S6K (T389), anti-p-FOXO1/3a (T24/T32), anti-p70S6K, anti-FOXO1 (Cell Signaling), anti-GLUT2 (Calbiochem), anti-β-actin (Sigma), anti-rabbit or anti-mouse immunoglobulin G-horseradish peroxidase (Zymed) antibodies.

Relative quantitation of mRNAs by real-time quantitative reverse transcription-PCR (RT-PCR).

Total RNA was isolated from pancreases of wild-type and Akt1+/− Akt2−/− mice using the Absolutely RNA miniprep kit (Stratagene) according to the manufacturer's instructions. The concentration and purity of the RNA samples were estimated by UV spectroscopy at 260 and 280 nm, and the integrity was confirmed by electrophoresis in 1% agarose gels stained with ethidium bromide. One microgram of total RNA was reverse transcribed to synthesize the first-strand cDNA by using random hexamer as previously described (31). Real-time PCR was performed on an iQ5 real-time PCR detection system (Bio-Rad) using iQ SYBR green Supermix (Bio-Rad) and according to the manufacturer's protocols. The reaction condition was as follows: 4 min of denaturation at 95°C, followed by 50 cycles of denaturation for 10 s at 95°C, and annealing and elongation for 15 s at 60°C. The primer sequences used in the present study were as follows: Ins1/2, GCAGAAGCGTGGCATTGT and CAGCTGGTAGAGGGAGCAGA; Glut2, TTGACTGGAGCCCTCTTGATG and CACTTCGTCCAGCAATGATGA; and β-actin (housekeeping gene), AGAGGGAAATCGTGCGTGAC and CAATAGTGATGACCTGGCCGT. PCR assays were performed in triplicate. Values obtained for levels of mRNAs were normalized to the levels of β-actin mRNA.

Isolation and culturing of islets.

Pancreatic islets were isolated and cultured as described previously (34). Six-month-old mice were used in all experiments. In brief, the pancreatic duct was injected with dissociation buffer containing 137 mM NaCl, 5.4 mM KCl, 4.2 mM NaH2PO4, 4.1 mM KH2PO4, 1 mM MgCl2, 10 mM HEPES, 2 mM glucose, and 0.375 mg of collagenase P (Roche)/ml. The distended pancreata were dissected and incubated in dissociation buffer at 37°C for 8 min to dissociate the pancreatic acinar tissue. Islets were separated from acinar, vascular, and connective tissues by centrifugation through discontinuous Ficoll (Sigma Chemical Co.) gradients (density of 1.108, 1.096, 1.069, and 1.037) at 1,800 rpm for 15 min at 4°C. The islets were collected from the top two layers of the Ficoll gradients, rinsed with RPMI 1640 medium (Gibco, Inc.), hand-picked using micropipettes, and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (HyClone, Inc.) and 11.2 mM glucose.

In vitro assay for insulin secretion and total granular insulin.

Islets were incubated in Krebs-Ringer buffer (KRB; 119 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 1.2 mM KH2PO4, 25 mM NaHCO3 [pH 7.4]) containing 2 mM glucose and 2% bovine serum albumin at 37°C for 1 h, and then three to five islets per tube were incubated in 600 to 1,000 μl of KRB with 12 or 20 mM glucose or 30 mM KCl as a control for another hour. The supernatant was collected to measure secreted insulin, and the islets were placed in acid ethanol for sonication to determine total insulin levels. Total insulin levels per islet was measured by ELISA normalized to the DNA content. The percentage of total insulin secreted was calculated as the amount of secreted insulin per islet divided by the total insulin per islet.

Intracellular Ca2+ measurement.

Intracellular Ca2+ level during glucose stimulation was measured for functional evaluation of isolated islets using standard wide-field fluorescence imaging with dual-wavelength excitation fluorescence microscopy. Islets were loaded with Fura-2 during a 25-min incubation at 37°C in KRB with 2 mM glucose containing 5 μM Fura-2/AM (Molecular Probes, Inc., Eugene, OR). The islets were then placed into a temperature-controlled perfusion chamber (Medical Systems, Inc., Paola, KS) mounted on an inverted epifluorescence microscope (TE-2000U; Nikon, Inc., Melville, NY) and perfused by a continuous flow (rate, 2.5 ml/min) of 5% CO2-bubbled KRB with 2 mM glucose at 37°C (pH 7.4). KRB containing 12 or 20 mM glucose or KRB containing 30 mM KCl was administered to the islets and monitored for 15 min each, rinsing with KRB containing 2 mM glucose in between steps for 10 min. Multiple islets were imaged with 10× to 20× objective lenses. Fura-2 dual-wavelength excitation was set at 340 and 380 nm, and detection of fluorescence emission was set at 510 nm. The reading was performed using Metafluor/Metamorph imaging acquisition and analysis software (Universal Imaging Corp.); images were collected with a high-speed, high-resolution charge-coupled device (Roper Cascade CCD). Estimation of the level of Ca2+ was accomplished by using an in vivo calibration method (34).

Measurement of food intake.

For measurement of food intake, mice were caged individually and treated with or without leptin, as described below. The amount of food in the feeding container was measured at day 0 and day 10 of treatment as previously described (45). Food intake was expressed as grams adjusted by body weight per day per mouse. Mice were weighed at days 0 and 10, and the changes in body weights were calculated.

Adenovirus-mediated gene transfer.

Adenovirus carrying rat leptin cDNA was kindly provided by Christopher Newgard (Duke University). Mice were injected with 2.5 × 107 PFU per g of body weight. Blood glucose levels were measured every 3 to 4 days for up to 2 weeks before injection or 10 days after injection. Insulin levels were measured prior to injection and 10 days after injection.

RESULTS

Compensatory and complementary roles of Akt isoforms in glucose homeostasis and diabetes.

To assess the role of the three Akt isoforms in diabetes, we determined the contribution of Akt1 and Akt3 to the diabetic phenotype observed in Akt2-deficient mice. For this purpose, we either increased the activity of Akt1 and Akt3 in Akt2−/− mice by breeding them with Pten+/− mice or decreased their activity by gene deletion in Akt2−/− mice.

To determine whether activation of other Akt isoforms could compensate for Akt2 deficiency by rescuing the insulin resistance observed in Akt2-null mice, we first intercrossed Akt2−/− mice with Pten+/− mice to generate Pten+/− Akt2−/− mice. These mice showed a significantly less severe phenotype than did Akt2−/− mice when subjected to a GTT (Fig. 1A). The high serum insulin levels found in Akt2−/− mice were also markedly reduced in Pten+/− Akt2−/− mice (Fig. 1B). These results suggest that the other Akt isoforms can compensate for the lack of Akt2 function. To better determine the contribution of Akt isoforms to diabetes, we generated compound mutants of the three Akt isoforms. Akt1−/− and Akt2−/− mice were described previously (6, 11, 31). The generation of Akt3−/− mice is described in the supplemental material and in Fig. S1 in the supplemental material. We found that haplodeficiency of Akt2 in Akt1-null mice did not elicit a diabetic phenotype, as Akt1−/− Akt2+/− mice had normal blood glucose and insulin levels (Fig. 1C and data not shown). Akt2−/− Akt3−/− mice had a diabetic phenotype similar to that of Akt2−/− mice, implying that Akt3 deficiency does not significantly enhance the diabetic phenotype of Akt2−/− mice (Fig. 1C and data not shown). However, Akt1+/− Akt2−/− mice displayed severe diabetes and hyperglycemia, with about two- to threefold-higher levels of blood glucose in fed or fasted mice (Fig. 1C and D), and the response to GTT was clearly in the diabetic range (Fig. 1D). The high blood glucose levels in Akt1+/− Akt2−/− mice were observed as early as 1 month after birth (Fig. 2). Thus, haplodeficiency of Akt1 is sufficient to convert insulin resistance of Akt2−/− mice to overt type 2 diabetes. Akt1+/− Akt2−/− Akt3−/− mice also displayed hyperglycemia (Fig. 1C). Although the serum insulin level, under fed conditions, in Akt1+/− Akt2−/− mice was somewhat elevated compared to wild-type mice, it was not as elevated as in Akt2−/− mice and was reduced almost threefold compared to Akt2−/− mice (Fig. 1E). Surprisingly, after glucose injection, serum insulin levels were not substantially increased in Akt1+/− Akt2−/− mice (Fig. 1F). Finally, when subjected to an ITT, Akt1+/− Akt2−/− mice still maintained high blood glucose levels (Fig. 1G). Interestingly, Pten haplodeficiency rescued the phenotype observed in Akt1+/− Akt2−/− mice, since Akt1+/− Akt2−/− Pten+/− mice did not exhibit hyperglycemia (Fig. 1C and G), had an improved response to glucose injection (Fig. 1D and F), and had high serum insulin levels under fed conditions similar to that of Akt2−/− mice (Fig. 1E). Thus, haplodeficiency of Pten was sufficient to reverse the type 2 diabetes in Akt1+/− Akt2−/− mice to a prediabetic, insulin resistant state observed in Akt2−/− mice. The reduced serum insulin levels in Akt1+/− Akt2−/− mice and their inability to increase insulin levels upon glucose injection compared to Akt2−/− mice (Fig. 1E and F) suggested a beta-cell dysfunction in Akt1+/− Akt2−/− mice. However, the inability of the insulin dose to lower the blood glucose in Akt1+/− Akt2−/− (Fig. 1G) suggested that, in addition to beta-cell dysfunction, these mice are impaired in glucose homeostasis by a different mechanism.

FIG. 1.

FIG. 1.

Analyses of serum glucose and insulin levels. (A) Six-month-old male mice (wild type, n = 4; Akt2−/− [A2−/−], n = 6; Akt2−/− Pten+/− [A2−/− P+/−]; n = 6) were subjected to GTT after 12 h of fasting. Values are means ± the standard error (SE). P < 0.05 for Akt2−/− versus wild type or Akt2−/− Pten+/− (Student t test). (B) Serum insulin levels of wild type, Akt2−/−, and Akt2−/− Pten+/− fed 6-month-old male mice (n = 6). Bars represent means ± the SE. *, P < 0.01 versus wild type; **, P < 0.01 versus Akt2−/− (Student t test). (C) Blood glucose levels of wild type, Akt2−/−, Akt1−/− Akt2+/−, Akt1+/− Akt2−/−, Akt1+/− Akt2−/− Pten+/−, Akt2−/− Akt3−/−, and Akt1+/− Akt2−/− Akt3−/− fed 6-month-old male mice (at least four mice of each genotype were analyzed, except for Akt1+/− Akt2−/− Akt3−/−, where only three mice were used). Bars represent means ± the SE. *, P < 0.05 versus wild type (Student t test). (D) GTT for Akt1+/− Akt2−/− and Akt1+/− Akt2−/− Pten+/− 6-month-old male mice (n = 4). Values are means ± the SE. P < 0.01 for all time points (Student t test). (E) Serum insulin levels of wild type (n = 7), Akt2−/− (n = 9), Akt1+/− Akt2−/− (n = 6), and Akt1+/− Akt2−/− Pten+/− (n = 4) fed 6-month-old male mice. Bars represent means ± the SE. *, P < 0.01; **, P < 0.05 versus wild type (Student t test). (F) Increase of serum insulin levels during GTT in 6-month-old wild type, Akt2−/−, Akt1+/− Akt2−/−, and Akt1+/− Akt2−/− Pten+/− male mice. The increase was calculated from the mean serum insulin levels of three mice of each genotype at 15 and 30 min after glucose injection, where the insulin level for each genotype at 0 min was set at 1.00. (G) Six-month-old wild type, Akt2−/−, Akt1+/− Akt2−/−, and Akt1+/− Akt2−/− Pten+/− male mice (n = 4) were subjected to ITT. Values are means ± the SE. WT, wild type.

FIG. 2.

FIG. 2.

High blood glucose levels in Akt1+/− Akt2−/ mice. Blood glucose levels in 1-month-old (n = 4), 2-month-old (n = 16), 3-month-old (n = 27), and 4- to 7-month-old (Akt1+/− Akt2−/−, n = 39; wild type, n = 7) mice. WT, wild type.

Histopathological analyses of pancreatic islets.

To further analyze the phenotype of Akt1+/− Akt2−/− mice, we first examined islets derived from these mice. Histopathologic examination showed that anti-insulin immunostaining intensity in beta cells of pancreatic islets derived from Akt1+/− Akt2−/− mice was substantially reduced compared to islets derived from wild-type or Akt2−/− mice (Fig. 3A). Many individual Akt1+/− Akt2−/− beta cells had very low or undetectable insulin. In contrast, Akt1+/− Akt2−/− Pten+/− islets displayed anti-insulin immunostaining intensity that was similar to wild type, which is consistent with the ability to maintain high serum insulin levels observed in these mice (Fig. 1E). The reduced insulin content in the islets of Akt1+/− Akt2−/− mice was further confirmed quantitatively by ELISAs (see Fig. 5C). These results suggested that the expression of insulin in beta cells of Akt1+/− Akt2−/− islets was markedly reduced. Immunostaining with anti-GLUT2 clearly showed intense staining at the plasma membrane of wild-type and Akt2−/− beta cells, whereas in Akt1+/− Akt2−/− beta cells the overall anti-GLUT2 staining was markedly reduced, particularly at the plasma membrane (Fig. 3B). The reduced GLUT2 levels was also confirmed by immunoblotting (see Fig. 6C). GLUT2 plasma membrane staining was restored in Akt1+/− Akt2−/− Pten+/− beta cells. This is consistent with the role of Akt in the regulation of glucose transporter expression and translocation to the plasma membrane (reviewed in reference 18). Collectively, these results established a role for Akt in insulin and GLUT2 biosynthesis and GLUT2 translocation. The restoration of insulin and GLUT2 biosynthesis and GLUT2 translocation in Akt1+/− Akt2−/− Pten+/− beta cells demonstrates that the Akt isoforms can compensate for each other.

FIG. 3.

FIG. 3.

Histopathologic analysis of islets. (A) Paraffin sections of pancreata derived from 6-month-old wild-type, Akt2−/−, Akt1+/− Akt2−/−, and Akt1+/− Akt2−/− Pten+/− male mice were coimmunostained with anti-insulin (green) and anti-glucagon (red) and stained with DAPI (blue) as described in Materials and Methods. Representative islets are shown. Bar, 50 μm. (B) Immunocytochemistry with anti-GLUT2 of pancreas sections as in panel A. Representative islets are shown. Magnifications: ×400 (insets, ×800). (C) Islet size distribution. Confocal transmitted black and white images were obtained from hematoxylin-and-eosin-stained sections. Clusters of more than 10 cells were considered to be islets; size was measured with a Zeiss image browser software. The number and size of islets were measured from 6-month-old male mice pancreata (n = 4 for each genotype). WT, wild type.

FIG. 5.

FIG. 5.

Ex vivo analyses of isolated islets. (A) Measurement of intracellular Ca2+ flux of isolated islets during glucose stimulation. A standard wide-field epifluorescence imaging system as described in Materials and Methods was used to determine the intracellular Ca2+ flux of normal size islets (∼75 μm diameter) isolated from 6-month-old wild-type, Akt2−/− or Akt1+/− Akt2−/− mice. Each line represents the average intracellular Ca2+ levels in a group of five islets of each genotype, isolated from at least three different mice of each genotype. Islets were maintained in 2 mM glucose, stimulated with 12 mM glucose for 15 min, followed by a 10-min wash with 2 mM glucose, and stimulated again with 20 mM glucose, followed by another 10-min wash with 2 mM glucose. Stimulation with 30 mM KCl served as the control. (B) Insulin secretion per isolated islet after glucose stimulation. Islets isolated from 6-month-old mice of each genotype were subjected to in vitro glucose stimulation using 12 or 20 mM glucose on five islets for each genotype isolated from at least three mice of each genotype. Supernatants from islets incubated at 37°C for 1 h after stimulation were collected to determine amount of insulin secreted per islet. Small islets are ∼75 μm in diameter. Large islets of ∼400 μm in diameter are present only in Akt2−/− and Akt1+/− Akt2−/− mice. Bars represent means ± the SE. (C) The islets used in panel B were sonicated to extract insulin as described in Materials and Methods. Supernatants were diluted before measuring insulin levels. Bars represent means ± the SE. (D) Percentage of total insulin secreted per islet. Percentage of insulin secreted per islet was calculated from panels B and C. Bars represent means ± the SE. *, P < 0.05; #, P > 0.05 (Student t test). WT, wild type.

FIG. 6.

FIG. 6.

Expression of Ins1/2 and Glut2 in Akt1+/− Akt2−/− and wild-type mice. Samples from three Akt1+/− Akt2−/− mice and five wild-type mice were tested. (A) Relative expression levels of Ins1/2 to β-actin in pancreas. mRNA expression was quantified by real-time RT-PCR. The error bars stand for the SEs of the sample means. The P value was determined from a t test. (B) Relative expression levels of Glut2 to β-actin in pancreas. mRNA expression was quantified by real-time RT-PCR. P value was from t test. (C) Protein samples were extracted from pancreatic tissues of three different mice in each group. The same amount of proteins from each mouse in the same group were combined and subjected to Western blotting in one lane. After probing with each indicated phospho-specific antibody, the membrane was deprobed and then probed with each total antibody and actin antibody as a loading control. WT, wild type.

Analysis of islet size distribution revealed increased islet size in adult Akt2−/− mice, as expected from an islet size compensation mediated by insulin resistance (Fig. 3C). When compared to Akt2−/− islets, the average size of islets derived from Akt1+/− Akt2−/− or Akt1+/− Akt2−/− Pten+/− mice was slightly increased as the percentage of islets smaller than 104 μm2 was higher in Akt2−/− mice (Fig. 3C). The decrease in insulin content and GLUT2 levels and translocation was observed even in 4-week-old mice (Fig. 4A and B), when islet size compensation has not yet fully developed (Fig. 4C). Thus, the reduced insulin content and GLUT2 expression/translocation are early events.

FIG. 4.

FIG. 4.

Histopathologic analysis of islets of 4-week-old mice. (A) Paraffin sections of pancreata derived from 1-month-old wild-type, Akt2−/−, Akt1+/− Akt2−/−, and Akt1+/− Akt2−/− Pten+/− male mice were coimmunostained with anti-insulin (green) and anti-glucagon (red) and stained with DAPI (blue) as described in Materials and Methods. Representative islets are shown. Bar, 50 μm. (B) Immunocytochemistry (anti-GLUT2) of pancreas sections representative islets are shown. (C) Islet size distribution. Transmitted black and white images were obtained from hematoxylin-and-eosin-stained sections by using an LSM510 confocal microscope. Clusters of more than 10 cells were considered as islets, and the size was measured with a Zeiss image browser software. The islets were counted, and the sizes of the islets were measured from pancreata of a total of four 1-month-old male mice for each genotype. WT, wild type.

Taken together these results show that Akt1+/− Akt2−/− pancreata have the capacity to respond to high blood glucose levels by increasing islet mass, but individual Akt1+/− Akt2−/− beta cells are impaired in their ability to express insulin and GLUT2 and to translocate GLUT2 to the plasma membrane.

Analyses of pancreatic islets ex-vivo revealed that impaired insulin secretion in Akt1+/− Akt2−/− islets is correlated with a reduced insulin content.

To determine how the reduced GLUT2 and insulin levels in Akt1+/− Akt2−/− beta cells affect islet physiology, we isolated pancreatic islets and analyzed them ex vivo. Glucose sensing and insulin secretion were quantified following addition of 12 or 20 mM glucose to pancreatic islets of equal size isolated from wild-type, Akt2−/−, and Akt1+/− Akt2−/− mice. We determined glucose sensing by measuring Ca2+ flux of the same size islets for the different genotypes (Fig. 5A). Despite the downregulation of GLUT2 expression and its translocation, it appeared that sensing and response to glucose, as measured by Ca2+ flux, were intact in Akt1+/− Akt2−/− islets, since no significant differences in Ca2+ oscillations were detected (Fig. 5A). We then measured insulin secretion in vitro using islets selected based on their size, where “small” islets were present in wild-type, Akt2−/−, and Akt1+/− Akt2−/− pancreata and “large” islets were only present in Akt2−/− and Akt1+/− Akt2−/− pancreata. Although insulin secretion was markedly impaired in Akt1+/− Akt2−/− islets compared to wild-type or Akt2−/− islets (Fig. 5B), total insulin levels in Akt1+/− Akt2−/− islets were also markedly and proportionally decreased (Fig. 5C), such that the percentage of insulin secreted by Akt1+/− Akt2−/− islets was not significantly different than that observed in Akt2−/− islets (Fig. 5D). We therefore concluded that the reduced serum insulin levels in Akt1+/− Akt2−/− versus Akt2−/− mice could be due to the impaired ability of Akt1+/− Akt2−/− beta cells to produce and secrete sufficient amounts of insulin. However, we cannot completely exclude the possibility that, in vivo, reduced GLUT2 expression and its impaired translocation to the plasma membrane may also play a role by reducing glucose uptake in beta cells. The slightly higher serum insulin levels in Akt1+/− Akt2−/− mice versus wild-type mice was likely due to the larger islet size in Akt1+/− Akt2−/− mice. Transgenic mice expressing dominant-negative Akt in beta cells also had impaired insulin secretion, although reduced insulin content and GLUT2 levels or translocation were not reported (3).

To determine the mechanism by which Akt regulates the expression of insulin and GLUT2, we first examine their mRNAs levels. The mRNA levels of insulin and GLUT2 were not statistically different between wild-type and Akt1+/− Akt2−/− pancreata (Fig. 6A and B). However, protein levels were reduced, suggesting that mRNA translation of Ins1/2 and Glut2 is impaired in Akt1+/− Akt2−/− mice (Fig. 6C). This is consistent with a positive feedback through the insulin receptor on the membrane of beta cells and involves IRS-1 and IRS-2, as well as mTORC1 activity (22, 23). Because Akt is a critical mediator between the insulin receptor, IRS, and mTORC1, it is conceivable that Akt activity is required for the positive feedback to stimulate insulin synthesis. Indeed, we found that mTORC1 activity as measured by S6K1 phosphorylation is markedly reduced in Akt1+/− Akt2−/− pancreata (Fig. 6C).

Leptin deficiency is the predominant cause of overt diabetes in Akt1+/− Akt2−/− mice.

Because injection of insulin in the ITT was not sufficient to substantially reduce glucose levels in Akt1+/− Akt2−/− mice (Fig. 1G), a reduced serum insulin level in these mice by itself cannot explain the high blood glucose levels. Accordingly, serum leptin levels of Akt1+/− Akt2−/− mice were markedly reduced compared to wild-type or Akt2−/− mice (Fig. 7A). These reduced leptin levels were likely due to lipoatrophy (Fig. 7B and C). Consistently, we have previously observed that adipocyte differentiation is almost completely impaired in Akt1−/− Akt2−/− mice (31), and this defect is much more pronounced in Akt1+/− Akt2−/− mice than in Akt1−/− Akt2+/− mice (data not shown). The reduced fed-state serum leptin levels in Akt1+/− Akt2−/− mice raises the possibility that, as was shown for other lipoatrophic mice (12, 21, 37), the high blood glucose levels in these mice are due to the inability to maintain glucose homeostasis in the liver and skeletal muscles, which is normally mediated by leptin. Infusion of leptin (12, 37) or expression of leptin in the liver using adenovirus injection (21) reversed the diabetic phenotype. Therefore, to address this possibility, adenovirus expressing leptin was injected into mice as previously described (21). Leptin expression did not significantly affect blood glucose and insulin levels in wild-type mice (Fig. 7D and G). However, it reduced glucose and insulin in Akt1+/− Akt2−/− mice to normal levels (Fig. 7D and E). Injection of a control adenovirus did not alter either glucose or insulin levels (data not shown). Thus, these results strongly suggest that the predominant cause of diabetes in Akt1+/− Akt2−/− mice is leptin deficiency. Notably, serum leptin levels were also reduced in Akt2−/− mice, albeit not to the same extent as in Akt1+/− Akt2−/− mice (Fig. 7A). Indeed, we found that injection of adenovirus expressing leptin into Akt2−/− mice reduced the high levels of insulin in these mice to normal levels (Fig. 7F). The expression of leptin mediated by the adenovirus injection was not sufficient to significantly alter food intake and body weight (Fig. 8), and therefore the effect of leptin could not be attributed to changes in food intake. Previous studies attributed the insulin resistance in Akt2−/− mice to impaired glucose homeostasis in skeletal muscles and liver (7). However, the exact mechanism by which the impaired glucose homeostasis is exerted is unknown. We propose that the decreased leptin level in Akt2−/− mice is a major contributing factor to the impaired glucose homeostasis in Akt2−/− mice.

FIG. 7.

FIG. 7.

Restoring serum leptin levels restores normal glucose and insulin levels in Akt1+/− Akt2−/− and Akt2−/− mice. (A) Serum leptin levels in 6-month-old male mice (n = 6). (B) Percentage of fat as measured by DEXA in 6-month-old male mice (n = 6). (C) Reduced white adipose tissue (WAT) mass in Akt1+/− Akt2−/− mice. WAT fat pads (epididymal and suprapubic) were isolated from 5-month-old male mice (n = 4), and their weights as percentage of total body weight were calculated. The left panels show representative photographs of epididymal and suprapubic fat pads isolated from wild-type and Akt1+/− Akt2−/− mice. In the right panel, a bar graph shows the percentage of WAT in wild-type and Akt1+/− Akt2−/− mice. P values were from a Student t test, and the bars represent the SEs of the means. (D) Reversal of hyperglycemia by leptin in Akt1+/− Akt2−/− mice. Five-month-old Akt1+/− Akt2−/− (n = 9) or wild-type (n = 4) male mice were monitored for glucose levels every 3 to 4 days for 2 weeks prior to injection of Ad-leptin at 2.5 × 107 PFU per g of body weight (before) or 10 days after infection (after). Bars represent means ± the SEs. (E) Insulin levels were measured prior to Ad-leptin injection (before) or 10 days after (after). Bars represent means ± the SEs. *, P < 0.05; **, P > 0.05 (Student t test). (F) Reversal of hyperinsulinemia by leptin in Akt2−/− mice. Insulin levels were measured in 5-month-old Akt2−/− (n = 6) or wild-type (n = 6) male mice prior to Ad-leptin injection (before) or 10 days after infection (after). Bars represent means ± the SEs. (G) Glucose levels were measured prior to Ad-leptin injection (before) or 10 days after infection (after). Bars represent means ± the SEs. WT, wild type.

FIG. 8.

FIG. 8.

(A) Food intake in the absence or presence of leptin. Adenovirus expressing leptin was injected intravenously via tail vein at a dose of 2.5 × 107 PFU per g of body weight. Four 5-month-old male mice per genotype group were tested. Food intake was measured at day 0 and day 10 in the absence of leptin or during the leptin treatment. P values were calculated using the Student t test, and the bars stand for SEs of the means. (B) Changes in body weights (BW) in the absence or presence of leptin. Body weights were measured at day 0 and day 10 in the absence of leptin or during the leptin treatment as in panel A. P values were calculated using a Student t test, and the bars represent the SEs of the means. WT, wild type.

DISCUSSION

Our studies demonstrate compensatory and complementary roles of Akt isoforms in type 2 diabetes mellitus. Whereas Akt2 deficiency dictates a diabetic phenotype, Akt1 and possibly Akt3, when activated by haplodeficiency of Pten, can compensate for the loss of Akt2. These results are consistent with previous work showing that haplodeficiency of Pten in IRS2-null mice elevates Akt activity and improves beta-cell function and glucose homeostasis (20). In principle, the haplodeficiency of Pten could overcome the diabetic phenotype in Akt2−/− or Akt1+/− Akt2−/− mice not necessarily by the activation of Akt isoforms but also on other AGC kinases that are downstream effectors of PI3K. The activity of these kinases is dependent on the activity of PDK1. However, PDK1 is much less sensitive to changes in the cellular content of PIP3 than Akt as the affinity of PDK1, PH domain to PIP3 is about 1 order magnitude higher than the affinity of Akt PH domain to PIP3 (1). Therefore, it is unlikely that decreasing Pten activity by 50% could have major impact on PDK activity. Furthermore, it has been recently reported that knockin mice expressing mutant PDK1 mutated in the PH domain display insulin resistance. This insulin resistance was attributed exclusively to the reduction in Akt activity, since other AGC kinases are not affected by the reduced ability of PDK1 to bind PIP3 (2).

Akt1 haplodeficiency in Akt2-deficient mice was sufficient to induce overt type 2 diabetes by reducing serum leptin levels and impairing beta-cell function. However, leptin deficiency appears to be the predominant cause of hyperglycemia and type 2 diabetes in Akt1+/− Akt2−/− mice, since restoring serum leptin levels was sufficient to restore normal blood glucose levels despite beta-cell dysfunction. Akt3 deficiency does not appear to contribute significantly to the diabetic phenotypes induced by Akt2 deficiency or by Akt2 deficiency combined with Akt1 haplodeficiency. However, we cannot completely exclude the possibility that Akt3 deficiency, as a consequence of its effect on the brain, also affects glucose homeostasis under certain physiological conditions.

The phenotype of Akt1+/− Akt2−/− mice recapitulates the finding of a family with severe type 2 diabetes mellitus combined with lipodystrophy, where a mutation in Akt2 converts it to a dominant-negative mutant that may potentially inhibit other Akt isoforms (13). Indeed, the expression of this mutant is sufficient to inhibit adipocyte differentiation in vitro (13). Our results suggest that the observed diabetes in these patients is mainly due to lipodystrophy and that leptin therapy could be effective. Previous results suggested that Akt2−/− mice exhibit peripheral insulin resistance in skeletal muscles and liver in a cell autonomous manner due the reduced downstream effect of insulin in these tissues (7). Our results suggest that the primary cause of insulin resistance is likely leptin deficiency since expression of leptin in Akt2−/− mice was sufficient to restore normal blood insulin levels in these mice. Leptin can reduce blood glucose levels by reducing food intake, but we have not observed any substantial reduction in food intake or weight loss after leptin administration during the time that we observed restoration of normal blood glucose and insulin levels. Alternatively, leptin increases insulin sensitivity and glucose homeostasis independently of food intake. Indeed, administration of leptin into ob/ob mice could reverse hyperglycemia and hyperinsulinemia prior to weight loss (10, 14, 30). Leptin was shown to affect glucose metabolism by increasing whole-body glucose uptake (5, 17, 40). It was also shown that under hyperinsulinemic conditions leptin decreases hepatic glucose production, which is due mainly to a decrease in glycogenlysis and an increase in glycogen production (27, 35). These effects of leptin on glucose metabolism and hepatic glucose production are independent of the effect on food intake and appear to be mediated by both the effect of leptin on the central nervous system and directly on the liver. Leptin was also reported to decrease hepatic gluconeogenesis by either reducing the level of glucose-6-phosphatase (40) or the activity of phosphoenolpyruvate carboxykinase (5, 32).

Finding the exact mechanism(s) by which leptin exerts its effect is beyond the scope of these studies. However, there are two possibilities that should be considered. First, leptin, via its cognate receptor in the liver, could activate Stat3, which was shown to suppresses gluconeogenic gene expression in the liver in a PI3K/Akt-independent mechanism (16). Second, leptin could exert its effect by decreasing the level of glucagon. It has been shown recently that leptin can reverse type 1 diabetes in streptozotocin-treated mice and rats (46). Leptin was shown to reduce the increase in plasma glucagon levels observed in these rodent models and, therefore, reduces the expression of gluconeogenic genes. Since glucagon increases the phosphorylation of the transcription factor CREB, it was suggested that, by increasing CREB activity in the liver, glucagon increases the expression of gluconeogenic genes in the liver (46).

We suggest that the decrease in insulin levels in Akt1+/− Akt2−/− and Akt2−/− mice is in response to a reduced glucose level and improved glucose tolerance (Fig. 7D to G). It should be noted, however, that it was reported that leptin could directly affect beta-cell function by decreasing insulin expression and secretion (reviewed in reference 36). It is unlikely a major factor reducing insulin level in our systems, because although in wild-type mice leptin administration slightly reduced insulin level, this is not statistically significant compared to the dramatic decrease of insulin levels observed in Akt-deficient mice (Fig. 7D to G). Moreover, as it has been recently shown leptin reduces glucose level in rodents even when beta cells were destroyed by streptozotocin (46).

Akt can affect hepatic glucose production by inhibiting FoxO transcription factors, since it was shown that FoxO1 elevates the expression of gluconeogenic enzymes in the liver (33). Recently, it was shown that Akt can also phosphorylate and inactivate PGC1α (24), which is a coactivator for transcription factors that affect gluconeogenesis, such as FOXO1, HNF4α, and PPARα (25). However, it is not clear whether the cell autonomous effect of Akt on hepatic gluconeogenesis is sufficient to explain the hyperglycemia in Akt1+/− Akt2−/− mice or this is due to both the cell autonomous effect of Akt deficiency on gluconeogenesis in conjunction with the effect of leptin deficiency, on glucose metabolism, glycogenlysis, and gluconeogenesis in the liver within a whole-animal context. Our results clearly suggest that leptin deficiency is the predominant cause of hyperglycemia within a whole animal context. Notably, reduced Akt activity in the liver could also have an impact on serum leptin levels, since it was shown that a transient knockdown of IRS1 and IRS2 in the liver reduced serum leptin levels by an indirect effect on adipose tissues within a whole-animal context (39). Interestingly, the deletion of both p85α and p85β in the liver, which diminished Akt1 and Akt2 activity only in the liver, induces an elevation of serum leptin levels (38). In these cases, Akt activity was reduced only in the liver and therefore the function of adipose tissues remains intact, enabling the production of higher levels of leptin. Perhaps this was evolved as a compensation mechanism to reduce blood glucose levels by leptin independently of insulin. In support of this possibility, it has been recently shown that leptin could compensate for insulin in rodent models of type 1 diabetes (46).

In addition to leptin deficiency, we observed beta-cell dysfunction manifested by impaired insulin synthesis, as well as GLUT2 synthesis and membrane translocation. The analyses of islets ex vivo revealed that glucose sensing is not impaired despite the reduction in GLUT2 expression and membrane translocation. Ex vivo insulin secretion was reduced in Akt1+/− Akt2−/− islets, but it was proportional to the reduced insulin content. Therefore, we concluded that insulin secretion per se may not be impaired and that the effect on insulin secretion could be due to the reduced insulin content. Nevertheless, we cannot completely rule out that in vivo glucose sensing is also reduced due to the impaired GLUT2 expression and translocation.

The reason for the reduced insulin content in Akt1+/− Akt2−/− beta cells is not clear. It is possible that this is mediated by the lack of a positive feedback through the insulin receptor on the membrane of beta cells and involves IRS-1 and IRS-2 as well as mTORC1 activity (22, 23). Because Akt is a critical mediator between the insulin receptor, IRS, and mTORC1, it is conceivable that Akt activity is required for the positive feedback to stimulate insulin synthesis. Thus, in Akt1+/− Akt2−/− beta cells Akt activity may be reduced to a threshold level that impairs the ability of insulin to stimulate its own synthesis. Consistently we found that insulin mRNA levels are not impaired but mTORC1 activity is impaired in Akt1+/− Akt2−/− islets (Fig. 6). Alternatively or additionally the ability of glucagonlike peptide 1 to induce insulin biosynthesis could be impaired in Akt1+/− Akt2−/− beta cells (28). Finally, because we observed the reduction in insulin and GLUT2 contents and GLUT2 translocation even in 4-week-old mice, it is possible that this is due to impaired beta-cell differentiation.

Our results have important therapeutic implications for patients with lipodystrophy-induced diabetes. Moreover, direct inhibition of Akt has been considered for cancer therapy, and several current chemotherapeutic strategies indirectly inhibit Akt activity and thus can lead to diabetes. Our results strongly suggest that if diabetes and hyperglycemia are side effects of Akt ablation therapy, it may be reversed by leptin therapy.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank Giamila Fantuzzi (Department of Human Nutrition, University of Illinois, Chicago) for the help with the DEXA analysis.

This study was supported by NIH grants R01AG16927, R01AG25953, and R01CA90764 (N.H.); by the Chicago Biomedical Consortium with support from The Searle Funds at The Chicago Community (N.H. and J.B.); and in part by ACS grant Illinois Division 06-40 (W.S.C.), by grant R01DK48494 (L.H.P.), and by grant P60DK20595 to the Diabetes Research and Training Center, University of Chicago.

Footnotes

▿

Published ahead of print on 16 March 2009.

†

Supplemental material for this article may be found at http://mcb.asm.org/.

REFERENCES

  • 1.Alessi, D. R., S. R. James, C. P. Downes, A. B. Holmes, P. R. Gaffney, C. B. Reese, and P. Cohen. 1997. Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Bα. Curr. Biol. 7261-269. [DOI] [PubMed] [Google Scholar]
  • 2.Bayascas, J. R., S. Wullschleger, K. Sakamoto, J. M. Garcia-Martinez, C. Clacher, D. Komander, D. M. van Aalten, K. M. Boini, F. Lang, C. Lipina, L. Logie, C. Sutherland, J. A. Chudek, J. A. van Diepen, P. J. Voshol, J. M. Lucocq, and D. R. Alessi. 2008. Mutation of the PDK1 PH domain inhibits protein kinase B/Akt, leading to small size and insulin resistance. Mol. Cell. Biol. 283258-3272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bernal-Mizrachi, E., S. Fatrai, J. D. Johnson, M. Ohsugi, K. Otani, Z. Han, K. S. Polonsky, and M. A. Permutt. 2004. Defective insulin secretion and increased susceptibility to experimental diabetes are induced by reduced Akt activity in pancreatic islet beta cells. J. Clin. Investig. 114928-936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bhaskar, P. T., and N. Hay. 2007. The two TORCs and Akt. Dev. Cell 12487-502. [DOI] [PubMed] [Google Scholar]
  • 5.Burcelin, R., S. Kamohara, J. Li, G. S. Tannenbaum, M. J. Charron, and J. M. Friedman. 1999. Acute intravenous leptin infusion increases glucose turnover but not skeletal muscle glucose uptake in ob/ob mice. Diabetes 481264-1269. [DOI] [PubMed] [Google Scholar]
  • 6.Chen, W. S., P. Z. Xu, K. Gottlob, M. L. Chen, K. Sokol, T. Shiyanova, I. Roninson, W. Weng, R. Suzuki, K. Tobe, T. Kadowaki, and N. Hay. 2001. Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev. 152203-2208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cho, H., J. Mu, J. K. Kim, J. L. Thorvaldsen, Q. Chu, E. B. Crenshaw III, K. H. Kaestner, M. S. Bartolomei, G. I. Shulman, and M. J. Birnbaum. 2001. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKBβ). Science 2921728-1731. [DOI] [PubMed] [Google Scholar]
  • 8.Cho, H., J. L. Thorvaldsen, Q. Chu, F. Feng, and M. J. Birnbaum. 2001. Akt1/PKBα is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J. Biol. Chem. 27638349-38352. [DOI] [PubMed] [Google Scholar]
  • 9.Easton, R. M., H. Cho, K. Roovers, D. W. Shineman, M. Mizrahi, M. S. Forman, V. M. Lee, M. Szabolcs, R. de Jong, T. Oltersdorf, T. Ludwig, A. Efstratiadis, and M. J. Birnbaum. 2005. Role for Akt3/protein kinase Bγ in attainment of normal brain size. Mol. Cell. Biol. 251869-1878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Friedman, J. M., and J. L. Halaas. 1998. Leptin and the regulation of body weight in mammals. Nature 395763-770. [DOI] [PubMed] [Google Scholar]
  • 11.Garofalo, R. S., S. J. Orena, K. Rafidi, A. J. Torchia, J. L. Stock, A. L. Hildebrandt, T. Coskran, S. C. Black, D. J. Brees, J. R. Wicks, J. D. McNeish, and K. G. Coleman. 2003. Severe diabetes, age-dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKBβ. J. Clin. Investig. 112197-208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gavrilova, O., B. Marcus-Samuels, D. Graham, J. K. Kim, G. I. Shulman, A. L. Castle, C. Vinson, M. Eckhaus, and M. L. Reitman. 2000. Surgical implantation of adipose tissue reverses diabetes in lipoatrophic mice. J. Clin. Investig. 105271-278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.George, S., J. J. Rochford, C. Wolfrum, S. L. Gray, S. Schinner, J. C. Wilson, M. A. Soos, P. R. Murgatroyd, R. M. Williams, C. L. Acerini, D. B. Dunger, D. Barford, A. M. Umpleby, N. J. Wareham, H. A. Davies, A. J. Schafer, M. Stoffel, S. O'Rahilly, and I. Barroso. 2004. A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science 3041325-1328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Harris, R. B., J. Zhou, S. M. Redmann, Jr., G. N. Smagin, S. R. Smith, E. Rodgers, and J. J. Zachwieja. 1998. A leptin dose-response study in obese (ob/ob) and lean (+/?) mice. Endocrinology 1398-19. [DOI] [PubMed] [Google Scholar]
  • 15.Hay, N., and N. Sonenberg. 2004. Upstream and downstream of mTOR. Genes Dev. 181926-1945. [DOI] [PubMed] [Google Scholar]
  • 16.Inoue, H., W. Ogawa, M. Ozaki, S. Haga, M. Matsumoto, K. Furukawa, N. Hashimoto, Y. Kido, T. Mori, H. Sakaue, K. Teshigawara, S. Jin, H. Iguchi, R. Hiramatsu, D. LeRoith, K. Takeda, S. Akira, and M. Kasuga. 2004. Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nat. Med. 10168-174. [DOI] [PubMed] [Google Scholar]
  • 17.Kamohara, S., R. Burcelin, J. L. Halaas, J. M. Friedman, and M. J. Charron. 1997. Acute stimulation of glucose metabolism in mice by leptin treatment. Nature 389374-377. [DOI] [PubMed] [Google Scholar]
  • 18.Kandel, E. S., and N. Hay. 1999. The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp. Cell Res. 253210-229. [DOI] [PubMed] [Google Scholar]
  • 19.Kubota, N., K. Tobe, Y. Terauchi, K. Eto, T. Yamauchi, R. Suzuki, Y. Tsubamoto, K. Komeda, R. Nakano, H. Miki, S. Satoh, H. Sekihara, S. Sciacchitano, M. Lesniak, S. Aizawa, R. Nagai, S. Kimura, Y. Akanuma, S. I. Taylor, and T. Kadowaki. 2000. Disruption of insulin receptor substrate 2 causes type 2 diabetes because of liver insulin resistance and lack of compensatory beta-cell hyperplasia. Diabetes 491880-1889. [DOI] [PubMed] [Google Scholar]
  • 20.Kushner, J. A., L. Simpson, L. M. Wartschow, S. Guo, M. M. Rankin, R. Parsons, and M. F. White. 2005. Phosphatase and tensin homolog regulation of islet growth and glucose homeostasis. J. Biol. Chem. 28039388-39393. [DOI] [PubMed] [Google Scholar]
  • 21.Laustsen, P. G., M. D. Michael, B. E. Crute, S. E. Cohen, K. Ueki, R. N. Kulkarni, S. R. Keller, G. E. Lienhard, and C. R. Kahn. 2002. Lipoatrophic diabetes in Irs1−/−/Irs3−/− double knockout mice. Genes Dev. 163213-3222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Leibiger, I. B., B. Leibiger, and P. O. Berggren. 2002. Insulin feedback action on pancreatic beta-cell function. FEBS Lett. 5321-6. [DOI] [PubMed] [Google Scholar]
  • 23.Leibiger, I. B., B. Leibiger, T. Moede, and P. O. Berggren. 1998. Exocytosis of insulin promotes insulin gene transcription via the insulin receptor/PI-3 kinase/p70 s6 kinase and CaM kinase pathways. Mol. Cell 1933-938. [DOI] [PubMed] [Google Scholar]
  • 24.Li, X., B. Monks, Q. Ge, and M. J. Birnbaum. 2007. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1α transcription coactivator. Nature 4471012-1016. [DOI] [PubMed] [Google Scholar]
  • 25.Lin, J., C. Handschin, and B. M. Spiegelman. 2005. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab. 1361-370. [DOI] [PubMed] [Google Scholar]
  • 26.Mauvais-Jarvis, F., R. N. Kulkarni, and C. R. Kahn. 2002. Knockout models are useful tools to dissect the pathophysiology and genetics of insulin resistance. Clin. Endocrinol. 571-9. [DOI] [PubMed] [Google Scholar]
  • 27.O'Doherty, R. M., P. R. Anderson, A. Z. Zhao, K. E. Bornfeldt, and C. B. Newgard. 1999. Sparing effect of leptin on liver glycogen stores in rats during the fed-to-fasted transition. Am. J. Physiol. 277E544-E550. [DOI] [PubMed] [Google Scholar]
  • 28.Park, S., X. Dong, T. L. Fisher, S. Dunn, A. K. Omer, G. Weir, and M. F. White. 2006. Exendin-4 uses Irs2 signaling to mediate pancreatic beta cell growth and function. J. Biol. Chem. 2811159-1168. [DOI] [PubMed] [Google Scholar]
  • 29.Parsons, R. 2004. Human cancer, PTEN and the PI-3 kinase pathway. Semin. Cell Dev. Biol. 15171-176. [DOI] [PubMed] [Google Scholar]
  • 30.Pelleymounter, M. A., M. J. Cullen, M. B. Baker, R. Hecht, D. Winters, T. Boone, and F. Collins. 1995. Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269540-543. [DOI] [PubMed] [Google Scholar]
  • 31.Peng, X. D., P. Z. Xu, M. L. Chen, A. Hahn-Windgassen, J. Skeen, J. Jacobs, D. Sundararajan, W. S. Chen, S. E. Crawford, K. G. Coleman, and N. Hay. 2003. Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev. 171352-1365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pocai, A., K. Morgan, C. Buettner, R. Gutierrez-Juarez, S. Obici, and L. Rossetti. 2005. Central leptin acutely reverses diet-induced hepatic insulin resistance. Diabetes 543182-3189. [DOI] [PubMed] [Google Scholar]
  • 33.Puigserver, P., J. Rhee, J. Donovan, C. J. Walkey, J. C. Yoon, F. Oriente, Y. Kitamura, J. Altomonte, H. Dong, D. Accili, and B. M. Spiegelman. 2003. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1α interaction. Nature 423550-555. [DOI] [PubMed] [Google Scholar]
  • 34.Roe, M. W., M. E. Lancaster, R. J. Mertz, J. F. Worley III, and I. D. Dukes. 1993. Voltage-dependent intracellular calcium release from mouse islets stimulated by glucose. J. Biol. Chem. 2689953-9956. [PubMed] [Google Scholar]
  • 35.Rossetti, L., D. Massillon, N. Barzilai, P. Vuguin, W. Chen, M. Hawkins, J. Wu, and J. Wang. 1997. Short term effects of leptin on hepatic gluconeogenesis and in vivo insulin action. J. Biol. Chem. 27227758-27763. [DOI] [PubMed] [Google Scholar]
  • 36.Seufert, J. 2004. Leptin effects on pancreatic beta-cell gene expression and function. Diabetes 53(Suppl. 1)S152-S158. [DOI] [PubMed] [Google Scholar]
  • 37.Shimomura, I., R. E. Hammer, S. Ikemoto, M. S. Brown, and J. L. Goldstein. 1999. Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 40173-76. [DOI] [PubMed] [Google Scholar]
  • 38.Taniguchi, C. M., T. Kondo, M. Sajan, J. Luo, R. Bronson, T. Asano, R. Farese, L. C. Cantley, and C. R. Kahn. 2006. Divergent regulation of hepatic glucose and lipid metabolism by phosphoinositide 3-kinase via Akt and PKCλ/ζ. Cell Metab. 3343-353. [DOI] [PubMed] [Google Scholar]
  • 39.Taniguchi, C. M., K. Ueki, and R. Kahn. 2005. Complementary roles of IRS-1 and IRS-2 in the hepatic regulation of metabolism. J. Clin. Investig. 115718-727. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 40.Toyoshima, Y., O. Gavrilova, S. Yakar, W. Jou, S. Pack, Z. Asghar, M. B. Wheeler, and D. LeRoith. 2005. Leptin improves insulin resistance and hyperglycemia in a mouse model of type 2 diabetes. Endocrinology 1464024-4035. [DOI] [PubMed] [Google Scholar]
  • 41.Tschopp, O., Z. Z. Yang, D. Brodbeck, B. A. Dummler, M. Hemmings-Mieszczak, T. Watanabe, T. Michaelis, J. Frahm, and B. A. Hemmings. 2005. Essential role of protein kinase B gamma (PKBγ/Akt3) in postnatal brain development but not in glucose homeostasis. Development 1322943-2954. [DOI] [PubMed] [Google Scholar]
  • 42.Walker, K. S., M. Deak, A. Paterson, K. Hudson, P. Cohen, and D. R. Alessi. 1998. Activation of protein kinase B beta and gamma isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in vitro: comparison with protein kinase Bα. Biochem. J. 331299-308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Whiteman, E. L., H. Cho, and M. J. Birnbaum. 2002. Role of Akt/protein kinase B in metabolism. Trends Endocrinol. Metab. 13444-451. [DOI] [PubMed] [Google Scholar]
  • 44.Withers, D. J., J. S. Gutierrez, H. Towery, D. J. Burks, J. M. Ren, S. Previs, Y. Zhang, D. Bernal, S. Pons, G. I. Shulman, S. Bonner-Weir, and M. F. White. 1998. Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391900-904. [DOI] [PubMed] [Google Scholar]
  • 45.Xie, T., M. Chen, Q. H. Zhang, Z. Ma, and L. S. Weinstein. 2007. Beta cell-specific deficiency of the stimulatory G protein alpha-subunit Gsalpha leads to reduced beta cell mass and insulin-deficient diabetes. Proc. Natl. Acad. Sci. USA 10419601-19606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yu, X., B. H. Park, M. Y. Wang, Z. V. Wang, and R. H. Unger. 2008. Making insulin-deficient type 1 diabetic rodents thrive without insulin. Proc. Natl. Acad. Sci. USA 10514070-14075. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
supp_29_11_3151__1.pdf (125.7KB, pdf)

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES