Abstract
Background
Transporter associated with antigen processing (TAP), a member of the ATP-binding cassette transporter super family, is composed of two integral membrane proteins, TAP-1 and TAP-2. The TAP gene product is involved in the processing of endogenous peptides that bind to MHC class I molecules. Mutations and/or polymorphism within these genes could alter the efficacy of the immune response which might be relevant for the development of autoimmune diseases and cancer.
Methods
DNA was isolated from peripheral blood sample of 200 patients with cervical cancer and 200 healthy controls. TAP1 and TAP2 allele polymorphism were determined by polymerase chain reaction.
Result
Significant protective OR (OR = 0.22 95% CI = 0.09–0.51, P < 0.001-OR = 0.47, 95% CI = 0.24–0.92, P = 0.02) was observed for GG and combined AG+GG genotypes of TAP2 in patients with SCC respectively. Similarly, such genotypes (GG, AG+GG) appeared same OR for patient with cervical cancer in study group (OR = 0.12, 95% CI = 0.04–0.39-P < 0.001-OR = 0.5 ,95% CI = 0.25–0.95-P = 0.03). There was decrease risk of cervical cancer in user of oral contraceptive with AG and GG genotypes of TAP2 (OR = 0.55, 95% Cl = 0.41–0.73, P = 0.002, OR = 0.09, 95% CI = 0.02–0.36, P < 0.001) respectively. In case of TAP1 gene all allelic polymorphisms showed a decrease OR in patients with cervical cancer in passive smokers and user of oral contraceptives, though, no significant
Conclusion
Thus, TAP1 and TAP2 genes polymorphism are not linked to cervical carcinoma, since no association was found between a particular genotype and the disease.
Keywords: Cervical cancer, Polymorphism, TAP1, TAP2, Gene
Introduction
Cervical cancer is the second most common cancer and an significant cause of death in women worldwide [1]. It is widely accepted that specific human papillomavirus (HPV) types are central etiologic agent of cervical carcinogenesis. Other environmental and host factors also play decisive roles in the persistence of HPV infection and further malignant conversion of cervical epithelium [2]. Because many previous reports have focused on HPV and environmental factors, the role of host susceptibility to cervical carcinogenesis is largely unknown. Epidimiological studies have proposed a range of factors, such as human leukocyte antigen type, immune suppression, sex steroid hormones, and smoking, that may be involved in the progression of cervical cancer [3]. Cotinine, a nicotine metabolite, is present in measurable concentrations in the cervical mucus of women who smoke cigarette regularly [4]. It can also be present in the cervical mucus of nonsmoking women, which suggest that passive smoking conteributs to genotoxic and immunomodulatory effects, including carcinogenesis [5].
The transporter associated with antigen processing (TAP) is a critical component of the major histocompatibility complex (MHC) class I antigen presentation [6].
MHC class I molecules are expressed at low levels in most cells and are strongly induced by cytokines such as interferons that increased expression of MHC class I molecules correlates with increased CTL function [7].
Therefore, both the TAPs are up-regulated by IFN-γ about 10-fold within 24 h, accompanied by an increased peptide transport capacity [8]. Polymorphism in the TAP genes has been described in various species. In some tumor tissues, a down-regulation of TAP mRNA by an unknown mechanism or mutation of TAP was observed [9]. The observed frequency of TAP gene deletions (86%) has been found considerably higher than the frequency of MHC class I gene mutations, and the majority of the TAP gene deletions are homozygous, where TAP allelic polymorphism allows this to be confirmed [10].
The suppression of TAP may be a mechanism for tumor cells to escape the immune response (11). The rat TAP2 polymorphism is associated with different peptide binding specificities and functional differences in the MHC class I peptide complexes thereby also affecting T cell responses [11]. Polymorphism of the human TAP1 gene in healthy volunteers and individuals with autoimmune disease has been systematically analyzed [12]. Also, Kim et al. [13] suggested that TAP1 gene polymorphism may be an important factor contributing to the genetic susceptibility in the development of allergic rhinitis in the Korean population.
The cervical cancer seem to be under immune selection pressure, because an increased relative risk for cervical cancer in chronically immunosuppressed patients has been observed [14]. Vermeulen et al. [15] showed that defective TAP expression in cervical carcinoma is often associated with loss of heterozygosity (LOH) in the TAP region but not with mutations in the TAP1 gene. The aim of our study was to determine whether there was an association between TAP1 and TAP2 genes polymorphism and susceptibility to cervical cancer in northern India women. Under this hypothesis, we tested combination of TAP1 and TAP2 genotypes with squamous cell carcinoma (SCC), adenocarcinoma (AC) and the interaction of these genes with smoking habit and use of oral contraceptive .
Materials and methods
Study subjects
The case-control study involved collection of peripheral blood samples (2–5 ml) of 400 North Indian subjects. 200 cases were newly diagnosed, previously untreated and histologically confirmed as cervical cancer patients. The samples were collected from the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh and Government Medical College (GMC), Chandigarh. The control peripheral blood samples (n = 200) were collected from the same institute with no history of cancer or pre cancer. The control samples were collected from women visiting the gynecology OPD (out patient department) clinic for routine check up without any past medical history of gynecology disorder including cervical diseases.
Informed consent was obtained from all the cases and controls. Detailed data regarding age, use of oral contraceptives, education, menarche, and menopausal status, number of children, age at marriage and birth of first child, cigarette smoking history and spouse’s smoking history were also obtained.
Methods
Genomic DNA was extracted from EDTA anti-coagulated peripheral blood samples according to a standard proteinase K digestion and phenol chloroform extraction method [16]. It was amplified by polymerase chain reaction (PCR). The oligonucleotides were used as primers for TAP1( C/T intron 7), Forward:GTGCTCTCACGTTCCAAGGA, Reverse: AGGAGTAGAGATAGAAGAACC and TAP2 (A/G exon 11), Forward:3- GGTGATTGCTCACAGGCTGCCG Reverse: CACAGCTCTAGGGAAACTC. Amplification reactions were carried out in 25-µL of reaction mixture containing 100 ng genomic DNA, 0.25 mmol/L dNTPs, 2 mmol/L MgCl2, 10 mMTris-HCl (pH = 8.3). 50 mM KCl, 1.5 units of Taq polymerase (MBI Fermentas, Burlington, Ontario, Canada), and 0.3 mmol/L of each primer (Sigma-Aldrich, USA). PCR was carried out at 95°C for 2.5 min, 30 cycles of 30 s at 95°C, 30 s at 55°C, and 72°C for 30 s, followed by a final 5 min at 70°C.( Amplification reactions and PCR condition were same for both genes).
Restriction digestion: RFLP assay was performed in a 15 µL reaction mixture containing PCR product (10 µL), buffer (1.6 µL), enzyme (Msp1, 3 unit per reaction) and distilled water (3 µl). The reaction mixture was incubated at 37°C for 3 h. After digestion, for TAP1, T allele gave a product of 183 bp and the C allele gave two fragments of 161 and 22 bp, in case of TAP2 with same condition AA genotypes were identified by the presence of only 225 bp fragment, AG genotype by the presence of 225, 205, 20 bp fragments and GG genotype by 205 and 20 bp fragments.
Statistical analysis
The association between polymorphism in TAP1 and TAP2 genes with the risk of cervical cancer was estimated by computing odds ratio (OR) and 95% confidence intervals (95% CI), using a multivariate logistic regression analysis that included several potential confounding variables. The Statistical analysis was performed using Epi-Info software (Epi-Info, version 3.2, Center for Disease Control and Prevention, Atlanta, GA, USA) and software SPSS version 10.0 (SPSS, Chicago, IL) . Significance was set at P < 0.05.
Results
The genotype of the TAP1 and TAP2 genes in cervical cases and healthy controls derived from north India population was analyzed.
Demographic variables for cases and controls have been summarized in Table 1. The variables have also been categorized for squamous cell carcinoma (SCC) and adenocarcinoma (AC) cervical cancer; 175 were identified as SCC and 25 as AC.
Table 1.
Demographic characteristics of cervix cancer cases and controlsa
| Variable | Cases (200) | Controls (200) | SCC(175) | AC(25) |
|---|---|---|---|---|
| Age ± | 48.55 ± 9.43 | 48.81 ± 9.64 | 48.39 ± 9.42 | 49.68 ± 9.64 |
| Age at menarche ± | 14.87 ± 1.14 | 14.02 ± 1.09 | 14.90 ± 1.16 | 14.68 ± 1.00 |
| Age at marriage ± | 16.36 ± 3.39 | 20.31 ± 3.46 | 16.68 ± 2.97 | 14.74 ± 2.56 |
| Age at first birth ± child | 18.39 ± 3.39 | 22.31 ± 4.30 | 18.61 ± 3.16 | 16.84 ± 4.45 |
| Childrenb | 4.11 | 2.50 | 4.09 ± 1.51 | 4.21 ± 1.84 |
| Age at menopause ± | 48.31 ± 3.56 | 48.26 ± 2.39 | 48.29 ± 3.62 | 48.44 ± 3.40 |
Abbreviations: AC adenocarcinoma, OR odds ratio, SCC squamous cell carcinoma
aValues are given as mean ±SD or number (percentage) unless otherwise indicated
bValues are given as median for the cancer and control groups
The mean±SD age was 48.55 ± 9.43 years in the study group and 48.81 ± 9.64 years in the control group. Compared with the controls, the study group had younger age at the time of the marriage (16.36 ± 3.39) and of the birth of first child (18.39 ± 3.39) and had a greater median number of children (4.11 vs 2.50). Ages at menarche and menopause were found to be comparable between cases and controls.
As shown in Table 2, the distribution of TAP1 genotypes among cervical cancer cases and controls. The frequency of TC genotype was greater in cases (91.0%) than controls (87.0%), while those of CC genotype was higher in controls (8.0%) than cases (4.0%). In case of TAP2 , the frequency of AA (16%) and AG (80.5%) genotypes was greater in cases than controls (8.5%,76% respectively). On the other hand, GG genotype of TAP2 was more frequent in control (15.5%) than cases (3.5%).
Table 2.
TAP1 and TAP2 genotypes in women with cervical cancer and healthy controlsa
| TAP1 genotypes | Case (%)200 | Control(%)200 | OR(95% CI)b | Pc |
|---|---|---|---|---|
| TT | 10 (5.0) | 10 (5.0) | 1.0(ref) | |
| TC | 182 (91.0) | 174 (87.0) | 1.05 (0.39–2.79) | |
| CC | 8 (4.0) | 16 (8.0) | 0.50 (0.12–2.0) | |
| TC+CC | 190 (95.0) | 190 (95.0) | 1.00 (0.37–2.67) | |
| TAP2 genotypes | ||||
| AA | 32 (16.0) | 17 (8.5) | 1.0(ref) | |
| AG | 161 (80.5) | 152 (76.0) | 0.56 (0.29–1.1) | |
| GG | 7 (3.5) | 31 (15.5) | 0.12 (0.04–0.39) | P < 0.001 |
| AG+GG | 168 (84.0) | 183 (91.5) | 0.5 (0.25–0.95) | P = 0.03 |
Abbreviations: CI confidence interval, NA not applicable, OR odds ratio, ref Reference
aValues are given as number (percentage) unless otherwise indicated
bORs were adjusted for age, smoking status, and use of oral contraceptives
cp < 0.05 has been mentioned
The association between the TAP genes and cervical cancer is summarized in Table 2. In case of TAP1, marginal risk of cervical cancer was found in individuals with TC and combined TT + CC (OR = 1.05, 95% CI = 0.39–2.79–OR = 1.0, 95% CI = 0.37–2.67) genotypes respectively. There was a decrease in OR (OR = 0.50, 95% CI = 0.12–2.0) for CC genotype as well. A highly significant decrease was observed in the OR of patients carrying GG and combined AA+GG genotypes of TAP2 (OR = 0.12, 95% CI, 0.04–0.39, P < 0.001 and OR = 0.50, 95% CI = 0.25–0.95, P = 0.03 respectively).
When the genotypes of TAP1 were stratified according to histological subtypes (Table 3), there was no association between TAP1 genotypes and type of cervix cancer. A significant decrease in OR was observed for patients with GG and combined AA + GG genotypes of TAP2 for SCC (OR = 0.22, 95% CI = 0.09–0.51, P < 0.001 and OR = 0.47, 95% CI = 0.24–0.92, P = 0.02 respectively).
Table 3.
Association between TAP1 and TAP2 genotypes and type of cervical cancer
| AP1 | Type of cancer | nc | OR (95% CI)a | P -valueb |
|---|---|---|---|---|
| TT | No cancer | 10/10 | 1.0(ref) | – |
| TC | SCC | 158/174 | 1.01 (0.37–2.78) | |
| AC | 24/121 | 1.33 (0.20–8.97) | ||
| CC | SCC | 8/16 | 0.56 (0.13–2.27) | – |
| AC | – | |||
| TC+CC | SCC | 166/190 | 0.97 (0.35–2.67) | |
| TAP2 | ||||
| AA | No cancer | 32/17 | 1.0(ref) | |
| AG | SCC | 141/152 | 0.54 (0.27–1.08) | |
| AC | 2/152 | 0.78 (0.25–2.38) | ||
| GG | SCC | 5/31 | 0.22 (0.09–0.51) | P < 0.001 |
| AC | 2/31 | 0.40 (0.07–2.21) | ||
| AG+GG | SCC | 146/183 | 0.47 (0.24–0.92) | P = 0.02 |
| AC | 4/183 | 0.72 (0.23–2.18) |
Abbreviations: AC adenocarcinoma, CI confidence interval, NA not applicable, nc number of case and control, OR odds ratio, ref Reference, SCC squamous cell carcinoma
aORs were adjusted for age, smoking status, and use of oral contraceptives
bp < 0.05 has been mentioned
None of the genotypes of TAP1 and TAP2 were found to be significantly associated with the risk of cervical cancer in passive smokers (Table 4)
Table 4.
Association between TAP1 and TAP2 genotypes and smoking habits in women with cervical cancer and healthy controls
| TAP1genotype | Statue of smoking | Case % | Control % | OR(95% CI)a |
|---|---|---|---|---|
| TT | Never smoking | 5 (4.5) | 5 (4.2) | 1.0(ref) |
| TT | Passive smoking | 5 (5.7) | 1 (6.6) | |
| TC | Passive smoking | 80 (90.9) | 53 (80.3) | 1.20 (0.64–2.3) |
| CC | Passive smoking | 3 (3.4) | 2 (13.2) | 1.20 (0.47–3.09) |
| TC+CC | Passive smoking | 83(94.3) | 55(98.2) | 1.08(0.59–1.97) |
| TAP2genotype | ||||
| AA | Never smoking | 16 (14.5) | 8 (5.8) | 1.0(ref) |
| AA | Passive smoking | 16 (18.2) | 5 (8.9) | |
| AG | Passive smoking | 68 (77.3) | 49 (78.5) | 0.69 (0.25–1.90) |
| GG | Passive smoking | 4 (4.5) | 2 (3.5) | 1.00 (0.53–1.88) |
| AG+GG | Passive smoking | 72(81.8) | 51(91.07) | 0.71(0.25–1.92) |
Abbreviations: CI confidence interval, OR odds ratio, ref Reference
aORs were adjusted for age and use of oral contraceptives
The relationship between TAP1 and TAP2 genotypes and use of oral contraceptives are given in Table 5. There was an decreased OR in patients using oral contraceptives having TAP1 (TC) genotype (OR=0.81, 95% CI=0.41–1.60). In case of TAP2, statistically significant relationship was found between the use of oral contraceptives and decreased risk of cervical cancer in those having TAP2 (AG and GG) genotypes (OR = 0.55, 95% CI = 0.41–0.73, P = 0.002 and OR = 0.09, 95% CI = 0.02–0.36, P < 0.001 respectively).
Table 5.
Relationship between TAP1 and TAP2 genotypes and oral contraceptive use in women with cervical cancer and healthy controls
| TAP1 | Case (%) | Control (%) | OR(95% CI) | P –valueb |
|---|---|---|---|---|
| TT (none used) | 5 (4.0) | 6 (7.5) | 1.0(ref) | – |
| TT | 5 (6.7) | 1 (0.83) | 1.83(0.87–3.04) | |
| TC | 65 (86.7) | 111 (89.0) | 0.81 (0.41–1.60) | |
| CC | 5 (6.7) | 8 (6.6) | 0.75(0.11–5.13) | |
| TC+CC | 70(35.0) | 119(59.5) | 0.81(0.42–1.60) | |
| TAP2 | ||||
| AA(none used) | 20 (16.0) | 6 (7.5) | 1.0(ref) | – |
| AA | 12 (16.0) | 10 (8.3) | 0.36(0.09–1.46) | |
| AG | 61 (81.3) | 84 (70.0) | 0.55 (0.41–0.73) | P = 0.02 |
| GG | 2 (2.7) | 26 (21.6) | 0.09 (0.02–0.36) | P < 0.001 |
| AA+GG | 63(31.5) | 110(55.5) | 0.47(0.35–0.63) | 0.0002 |
Abbreviations: CI confidence interval, OR odds ratio, ref Reference
aORs were adjusted for age and smoking status
bp < 0.05 has been mentioned
Discussion
To the best of our knowledge, no such study has been carried out on cervical cancer. So this is the first case-control study which has analyzed the effect of TAP gene polymorphism on the risk of developing cervical cancer in north Indian population. The importance of host factors, particularly immunoregulatory genes, in the pathogenesis of cervical cancer has become more evident over the past decade. Longitudinal studies have shown that most women exposed to high risk types of HPV clear the virus [17, 18]. A smaller subset has intermittent virus present in the genital mucosa, but about 11% of women have consistent detectable virus in the mucosal tissues after exposure [19]. The factors that result in persistent carriage of the virus are unknown, but one factor appears to be the absence of a cytotoxic T-cell response with which to clear the virus [20].
The present study sought to identify the possible link between TAP gene polymorphisms and the risk of developing cervical cancer in north Indian population. No association has been identified between risk of cervical cancer and TAP1 and TAP2 genes polymorphism. Fowler et al [21] demonstrated that TAP2 AB genotype, having high frequency in patients with cervical cancer, may be relevant to evolution of cervical cancer from precursor lesions. Hodson et al [22] did not found any association between TAP2 gene polymorphism and renal cell carcinoma. It has been reported that a neoplastic transformation is frequently associated with impaired TAP expression [23]. In addition, lack of TAP resulted in reduction of MHC class 1 antigen in various cancers [24]. Loss of MHC class 1 antigen expression on the cell surface is assumed to allow tumors to avoid being killed by cytotoxic T lymphocytes [25].
The limitations of the present study are as follows: first the present study is hospital-based and exist in environment; therefore, it can’t be free from any selection bias. Second, the current study didn’t include all clustered polymorphism site of TAP1, TAP2 and associated genes; the haplotypes analysis could not be done. So it would be worthwhile to perform further large scale population-based study including the analysis of various clustered polymorphisms. In conclusion, in north Indian population, TAP1 and TAP2 genotypes are not associated with increased risk of cervical cancer.
Acknowledgments
The authors are grateful to University Grant Commission (UGC) -New Delhi, India, and University of Sistan and Baluchistan-Zahedan, Iran, for supporting this project financially.
References
- 1.Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ. Cancer statistics. CA Cancer J Clin 2003;53:5–26. [DOI] [PubMed]
- 2.Zur Hausen H. Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. J Natl Cancer Inst. 2000;3;92(9):690–8. [DOI] [PubMed]
- 3.Arends MJ, Benton EC, McLaren KM, Stark LA, Hunter JA, Bird CC. Renal allograft recipients with high susceptibility to cutaneous malignancy have an increased prevalence of human papillomavirus DNA in skin tumours and a greater risk of anogenital malignancy. Br J Cancer 1997;75(5):722–8. [DOI] [PMC free article] [PubMed]
- 4.Poppe WA, Peeters R, Daenens P, Ide PS, Van Assche FA. Tobacco smoking and the uterine cervix: cotinine in blood, urine and cervical fluid. Gynecol Obstet Invest 1995;39(2):110–4. [DOI] [PubMed]
- 5.Trimble CL, Genkinger JM, Burke AE, Hoffman SC, Helzlsouer KJ, Diener-West M, et al. Active and passive cigarette smoking and the risk of cervical neoplasia. Obstet Gynecol 2005;105(1):174–81. [DOI] [PMC free article] [PubMed]
- 6.Abele R, Tampe R. Function of the transport complex TAP in cellular immune recognition. Biochim Biophys Acta 1999;1461:405–19. doi:10.1016/S0005-2736(99)00171-6. [DOI] [PubMed]
- 7.Lankat-Buttgereit B, Tampe R. The transporter associated with antigen processing TAP: structure and function. FEBS Lett 1999;464:108–12. doi:10.1016/S0014-5793(99)01676-2. [DOI] [PubMed]
- 8.Beck S, Kelly A, Radley E, Khurshid F, Alderton RP, Trowsdale J. DNA sequence analysis of 66 kb of the human MHC class II region encoding a cluster of genes for antigen processing. J Mol Biol 1992;228:433–41. doi:10.1016/0022-2836(92)90832-5. [DOI] [PubMed]
- 9.Seliger B, Höhne A, Jung D, Kallfelz M, Knuth A, Jaeger E, et al. Expression and function of the peptide transporters in escape variants of human renal cell carcinomas. Exp Hematol 1997;25(7):608–14. [PubMed]
- 10.Kim KR, Cho SH, Choi SJ, Jeong JH, Lee SH, Park CW, et al. TAP1 and TAP2 gene polymorphisms in Korean patients with allergic rhinitis. J Korean Med Sci 2007;22(5):825–31. [DOI] [PMC free article] [PubMed]
- 11.Cao B, Tian X, Li Y, Jiang P, Ning T, Xing H, et al. LMP7/TAP2 gene polymorphisms and HPV infection in esophageal carcinoma patients from a high incidence area in China. Carcinogenesis 2005;26(7):1280–4. doi:10.1093/carcin/bgi071. [DOI] [PubMed]
- 12.Vambutas A, Bonagura VA, Steinberg BM. Altered expression of TAP1 and MHC class I in laryngeal papillomatosis: correlation of TAP1 with disease. Clin Diagn Lab Immunol 2000;7:79–85. [DOI] [PMC free article] [PubMed]
- 13.Kim KR, Cho SH, Choi SJ, Jeong JH, Lee SH, Park CW, et al. TAP1 and TAP2 gene polymorphisms in Korean patients with allergic rhinitis. J Korean Med Sci 2007;22(5):825–31. [DOI] [PMC free article] [PubMed]
- 14.Ian HF, Germain F, Linda D, Graham L, Karen M, Rachel D, et al. Cervical cancer immunotherapy: murine and human studies. Cancer Res Inst. 2006.
- 15.Vermeulen CF, Jordanova ES, ter Haar NT, Kolkman-Uljee SM, de Miranda NF, Ferrone S, et al. Expression and genetic analysis of transporter associated with antigen processing in cervical carcinoma. Gynecol Oncol 2007;105(3):593–9. doi:10.1016/j.ygyno.2007.02.016. [DOI] [PubMed]
- 16.Roe BA, Crabtree JS, Khan AS. Methods for DNA isolation.Part III. In: Protocols for recombinant DNA isolation, cloning, and sequencing [Internet edition]. Norman, OK: University of Oklahoma; 1995. Available from: http://www.genome.ou.edu/protocol_book/protocol_index.html; also available in paper copy as: DNA isolation and sequencing; New York: Wiley; 1996. leucovorin. Clin Cancer Res. 2002; 8:2488–2498.
- 17.Hildesheim A, Schiffman MH, Gravitt PE, Glass AG, Greer CE, Zhang T, et al. Persistence of type-specific human papillomavirus infection among cytologically normal women. J Infect Dis 1994;169(2):235–40. [DOI] [PubMed]
- 18.Ho GY, Palan PR, Basu J, Romney SL, Kadish AS, Mikhail M, et al. Viral characteristics of human papillomavirus infection and antioxidant levels as risk factors for cervical dysplasia. Int J Cancer 1998;78(5):594–9. doi:10.1002/(SICI)1097-0215(19981123)78:5<594::AID-IJC11>3.0.CO;2-B. [DOI] [PubMed]
- 19.Moscicki AB, Hills N, Shiboski S, Powell K, Jay N, Hanson E, et al. Risks for incident human papillomavirus infection and low-grade squamous intraepithelial lesion development. JAMA 2001;285(23):2995–02. doi:10.1001/jama.285.23.2995. [DOI] [PubMed]
- 20.Tsukui T, Hildesheim A, Schiffman MH, Lucci J, Contois D, Lawler P, et al. Interleukin 2 production in vitro by peripheral lymphocytes in response to human papillomavirus-derived peptides: correlation with cervical pathology. Cancer Res 1996;56(17):3967–74. [PubMed]
- 21.Fowler NL, Frazer IH. Mutations in TAP genes are common in cervical carcinomas. Gynecol Oncol 2004;92(3):914–21. doi:10.1016/j.ygyno.2003.11.037. [DOI] [PubMed]
- 22.Hodson I, Bock M, Ritz U, Brenner W, Huber C, Seliger B. Analysis of the structural integrity of the TAP2 gene in renal cell carcinoma. Int J Oncol 2003;23(4):991–9. [PubMed]
- 23.Seliger B, Bock M, Ritz U, Huber C. High frequency of a non-functional TAP1/LMP2 promoter polymorphism in human tumors. Int J Oncol 2002;20(2):349–53. [PubMed]
- 24.Alaminos M, Davalos V, Cheung NK, Gerald WL, Esteller M. Clustering of gene hypermethylation associated with clinical risk groups in neuroblastoma. J Natl Cancer Inst 2004;96:1208–19. [DOI] [PubMed]
- 25.Hicklin DJ, Wang Z, Arienti F, Rivoltini L, Parmiani G, Ferrone S. Beta2-microglobulin mutations, HLA class I antigen loss, and tumor progression in melanoma. J Clin Invest 1998;101:2720–9. doi:10.1172/JCI498. [DOI] [PMC free article] [PubMed]