In Vivo Selection of Reduced Susceptibility to Carbapenems in Acinetobacter baumannii Related to ISAba1-Mediated Overexpression of the Natural bla_OXA-66 Oxacillinase Gene

Abstract

Two clonally related Acinetobacter baumannii isolates, A1 and A2, were obtained from the same patient. Isolate A2, selected after an imipenem-containing treatment, showed reduced susceptibility to carbapenems. This resistance pattern was related to insertion of the ISAba1 element upstream of the naturally occurring bla_OXA-66 carbapenemase gene as demonstrated by sequencing, reverse transcription-PCR analysis, and inactivation of the bla_OXA-66 gene.

Acinetobacter baumannii is a gram-negative nonfermenting coccobacillus with a noticeable increase in resistance to carbapenems due to various and combined mechanisms, but mostly related to carbapenemases (11, 14). These carbapenemases are mostly carbapenem-hydrolyzing class D β-lactamases (CHDLs) which have been identified worldwide in Acinetobacter spp. The four groups of CHDLs identified in A. baumannii are the naturally occurring OXA-51-like β-lactamase and the acquired OXA-23-like, OXA-24/OXA-40-like, and OXA-58-like β-lactamases (14). Whereas the contribution of acquired CHDLs in carbapenem resistance is known (5), despite their weak ability to hydrolyze carbapenems (4), the naturally occurring OXA-51-like enzymes may be involved in resistance or decreased susceptibility to carbapenems (4, 8, 15, 16). The presence of the ISAba1 element upstream of bla_OXA-51-like genes might provide promoter sequences enhancing expression of these genes, as observed with the naturally occurring bla_ampC gene (named bla_ADC) of A. baumannii.

We report here the clinical, microbiological, and genetic features associated with the isolation of isogenic A. baumannii strains, with or without reduced susceptibility to carbapenems, recovered after an imipenem-containing treatment.

Patients and strains.

Carbapenem-susceptible A. baumannii isolate A1 was recovered from rectal and wound swabs from a 62-year-old patient hospitalized for severe trauma in June 2007 in the intensive care unit of Grenoble Hospital, France. After 3 weeks of an imipenem-containing treatment (500 mg three times daily together with ciprofloxacin and linezolide), a carbapenem-nonsusceptible A. baumannii isolate, A2, was recovered from the same patient from an endotracheal aspirate (Table 1). Both isolates were identified with the API 32GN system (bioMérieux SA, Marcy-l'Etoile, France), and identification was confirmed by sequencing of 16S rRNA genes as described previously (3). During the following months, an outbreak of A. baumannii A1 was identified at Grenoble Hospital involving 36 patients (eight infections and 28 colonizations) (data not shown).

TABLE 1.

MICs of β-lactams for the A. baumannii strains

β-Lactam	MIC of indicated isolate (μg/ml)
	A1	A2	A2 (ΔOXA-66)
Imipenem	2	4	0.5
Meropenem	3	6	0.5
Rifampin	8	8	128
Ceftazidime	128	128	128

Susceptibility testing.

Antibiotic susceptibilities of A. baumannii isolates A1 and A2 were determined and interpreted as described previously (1, 13). Production of extended-spectrum β-lactamase and overexpression of the AmpC cephalosporinase were evaluated as described previously (13). Metallo-β-lactamase production was evaluated by using Etest strips with imipenem and EDTA (AB Biodisk, Solna, Sweden). MICs of β-lactams were determined by using Etest strips on Mueller-Hinton agar plates at 37°C. A. baumannii isolate A1 was susceptible to imipenem, meropenem, and colistin. A. baumannii isolate A2 had a resistance profile similar to that of isolate A1 but with reduced susceptibility to imipenem and meropenem (Table 1). Antimicrobial susceptibility testing performed with cloxacillin-containing plates suggested overexpression of the naturally occurring gene bla_ADC in both isolates. Neither extended-spectrum β-lactamase nor metallo-β-lactamase production was detected in either isolate.

Molecular investigations.

Pulsed-field gel electrophoresis was performed as described previously (13) using restriction enzyme ApaI (GE Healthcare, Orsay, France) for genotyping A. baumannii isolates and showed indistinguishable patterns between isolates A1 and A2 (data not shown). Preliminary PCR experiments followed by sequencing with published primers (9) revealed that both isolates possessed a bla_TEM-1 gene. PCR analysis and sequencing performed as described previously (2, 6) identified ISAba1 9 bp upstream of the bla_ADC gene in isolates A1 and A2, further confirming overexpression of AmpC.

Genes coding for the acquired CHDLs were searched out by using PCR analysis as described previously (5, 12), but results remained negative for both isolates. However, the same bla_OXA-66 gene corresponding to the intrinsic bla_OXA-51-like gene of A. baumannii was identified in isolates A1 and A2 by using primers PreOXA-Ab-1 and PreOXA-Ab-2 (Table 2). ISAba1 was identified 7 bp upstream of the bla_OXA-66 gene in isolate A2 but not in isolate A1. This insertion element belonging to the IS4 family (10) was inserted in such a way that its transposase gene was in the opposite orientation with respect to bla_OXA-66. That discrepancy between isolates A1 and A2 might explain the different resistance profiles toward carbapenems. Noteworthy is that a PCR experiment confirmed that isolate A1 originally possessed ISAba1 in its genome.

TABLE 2.

Primers used in this study

Primer	Sequence (5′ to 3′)	Target
AmpC-2a	ACAGCCATACCTGGCACATC	blaampC
P13Bb	CGGGATCCCAGGCCCGGGAAC	16S rRNA
UNI14	GTGCCAGCAGCCGCGGTAAT	16S rRNA
PBb	TAACACATGCAAGTCGAACG	16S rRNA
BAK2	GGACTACHAGGGTATCTAT	16S rRNA
16S1	GGAGGAAGGTGGGGATGACG	RT-PCR of 16S rRNA gene
16S3	TCTGATCCGCGATTACTAGCG	RT-PCR of 16S rRNA gene
PreOXA-Ab-1	CTAATAATTGATCTACTCAAG	blaOXA-51-like
PreOXA-Ab-2	CCAGTGGATGGATAGATTATC	blaOXA-51-like
OXA-Abint-BamHI-A	CGGGATCCCGCGACCGAGTATGTACCTGCTT	blaOXA-66, internal primer
OXA-Abint-BamHI-B	CGGGATCCCGCTAAGTTAAGGGAGAACGC	blaOXA-66, internal primer

^aThe AmpC-2 primer is used with ISAba1-B.

^bThe P13B primer is used together with UNI14; the PB primer is used together with BAK2.

In order to investigate the possible indirect involvement of that ISAba1-bla_OXA-66 structure in reduced susceptibility to carbapenems, quantitative reverse transcription-PCR (RT-PCR) experiments were performed to measure the bla_OXA-66 expression. Bacterial strains were grown aerobically in Luria-Bertani broth until mid-log phase; aliquots were removed and added to RNAprotect (Qiagen, Courtaboeuf, France), and total cellular RNA was extracted using the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. One-step RT-PCR was performed using a LightCycler (Roche, Mannheim, Germany) with the QuantiFast SYBR green RT-PCR kit (Qiagen). A post-PCR melting curve analysis was performed as described elsewhere (7). The bla_OXA-66 transcript levels were normalized against the 16S RNA gene, and quantifications were repeated in triplicate (primers used are listed in Table 2 and referenced elsewhere [5]). Transcriptional profile analysis indicated a 50-fold increased expression of bla_OXA-66 in isolate A2 compared with that of isolate A1 (mean ± the standard deviation, 50 ± 6.7).

In order to better precisely identify the role of OXA-66 expression in reduced susceptibility to carbapenems in isolate A2, a knockout mutant for the bla_OXA-66 gene was constructed as described previously (5). Briefly, plasmid pACYC184 unable to replicate in A. baumannii and harboring a chloramphenicol resistance gene was used as a suicide vector. The arr-2 gene conferring resistance to rifampin obtained as described previously (5) was inserted into the EcoRV-restricted plasmid pACYC184, giving rise to pACYC184-RA. An internal fragment of the bla_OXA-66 gene was generated using primers OXA-Abint-BamHI-A and OXA-Abint-BamHI-B (Table 2) and inserted into the BamHI-restricted plasmid pACYC184-RA, giving rise to plasmid pACYC184-RA-OXA-66, and then introduced into the rifampin-susceptible A. baumannii A2 isolate by electrotransformation. Selection of A. baumannii A2 (pACYC184-RA-OXA-66) was made on plates containing rifampin (25 μg/ml) and chloramphenicol (40 μg/ml). Inactivation of the bla_OXA-66 gene by insertion of pACYC184-RA-OXA-66 was verified by PCR amplification of the arr-2 gene and nonamplification of the entire bla_OXA-66 gene under standard PCR conditions. Inactivation of the bla_OXA-66 gene resulted in increased susceptibility to carbapenems in A. baumannii A2 (ΔOXA-66) compared to that in A. baumannii isolates A2 and A1 (Table 1), indicating that the bla_OXA-66 gene was involved in reduced susceptibility to carbapenems even when weakly expressed, such as in isolate A1.

Conclusions.

This study corresponds to the first report of an in vivo selection of reduced susceptibility to carbapenems in A. baumannii. This reduced susceptibility to carbapenems was related to selection of the ISAba1-related overexpression of bla_OXA-66. Turton et al. (16) had suggested the involvement of ISAba1 in the overexpression of bla_OXA-51-like genes, and other studies showed their significant expression levels by using RT-PCR experiments (8, 15). However, inactivation of the bla_OXA-51-like gene had not been performed to clearly assess the real impact of this mechanism. We demonstrated here that inactivation of a bla_OXA-66 gene in A. baumannii results in a higher susceptibility to carbapenems. Although the ISAba1-bla_OXA-66 association may lead to reduced susceptibility to carbapenems, it may constitute a resistance mechanism that could enhance selection of other mechanisms of resistance, efflux overexpression, impaired permeability, or acquisition of other CHDLs.