Capsular Type and Antibiotic Resistance in Streptococcus agalactiae Isolates from Patients, Ranging from Newborns to the Elderly, with Invasive Infections

Abstract

Streptococcus agalactiae isolates (n = 189) from patients with invasive infections were analyzed for capsular type by PCR, for antimicrobial susceptibility, and for the presence of resistance genes. In contrast to the predominance of capsular type III in children, types Ib and V were most common among adults. All 45 levofloxacin-resistant strains had two amino acid substitutions, Ser₈₁Leu in the gyrA gene and Ser₇₉Phe in the parC gene, and showed similar pulsed-field gel electrophoresis patterns.

Streptococcus agalactiae (a group B streptococcus [GBS]) is the main microorganism causing meningitis and sepsis in infants and also sepsis in nonpregnant adults (12, 14).

GBS infection in infants is classified as early onset, occurring in newborns within the first week of life, or late onset, developing in infants more than 1 week old, with most infections arising in the first 3 months and only extremely rarely in older infants (18). In the 1970s, morbidity and mortality from these GBS infections were high (3, 4, 9). In 1996, however, recommendations for the prevention of perinatal GBS infection were issued by the American College of Obstetricians and Gynecologists (2), the Centers for Disease Control and Prevention (7), and later also the American Academy of Pediatrics (1). As a result, preventive efforts increased and the incidence of early-onset disease decreased substantially (6, 23). A more detailed revised guideline, based on prenatal bacterial cultures and epidemiologic studies, was recommended in 2002 (17).

Recently, Phares et al. (15) reported on a 7-year epidemiologic survey of invasive GBS disease in the United States that demonstrated a significant decline in the incidence of early-onset disease in infants, contrasting with an increase in GBS disease among adults ≥65 years old.

In the present paper, we describe details concerning patient age, disease, and underlying diseases associated with invasive GBS infection, as well as the capsular types, antimicrobial susceptibilities, and resistance genes of isolates in Japan.

Between August 2006 and July 2007, our laboratory received 189 GBS strains from the bacteriologic laboratories of 97 medical institutions participating in the Invasive Streptococcal Disease Working Group at the 19th Annual Meeting of the Japanese Society for Clinical Microbiology. All isolates were from sterile sites: blood (n = 124), cerebrospinal fluid (n = 54), pustule fluid (n = 7), joint fluid (n = 3), and tissue (n = 1).

To identify the capsular type of GBS by PCR, we used nine sets of primers from types Ia to VIII as reported by Poyart et al. (16). We also applied our newly designed dltS primers for the identification of GBS (Table 1).

TABLE 1.

Primers for PCR and sequencing for FQ resistance in S. agalactiae

Gene and primer	Sequence (5′-3′)	Length (mer)	Amplicon size (bp)
dltS
dlts-F	CTGTAAGTCTTTATCTTTCTCG	22	199
dlts-R	TCCATTCGCTTAGTCTCC	18
gyrA
gyrA-F	GGTTTAAAACCTGTTCATCGTCGT	24	407
gyrA-R	GCAATACCAGTTGCACCATTGACT	24
gyrB
gyrB-F	CGAAGCTTTCAATCGATTCCTATT	24	495
gyrB-R	GGTCGCATAAAACGATAAATCAGAG	25
parC
parC-F	CCGGATATTCGTGATGGCTT	20	403
parC-R	TGACTAAAAGATTGGGAAAGGC	22
parE
parE-F	GCAAAGCAACTTCGATATGAAATTC	25	368
parE-R	CGGAGCTATTTACAGACAACGTTTT	25

One colony was picked up from each agar plate and placed in 30 μl of lysis solution containing 1 U of mutanolysin. The lytic reaction was carried out for 20 min at 60°C, followed by 5 min at 94°C. The lysate was added to each of five tubes containing PCR mixtures for individual capsular types: types Ia and Ib in tube A, types II and III in tube B, types IV and dltS in tube C, types V and VII in tube D, and types VI and VIII in tube E. The reaction mixture (25 μl) consisted of 20 pmol of each primer, 0.625 U of AmpliTaq Gold polymerase (Applied Biosystems, Tokyo, Japan), 2.5 μl of 10× PCR Gold buffer, 2.5 μl of 25 mM MgCl₂, 2 μl of a 2 mM deoxynucleotide triphosphate mixture, and 16.875 μl of DNase- and RNase-free distilled water. DNA amplification was carried out with 40 cycles of 94°C for 1 min, 53°C for 2 min, and 72°C for 2 min.

We measured the antimicrobial susceptibilities of GBS strains to 14 antibiotics including oral and parenteral agents by agar plate dilution methods using blood agar.

Three genes for macrolide (ML) resistance, erm(A), erm(B), and mef(A), were identified with the three sets of primers and PCR conditions described previously (21).

To identify fluoroquinolone (FQ) resistance, four sets of primers were designed based on the sequences of the gyrA, gyrB, parC, and parE genes (Table 1). The PCR mixture (50 μl) consisted of 20 pmol of each primer, 0.625 U of TaKaRa Ex Taq polymerase (Takara Bio, Kyoto, Japan), 5 μl of 10× Ex Taq buffer, 4 μl of the 2.5 mM deoxynucleotide triphosphate mixture, and 38.25 μl of DNase- and RNase-free distilled water. Amplified and purified DNA samples were sequenced with a BigDye Terminator cycle sequencing kit (version 3.1; Applied Biosystems, Foster City, CA). The pbp2x gene encoding the PBP2X enzyme, which mediates septum formation during cell wall synthesis, was also sequenced with primers reported previously (11).

We performed pulsed-field gel electrophoresis (PFGE) on the 45 GBS strains determined to have FQ resistance according to mutations in the gyrA and parC genes. Plug-embedded GBS cells were lysed with lysozyme (5,000 U/3 ml) and mutanolysin (20 U/ml) at 50°C for 3 h by a modification described previously (5, 8). Chromosomal DNA was digested at 37°C for 18 h with ApaI (100 U/ml). PFGE was performed with 1% agarose and 0.5× TBE buffer (1× TBE is 90 mM Tris base, 88 mM boric acid, and 2 mM EDTA) at pulse times of 2.91 to 17.33 s, at an angle of 120°, at 6.0 V/cm, and at 14°C for 20 h with the CHEF Mapper (Bio-Rad Laboratories, Hercules, CA).

Table 2 shows relationships between capsular types of GBS pathogens and diagnoses, separately considering children ≤17 years old (n = 65) and adults (n = 124). Diseases were classified into meningitis, sepsis, and other infection groups. In children including newborns (10.8%) with early-onset disease and neonates (70.8%) with late-onset disease, capsular type III predominated at 67.7%, with small numbers of other types. Among adults, those at least ≥50 years old accounted for 83.1% of the cases; capsular type Ib predominated at 31.5%, followed by V (18.5%), II (12.1%), and III (12.1%). In addition to sepsis (75.0%), a variety of diseases were noted: cellulitis, arthritis, necrotizing fasciitis, meningitis, and bacterial endocarditis. Importantly, 88.7% of the affected adults had underlying disease such as diabetes, liver dysfunction, or immune compromise. Instances of death and neurologic sequelae included one of each among children, and eight (6.4%) and two (1.6%) among adults, respectively.

TABLE 2.

Correlation of capsular types of strains with 189 invasive GBS infections

Patient group and infection	Capsular type (no. of cases)									Total
	Ia	Ib	II	III	IV	V	VI	VII	VIII
Children
Meningitis	3	5		39			3			50 (76.9)a
Sepsis	5	2	2	5						14 (21.5)
Other		1								1 (1.5)
Subtotal	8 (12.3)	8 (12.3)	2 (3.1)	44 (67.6)			3 (4.6)			65 (100)
Adults
Meningitis		1	1	2						4 (0.8)
Sepsis	9	31	12	6		20	6	1	8	93 (75.0)
Other	2	7	2	7		3	3		3	27 (21.8)
Subtotal	11 (8.9)	39 (31.5)	15 (12.1)	15 (12.1)		23 (18.5)	9 (7.3)	1 (0.8)	11 (8.9)	124 (100)

^aValues in parentheses are percentages.

Table 3 shows the MIC ranges and MICs for 50 and 90% of the strains tested (MIC₅₀, and MIC₉₀, respectively) of oral and intravenous antibiotics for GBS strains. The MIC range of β-lactam agents was narrow, and penicillin-resistant strains were not recognized. Notably, in a strain where cefotiam susceptibility was reduced to 2 μg/ml, four amino acid substitutions, Gly₃₉₈ to Ala, Gln₄₁₂ to Leu, His₄₃₈ to Tyr, and Ile₆₀₀ to Val, were identified in the pbp2x gene.

TABLE 3.

Susceptibilities of 189 S. agalactiae isolates to 14 antimicrobial agents

Delivery route and antibiotic	MIC rangea	MIC50a	MIC90a
Oral
Penicillin G	0.016-0.125	0.063	0.063
Ampicillin	0.031-0.25	0.125	0.125
Amoxicillin	0.031-0.25	0.063	0.125
Cefdinir	0.016-0.125	0.031	0.063
Cefditoren	0.016-0.063	0.031	0.031
Erythromycin	0.016-≥64	0.032	≥64
Clarithromycin	0.031-≥64	0.125	≥64
Clindamycin	0.031-≥64	0.063	≥64
Levofloxacin	0.5-≥64	2	≥64
Intravenous
Cefazolin	0.063-0.5	0.125	0.25
Cefotiam	0.125-2	0.5	0.5
Cefotaxime	0.016-0.125	0.031	0.063
Panipenem	0.008-0.031	0.016	0.031
Meropenem	0.031-0.125	0.063	0.063

^aValues are in micrograms per milliliter.

Table 4 shows relationships between ML and FQ resistance and capsular type, separately considering children and adults. Of 23 strains showing ML resistance (12.2%), 3 possessed the erm(A) gene and 20 possessed the erm(B) gene. The M type was not recognized. ML-resistant strains detected in both children and adults were mostly type III, but a few strains showed other capsular types.

TABLE 4.

Correlation of capsular types with FQ and ML resistance

Patient group and resistance pattern	No. of strains of serotype:									Total no. (%)
	Ia	Ib	II	III	IV	V	VI	VII	VIII
Children
FQr		6								6 (9.2)
MLr [erm(A)]				2						2 (3.1)
MLr [erm(B)]	1			6						7 (10.8)
Susceptible	7	2	2	36			3			50 (76.9)
Subtotal	8	8	2	44	0	0	3	0	0	65
Adults
FQr		32	1	1			1			35 (28.2)
FQr MLr [erm(A)]				1						1 (0.8)
FQr MLr [erm(B)]		2		1a						3 (2.4)
MLr [erm(B)]			1	4		4		1		10 (8.1)
Susceptible	11	5	13	8		19	8	0	11	75 (60.4)
Subtotal	11	39	15	15	0	23	9	1	11	124

^aThis strain showed three amino acid substitutions in PBP2X. The MICs of ampicillin and cefotiam for the strain were 0.25 and 2.0 μg/ml, respectively.

In 45 strains showing high levofloxacin resistance (23.8%), two amino acid substitutions, Ser₈₁ to Leu encoded by the gyrA gene and Ser₇₉ to Phe encoded by the parC gene, were identified simultaneously. The capsular type of these strains, including six isolated from children, was predominately Ib, which was observed in 34 strains; other types (II, III, and VI) were each seen in a few strains.

The PFGE patterns of 45 FQ-resistant strains are shown in Fig. 1. These strains included 40 strains of type Ib and 5 strains representing other types. All type Ib strains showed highly homologous restriction patterns that differed clearly from those of type II or III strains.

FIG. 1.

PFGE patterns of levofloxacin-resistant S. agalactiae isolates. Each DNA sample was digested with the ApaI restriction enzyme. Lanes M, lambda ladder.

In Japan, the proportion of the elderly population with underlying diseases has increased rapidly. As a consequence, invasive infections caused not only by GBS, but also S. dysgalactiae subsp. equisimilis and S. pneumoniae, are expected to increase gradually and to become serious problems (19, 20).

The capsular type in isolates from newborns was mostly type III, in agreement with previous results. In most cases involving adults at least 50 years old, however, type Ib was predominant, followed by type V. These findings differ from previous epidemiologic data from the United States; the reason for this disparity is not known.

The percentage of ML resistance was not particularly high compared with that in other countries. Much attention has been drawn to the emergence of GBS with reduced susceptibility to penicillin and cephalosporin antibiotics arising from mutations in the pbp2x gene (11). One of our collected strains had mutations of the pbp2x gene; this was a type III strain with multiple-antibiotic resistance to ML and FQ. FQ-resistant strains have been reported previously (10, 13, 22) but at extremely low rates. In our results, however, strains resistant only to FQ accounted for 23.8% of the isolates, and most of these were type Ib. FQ-resistant GBS from newborns, who had not been exposed to the agent, showed a PFGE pattern very similar to type Ib from adults. The observations suggest that a single clone acquired FQ resistance and spread rapidly throughout Japan.

Antimicrobial use in Japan favors oral cephalosporins as the drugs of first choice for children, while oral FQ and ML, as well as cephalosporins, are often prescribed for adults. Notably, the size of individual doses of antimicrobials typically is small in Japan compared with that in other countries. These factors will expand the mutant selection window for many pathogens, including GBS, and thus may cause an increase in resistant microorganisms.

To control the emergence of resistant organisms, continuous molecular epidemiologic surveillance for pathogens is needed.