Unusual Class 1 Integron-Associated Gene Cassette Configuration Found in IncA/C Plasmids from Salmonella enterica

Abstract

IncA/C plasmids carrying an unusual cassette configuration in a class 1 integron and five further shared resistance genes, aacC4, aphA1, hph, sul2, and tetA(D) were found in Salmonella enterica serovars Senftenberg and Ohio. A deletion formed using a short region of homology in the 5′ conserved segment and the orfF cassette created an array with only part of orfF followed by the aadA2 cassette. The IncA/C plasmids were not recoverable by conjugation, but additional conjugative resistance plasmids were present in some strains.

The ability of resistance genes carried on plasmids, particularly conjugative or mobilizable plasmids, to be transferred from a donor organism to a new recipient strain has received considerable attention because it provides an explanation for how resistance genes spread. However, plasmid spread, together with the diversity and ongoing evolution of resistance regions they carry, complicates the process of understanding the molecular epidemiology of resistance. Unusual features, such as uncommon cassette arrays in class 1 integrons, can serve as useful markers to identify potential plasmid relatives, and plasmid identification methods, such as incompatibility group determination (1), can further assist this process.

We have screened a large collection of multiply antibiotic-resistant Salmonella enterica strains of different serovars isolated in Australia in 1999, 2000, or 2001 from humans, cattle, pigs, chickens, and other animals for the presence of class 1 integrons. The strains were supplied by D. Lightfoot from the collection of the Microbiological Diagnostic Unit at the University of Melbourne, and part of our collection has been described previously (12). Strains were screened for the presence of a class 1 integron by using PCR to detect the 5′ conserved segment (5′-CS) and the sul1 gene which is normally found in the 3′-CS of class 1 integrons. The primers used, shown in Fig. 1A, and PCR conditions have been described elsewhere (13). All strains that scored positive for the 5′-CS were screened for the presence of gene cassettes by using L1/R1 primers (Fig. 1A). In the course of this work, we have previously identified a number of novel cassette arrays (10, 11, 13), one of which was found only in strains from a single serovar and hence was diagnostic for a group of resistant strains in the serovar (11).

FIG. 1.

(A)Schematic diagram depicting a typical class 1 integron and showing the positions of the primers used. (B) Schematic diagram depicting class 1 integrons containing the dfrA12-orfF-aadA2 and the ΔorfF-aadA2 cassette arrays. The deletion event that generates the ΔorfF-aadA2 cassette array is indicated. Bent arrows depict the locations of the L1 and R1 primers used for PCR amplification. (C) Alignment of sequences from GenBank entry AF284063 in the 5′-CS upstream of intI1 (nucleotides 112 to 171) and orfF (nucleotides 937 to 996) with sequences of the class 1 integron in SRC119 and SRC22. A region of 9 nucleotides common to the 5′-CS and orfF at the deletion boundaries is boxed. Double dots show positions of identity between sequences. The arrow indicates the position of the L1 priming site.

Here, we have identified a further group of strains, all isolated from pigs and belonging to Salmonella enterica serovars Senftenberg and Ohio (Table 1) that share a novel cassette configuration. These strains yielded an unusual 1.1-kb cassette amplicon which, when digested with RsaI as described elsewhere (12), yielded the same fragments in all cases. The sequences of this product from strains SRC119 and SRC22 were determined and were identical. The amplicon contained the aadA2 cassette and part of the orfF cassette but, apart from the L1 primer region, did not contain the expected 95 bp from the 5′-CS. The sequence of the longer L2-R1 PCR amplicon (Fig. 1A), sequenced from all seven strains, revealed that the configuration present in these strains was derived from a class 1 integron carrying the dfrA12-orfF-aadA2 cassette array (see reference 6 for details of sequences of this cassette array). The deletion (Fig. 1B) appears to have arisen utilizing a short region of 9 bp that is present in both the orfF cassette and in the 5′-CS upstream of the intI1 gene (Fig. 1C), and the L1 priming site overlaps this segment. The deletion removes the attI1 site (18), presumably rendering the integron unable to incorporate further cassettes (3, 5). The deleted segment also contains the upstream ribosome binding site and coding region for a short peptide (orf11). Translation of orf11 has been shown to substantially increase the expression of cassette-encoded genes (7), but streptomycin and spectinomycin resistance were both detected, indicating that the aadA2 gene is expressed. The sequence includes the strong version of the Pc promoter (4).

TABLE 1.

Properties of S. enterica strains carrying the ΔorfF-aadA2 cassette configuration

Strain	Isolation date (day/mo/yr)	Serovar	Resistance profilea	intI1	sul1	Shared resistance genesb	Other geneb	Plasmid Inc groups
SRC22	10/02/1999	Ohio	Gm Km Nm Sm Sp Su Tc	+	+	aacC4, aphA1, hph, sul2, tetA(D)	tetA(C)	A/C
SRC74	29/10/2001	Ohio	Ap Gm Km Nm Sm Sp Su Tc	+	+	aacC4, aphA1, hph, sul2, tetA(D)	blaTEM	A/C
SRC69	06/02/2001	Senftenberg	Ap Gm Km Nm Sm Sp Su Tc	+	−	aacC4, aphA1, hph, sul2, tetA(D)	blaTEM	A/C + I1
SRC91	12/10/2000	Senftenberg	Gm Km Nm Sm Sp Su Tc	+	−	aacC4, aphA1, hph, sul2, tetA(D)		A/C + I1
SRC102	09/01/2000	Senftenberg	Ap Gm Km Nm Sm Sp Su Tc	+	+	aacC4, aphA1, hph, sul2, tetA(D)	blaTEM	A/C
SRC103	10/04/2000	Senftenberg	Ap Gm Km Nm Sm Sp Su Tc	+	+	aacC4, aphA1, hph, sul2, tetA(D)	blaTEM	A/C + I1
SRC119	11/04/2000	Senftenberg	Ap Gm Km Nm Sm Sp Su Tc	+	+	aacC4, aphA1, hph, sul2, tetA(D)	blaTEM	A/C + I1

^aAp, ampicillin; Gm, gentamicin; Km, kanamycin; Nm, neomycin; Sm, streptomycin; Sp, spectinomycin; Su sulfonamides; Tc, tetracycline.

^bResistance genes were detected using PCR assays. The aacC4 gene confers resistance to apramycin; the hph gene confers resistance to hygromycin.

Searches of the GenBank nonredundant nucleic acid database (February 2009) identified no entries that contained the same cassette configuration. As recombination utilizing very short regions of homology occurs only rarely, it seemed unlikely that this deletion would have occurred on more than one occasion. We therefore examined the strains for the presence of a common plasmid. An IncA/C plasmid was detected in all strains by using diagnostic PCR assays (1), but an IncI1 plasmid was additionally present in four of them (Table 1). The sequence of the 465-bp IncA/C product from SRC119 was identical to the sequence with GenBank accession no. CP000604 (19). The strains exhibit similar antibiotic resistance profiles, and a number of additional resistance genes were detected in all strains by using the multiplexes for tetA genes (15) or primer pair conditions described previously (13). Further shared genes were aphA1, conferring resistance to kanamycin and neomycin; tetA(D), conferring resistance to tetracycline; and an additional sulfonamide resistance gene, sul2. Gentamicin resistance was traced to an aacC4 gene (GenBank accession no. X01385) by using primers RH554 (TCGGTCAGCTTCTCAACCTT) and RH555 (ACCGACTGGACCTTCCTTCT), and an hph gene conferring resistance to hygromycin was identified adjacent to it. All strains contained the aacC4 gene, and they were shown to be resistant to apramycin, netilmicin, and tobramycin, as expected for this gene. These findings are consistent with the presence of a shared IncA/C plasmid and, possibly, some further plasmids that are not shared.

Conjugation into an Escherichia coli strain and selection for resistance to each of the relevant antibiotics recovered a number of plasmids (Table 2), but the IncA/C plasmid was not detected. However, a set of 13 PCRs distributed around the IncA/C plasmid backbone and covering part of each of the three transfer regions (19) were positive in all strains, indicating that the transfer regions are likely to be present. An IncA/C plasmid that conferred resistance to a common set of antibiotics (gentamicin, kanamycin, neomycin, streptomycin, spectinomycin, sulfonamides, and tetracycline) was recovered from one Salmonella serovar Ohio strain (SRC22) and two Salmonella serovar Senftenberg strains (SRC103 and SRC119) by transformation. These transformants carried a class 1 integron and generated the 1.1-kb L1-R1 amplicon characteristic of the unusual cassette array and also carry the common set of antibiotic resistance genes aacC4, aphA1, hph, sul1, sul2, and tetA(D).

TABLE 2.

Plasmids recovered by conjugation from multiply antibiotic-resistant Salmonella enterica

Strain	Resistance profilea	Resistance gene(s)	Plasmid Inc groupb
SRC22	Tc	tetA(C)	−
SRC74	Ap Gm Km Nm	blaTEM, aacC4, hph, aphA1	−
SRC69	Ap Gm	blaTEM, aacC4, hph	I1
SRC103	Ap Gm	blaTEM, aacC4, hph	I1
SRC119	Ap	blaTEM	I1

^aAp, ampicillin, Gm, gentamicin, Km, kanamycin, Nm, neomycin, Tc, tetracycline.

^bInc groups were determined using multiplex PCR; −, unknown type.

IncA/C plasmids play an important role in the dissemination of antibiotic resistance genes. They have a broad host range, having been recovered from many species, including Klebsiella pneumoniae (2, 17), Enterobacter cloacae (2), Salmonella serovar Newport, Yersinia pestis and Yersinia ruckeri (19), Vibrio cholerae (16), Aeromonas salmonicida (14), and Photobacterium damselae (9), and are usually found to be conjugation proficient. IncA/C plasmids carrying the bla_CMY-2 gene have also been found in various Salmonella serovars, but only a few of them were capable of self transfer (8).

Nucleotide sequence accession number.

The sequence of the ΔorfF-aadA2 cassette configuration from SRC119 has been deposited in GenBank under accession no. EU934512.