Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jun 8.
Published in final edited form as: J Neurochem. 2008 Sep 6;107(3):855–870. doi: 10.1111/j.1471-4159.2008.05658.x

Protease-activated receptor dependent and independent signaling by kallikreins 1 and 6 in CNS neuron and astroglial cell lines

Alexander G Vandell *, Nadya Larson †, Gurunathan Laxmikanthan ‡, Michael Panos §, Sachiko I Blaber ‡, Michael Blaber ‡, Isobel A Scarisbrick *,†,§
PMCID: PMC2692621  NIHMSID: NIHMS87416  PMID: 18778305

Abstract

While protease-activated receptors (PARs) are known to mediate signaling events in CNS, contributing both to normal function and pathogenesis, the endogenous activators of CNS PARs are poorly characterized. In this study, we test the hypothesis that kallikreins (KLKs) represent an important pool of endogenous activators of CNS PARs. Specifically, KLK1 and KLK6 were examined for their ability to evoke intracellular Ca2+ flux in a PAR-dependent fashion in NSC34 neurons and Neu7 astrocytes. Both KLKs were also examined for their ability to activate mitogen-activated protein kinases (extracellular signal-regulated kinases, C-Jun N-terminal kinases, and p38) and protein kinase B (AKT) intracellular signaling cascades. Cumulatively, these studies show that KLK6, but not KLK1, signals through PARs. KLK6 evoked intracellular Ca2+ flux was mediated by PAR1 in neurons and both PAR1 and PAR2 in astrocytes. Importantly, both KLK1 and KLK6 altered the activation state of mitogen-activated protein kinases and AKT, suggestive of important roles for each in CNS neuron and glial differentiation, and survival. The cellular specificity of CNS–KLK activity was underscored by observations that both proteases promoted AKT activation in astrocytes, but inhibited such signaling in neurons. PAR1 and bradykinin receptor inhibitors were used to demonstrate that KLK1-mediated activation of extracellular signal-regulated kinases in neurons occurred in a non-PAR, bradykinin 2 (B2) receptor-dependent fashion, while similar signaling by KLK6 was mediated by the combined activation of PAR1 and B2. Cumulatively results indicate KLK6, but not KLK1 is an activator of CNS PARs, and that both KLKs are poised to signal in a B2 receptor-dependent fashion to regulate multiple signal transduction pathways relevant to CNS physiologic function and dysfunction.

Keywords: astrocyte, bradykinin, mitogen-activated protein kinase, neuron, protease-activated receptor, protein kinase B


The kallikreins (KLKs) comprise a family of 15 secreted serine proteases whose genes are localized in tandem on chromosome 19q13.4. While best characterized in terms of their utility as serum biomarkers in steroid hormone related cancers, emerging evidence links altered tissue, sera, or CSF levels to neurological disorders including Alzheimer’s (Little et al. 1997; Zarghooni et al. 2002), multiple sclerosis (MS) (Scarisbrick et al. 2002; Blaber et al. 2004; Scarisbrick et al. 2008), stroke (Uchida et al. 2004), and trauma (Terayama et al. 2004; Scarisbrick et al. 2006b). The physiological actions of KLKs are only beginning to be understood, but roles for other serine proteases and/or their endogenous inhibitors in CNS are known to include neuron migration (Seeds et al. 1990), neurite outgrowth (Monard 1988; Siconolfi and Seeds 2001; Smirnova et al. 2001), synaptic plasticity (Liu et al. 1994), neurogenic pain (Vergnolle et al. 2001), and neurodegeneration (Tsirka et al. 1997). We have become particularly interested in determining the CNS specific roles of two KLKs, KLK1 and KLK6, as these are expressed at moderate to high levels in normal human brain, are elevated in CNS and serum of MS patients, and each has been shown to cause profound loss of neurites and degeneration of cortical neurons in vitro (Scarisbrick et al. 2002, 2008).

Kallikrein 6 is the most abundant KLK in CNS with highest levels of expression in brainstem and spinal cord (Scarisbrick et al. 1997, 2001, 2006a). In normal CNS, KLK6 is primarily associated with neurons and oligodendrocytes (Scarisbrick et al. 2000), however in response to injury or disease, KLK6 is additionally expressed by reactive astrocytes and microglia/macrophages (Scarisbrick et al. 2000, 2002, 2006b). Despite the fact that KLK6 is one of the most highly expressed serine proteases in adult CNS, with predicted broad substrate specificity (Scarisbrick et al. 1997), that includes hydrolysis of extracellular matrix and myelin proteins (Bernett et al. 2002; Blaber et al. 2002; Scarisbrick et al. 2002), relatively little is known regarding its physiologic activities.

Kallikrein 1 is moderately expressed in CNS (Raidoo et al. 1996; Scarisbrick et al. 2006a) and like other KLKs its CNS specific activities are poorly characterized. KLK1 cleaves an array of peptide precursors, including insulin (Ole-MoiYoi et al. 1979), and apolipoprotein B-100 (Cardin et al. 1984). KLK1 is perhaps best characterized by its ability to cleave low molecular weight kininogen to release Lysbradykinin which binds to G protein linked bradykinin receptor 2 (B2). KLK1 is implicated in regulation of blood pressure, sodium and water homeostasis, tumor growth, and inflammatory events (Bhoola et al. 2001). Interestingly, delivery of exogenous KLK1 in rodent models of ischemia improves neurologic function, limits inflammation and suppresses oxidative stress to enhance survival of neurons and glia in a B2 receptor-dependent fashion (Xia et al. 2004).

Recent evidence indicates certain KLKs, including KLK6, mediate their physiologic effects in part by activation of protease-activated receptors (PARs). Four G protein linked PARs have been described (PAR1–4) which are activated by N-terminal hydrolysis exposing a tethered ligand that binds intramolecularly triggering signal transduction. PARs are best characterized in terms of thrombin which activates PAR1, -3, and -4, and trypsin which can activate all four (Steinhoff et al. 2005). KLK5, KLK6, and KLK14 were recently shown to mobilize Ca2+ in rat v-K-ras transformed Normal Rat Kidney PAR2 over-expressing cells and to mediate aortic ring relaxation, in a PAR2-dependent fashion. KLK14 was additionally shown to activate PAR1, triggering Ca2+ flux in human embryonic kidney cells, and PAR4, to promote aggregation of rat platelets (Oikonomopoulou et al. 2006a,b).

While the activity of PAR is best characterized in the hemostatic and blood coagulation systems, these receptors are also widespread in CNS neurons and glia (Weinstein et al. 1995; Striggow et al. 2000; Wang et al. 2002a; Junge et al. 2004; Bushell et al. 2006). Proposed roles for CNS PARs include those related to normal brain function such as potentiation of NMDA receptors (Gingrich et al. 2000), as well as pathogenic mechanisms associated with ischemia (Striggow et al. 2000; Junge et al. 2003), neurodegeneration (Smith-Swintosky et al. 1997), astrogliosis (Wang et al. 2002b; Sorensen et al. 2003; Nicole et al. 2005), hyperalgesia (Vergnolle et al. 2001), and neurogenic inflammation (Steinhoff et al. 2000). Despite these reports the endogenous activators of PARs in CNS have not been clearly identified. We hypothesize select tissue KLKs represent endogenous activators of CNS PARs. In this study, we determine the ability of two KLKs, KLK1 and KLK6, to mobilize intracellular Ca2+ in a PAR-dependent fashion in CNS derived neuron and astroglial cell lines and determine whether downstream signaling cascades related to cell differentiation and survival are activated.

Materials and methods

Cell culture

The NSC34 neuron and Neu7 astrocyte cell lines were used to determine the potential signaling activities elicited by KLK1 and KLK6 in CNS. NSC34 neurons are a murine spinal motor neuron hybridoma cell line which exhibits properties similar to motor neurons, including neurite extension, generation of action potentials, and acetylcholine production (Eggett et al. 2000; Scarisbrick et al. 2006b). Neu7 astrocytes are a murine cortical astrocyte cell line created by retroviral immortalization. Mirroring glial scar properties in vivo, Neu7 astrocytes produce an extracellular matrix which is inhibitory to neurite outgrowth (Fok-Seang et al. 1995).

NSC34 neurons were grown in high glucose Dulbecco’s modified Eagle’s medium, 10% fetal calf serum, 50 U/mL penicillin–streptomycin, and 2 mM Glutamax for expansion. NSC34 neurons were then differentiated for 48 h on surfaces coated with 10 µg/mL laminin under serum-free conditions. We have previously shown that growth in Neurobasal A media with 2% B27 supplement, 50 U/mL penicillin-streptomycin, 2 mM Glutamax, and 0.45% glucose (Sigma, St. Louis, MO, USA) promotes differentiation of NSC34 neurons and extensive neurite outgrowth (Scarisbrick et al. 2006b).

Neu7 astrocytes were adapted for growth under defined serum-free conditions (Neurobasal A with 2% B27 supplement, 1% N2 supplement, 50 U/mL penicillin-streptomycin, 0.45% glucose, 2 mM Glutamax, 1 mM sodium pyruvate, and 50 µM β-mercaptoethanol; Sigma). Neu7 astrocytes were grown on surfaces coated with 10 µg/mL poly-d-lysine (Sigma). All cells were maintained at 37°C in 95% air and 5% CO2. All cell culture reagents were obtained from Invitrogen (Carlsbad, CA, USA) unless otherwise indicated.

Primary cortical neurons and astrocytes were isolated from embryonic day 15 or postnatal day 1 C57/BL6J mice (Jackson Laboratories, Bar Harbor, ME, USA), essentially as described previously (McLaughlin et al. 1998). Primary neurons and astrocytes were differentiated for 96 h as described above for their cell line counterparts. All procedures were approved by the Mayo Clinic Institutional Animal Care and Use Committee.

RNA isolation and quantitative PCR

Total RNA was isolated from differentiated cells and from whole adult mouse brain or spinal cord using RNA STAT-60 (Tel-Test Inc., Friendswood, TX, USA). The level of PAR1–4 mRNA expression in each case was determined in 0.5 µg of RNA using Light Cycler RNA Amplification SYBR Green I (Roche, Basel, Switzerland) and either a Light Cycler (Roche) or iCycler iQ5 system (BioRad, Hercules, CA, USA). mRNA copy number in each case was determined using a standard curve prepared by parallel amplification of cDNA clones diluted to a known copy number as previously described in detail (Christophi et al. 2004). Primers used for amplification are provided in Table 1. Amplification of the housekeeping gene glyceraldehyde phosphate 3-dehydrogenase was used as a loading control. The mean and SE of PAR1–4 copy number was determined using three samples from independent cultures.

Table 1.

Primers used for quantitative PCR (5′–3′)

Gene Accession
number
Sequence
PAR1 (f) NM_010169.3 CTTGCTGATCGTCGCCC
PAR1 (r) TTCACCGTAGCATCTGTCCT
PAR2 (f) NM_007974.3 CCGGACCGAGAACCTTG
PAR2 (r) CGGAAGAAAGACAGTGGTCAG
PAR3 (f) NM_010170.3 TCCACACACCTTCACACCGA
PAR3 (r) GAACGGGCCTTTAACGACTT
PAR4 (f) NM_007975.3 CCCAGCATCTAGGATGATGTAGAG
PAR4 (r) CAGCGTGTCACTGTCGTT
GAPDH (f) NM_008084.2 ACCACCATGGAGAAGGC
GAPDH (r) GGCATGGACTGTGGTCATGA

GAPDH, glyceraldehyde phosphate 3-dehydrogenase; PAR, protease-activated receptor. Forward (f) and reverse (r) primers were used to amplify murine PAR isoforms and GAPDH.

Ratiometric calcium imaging

Differentiated NSC34 neurons or Neu7 astrocytes were grown on coated chambered cover glass (Lab-Tek II #1.5; Nalge Nunc International, Rochester, NY, USA) at a density of 25 or 50 × 103 cells per cm2, respectively. The cells were rinsed with imaging media (0.137 M NaCl, 5 mM KCl, 5.6 mM glucose, 20 mM HEPES, 0.59 mM KH2PO4, 0.014 mM CaCl2, 0.009 mM MgSO4, and 10 mM NaHCO3, pH 7.4) (Sigma), loaded with fura-2AM (0.05 mM) (Invitrogen) in imaging media for 1 h at 20°C then washed with the same media. Cells were imaged using a Zeiss Axiovert (Carl Zeiss, Inc., Thornwood. NY, USA) inverted microscope, a 40× oil immersion lens, and the Attofluor RatioVision System (Atto Bioscience, Rockville, MD, USA).

For ratiometric imaging, cells were alternately excited at 340 and 380 nm and emission collected between 470 and 550 nm. Changes in the F340/F380 nm fluorescence ratio were determined from selected regions encompassing the cytoplasm of a single cell; 10–20 cells were imaged per well, and 30–60 cells were quantified per condition. Each experiment was repeated at least three times and five representative traces are shown. Cells were imaged initially for 2 min to establish a baseline F340/F380 nm ratio. Agonists were then added and changes in the fluorescence ratio monitored. For cross desensitization experiments, 4 min after application of the first agonist, a second agonist was added and changes in the fluorescence ratio monitored. Images were taken every 10 s for a period of 10 min. When quantification of Ca2+ responses was performed the data were normalized by subtraction of the baseline F340/F380 nm reading. Agonists used: 1 µM bradykinin, 1 U thrombin, 100 nM trypsin (Sigma), 40 µM PAR1-activating peptide (AP) (TFLLR-amide), 200 µM PAR2-AP (SLIGRL-amide), 200 µM PAR4-AP (GYPGFK-amide) (Peptides International, Louisville, KY, USA), 400 nM KLK1, and 400 nM KLK6. Recombinant active KLK1 and KLK6 were expressed using a baculovirus/insect system and purified as described previously (Bernett et al. 2002; Blaber et al. 2002; Laxmikanthan et al. 2005).

Western blots

Western blots were performed using standard methodology Briefly, membranes were blocked for 1 h at 20°C using either 2% bovine serum albumin or 5% milk. Following block, primary antibodies were applied at concentrations of 1 : 1000 overnight at 4°C. Primary antibodies used were phospho-extracellular signal-regulated kinases (ERK), ERK, phospho-C-Jun N-terminal kinases (JNK), JNK, phospho-p38, p38, phospho-protein kinase B (AKT), and AKT all from Cell Signaling Technology (Danvers, MA, USA). Membranes were washed and horseradish peroxidase-conjugated secondary antibody (Santa Cruz, Santa Cruz, CA, USA) applied at 1 : 25 000 for 1 h at 20°C. Membranes were then washed and Supersignal Pico (Pierce, Rockford, IL, USA) added for detection. Westerns were repeated three times, scanned, quantified by densitometry using NIH ImageJ (Bethesda, MD, USA), and finally normalized to the non-phosphorylated form of each protein. All density measurements are expressed as a percent of the maximal response observed.

To determine the dependence of KLK1 and KLK6 signaling on PAR1 or B2 receptors, NSC34 neurons were pre-treated for 30 min with either the PAR1 antagonist SCH79797 (70 nM; Tocris, Ellisville, MO, USA), the B2 antagonist Icatibant (1 µM; Sigma), or vehicle alone. Cells were then exposed to KLK1 or KLK6 for 5 min, as described above, and ERK activation examined by western. The significance of changes in activation of signaling proteins was evaluated using unpaired Student’s t-test.

Results

Functionally active PAR1 and PAR2 expression in NSC34 neurons and Neu7 astrocytes

An essential aspect of these studies was to determine the complement of PAR expressed by CNS neurons and astrocytes and whether these were functional. Importantly, PAR expression in NSC34 neurons and Neu7 astrocytes closely mirrored expression levels observed in primary cortical neurons and astrocytes isolated from the developing brain of C57/BL6J mice and allowed to mature in culture (Fig. 1). PAR1, also known as the thrombin receptor, was by far the most abundant PAR in both neurons and astrocytes. Significant levels of PAR2 were detected in astrocytes, but only very low levels were detectable in neurons. PAR3 and PAR4 were also detected in both cell types, but at low levels relative to PAR1. In parallel, the thrombin receptor was by far the most abundant PAR in adult murine brain and spinal cord while the other PARs were expressed at levels at least 10-fold lower. These results point to the potential for all 4 of the known PARs to participate in signaling in CNS but indicate the likely predominant role played by PAR1.

Fig. 1.

Fig. 1

PAR expression in the murine CNS and CNS derived cells. Quantitative PCR showing relative mRNA expression of PAR1–4 in NSC34 neurons (a), Neu7 as-trocytes (b), primary cortical neurons (c), primary cortical astrocytes (d), adult mouse brain (e), and adult mouse spinal cord (f).

Ratiometric Ca2+ imaging was used to determine whether PARs observed in the neuron and astrocyte cell lines by quantitative PCR were present in sufficient quantity to produce a Ca2+ signal in response to stimulation with specific peptides that mimic the PARs tethered ligand. In NSC34 neurons, while PAR1-AP (40 µM) produced a Ca2+ signal (Fig. 2a), both PAR2-AP (200 µM) (Fig. 2c) and PAR4-AP (200 µM) (Fig. 2e) were unable to elicit a similar robust response even at concentrations up to 500 µM. In Neu7 astrocytes, both PAR1-AP (40 µM) (Fig. 2b) and PAR2-AP (200 µM) (Fig. 2d), but not PAR4-AP (200–500 µM) (Fig. 2f) elicited a robust Ca2+ response.

Fig. 2.

Fig. 2

Presence of functional PARs on NSC34 neurons and Neu7 astrocytes. Representative traces from five cells show Ca2+ responses measured by changes in the fluorescence ratio (F340/F380 nm) of fura-2 loaded NSC34 neurons (a, c, and e) or Neu7 astrocytes (b, d, and f). Arrows indicate the time of agonist application. (a) NSC34 neurons treated with PAR1-AP (40 µM) (n = 30); (b) Neu7 astrocytes treated with PAR1-AP (40 µM) (n = 30); (c) NSC34 neurons treated with PAR2-AP (200 µM) (n = 30); (d) Neu7 astrocytes treated with PAR2-AP (200 µM) (n = 30); (e) NSC34 neurons treated with PAR4-AP (200 µM) (n = 30); (f) Neu7 astrocytes treated with PAR4-AP (200 µM) (n = 30); n indicates total number of cells quantified.

KLK6 evokes Ca2+ signaling in NSC34 neurons and Neu7 astrocytes

Ratiometric calcium imaging was used to monitor changes in intracellular Ca2+ in response to KLK treatment. The normal level of KLK6 expressed in human CSF is approximately 40 nM (Zarghooni et al. 2002) which is likely representative of levels in brain overall. Cells were treated with doses of KLK6 at physiologic concentration as well as a 10-fold above (400 nM) and below (4 nM). Forty-four percent of NSC34 neurons responded at the 400 nM concentration while no response was observed at 40 or 4 nM under the assay conditions used. When Neu7 astrocytes were treated with identical concentrations of KLK6, 92% of the cells responded at 400 nM, and 86% at 40 nM, but no response was observed at the lowest concentrations examined, 4 nM. As the 400 nM concentration of KLK6 produced the most robust response in both cell types (Fig. 3c and d), 400 nM KLK6 was used in all subsequent experiments. KLK1 did not evoke a Ca2+ signal in either cell type when applied at similar concentrations (Fig. 3a and b).

Fig. 3.

Fig. 3

KLK6, but not KLK1, induces Ca2+ signaling in NSC34 neurons and Neu7 as-trocytes. Traces show Ca2+ responses measured by changes in the fluorescence ratio (F340/F380 nm) of fura-2 loaded NSC34 neurons (a and c) or Neu7 astrocytes (b and d). Representative traces from five cells are shown. Arrows indicate the time of addition of agonist. (a) NSC34 neurons (n = 30) or (b) Neu7 astrocytes exposed to KLK1 (400 nM) (n = 30); (c) NSC34 neurons (n = 30) or (d) Neu7 astrocytes exposed to KLK6 (400 nM) (n = 30); n indicates total number of cells quantified.

KLK6 activates PAR1 on both NSC34 neurons and Neu7 astrocytes

To determine the ability of KLK6 to activate PAR1 in neurons, ratiometric Ca2+ imaging and a series of cross desensitization experiments were performed using KLK6, PAR1-AP, and the NSC34 neuron cell line. Initial treatment of NSC34 neurons with KLK6 (400 nM) generated a robust but transient Ca2+ response and this reduced subsequent PAR1-AP (40 µM) induced Ca2+ responses by 81.29 ± 9.53% (Fig. 4a). Initial treatment with PAR1-AP (40 µM) also generated a robust Ca2+ response and this abolished subsequent KLK6 (400 nM) evoked Ca2+ responses (Fig. 4b). A second PAR1 agonist, thrombin, was used to verify findings with PAR1-AP. Initial treatment with KLK6 (400 nM) evoked a transient Ca2+ response which reduced subsequent thrombin (1 U) induced Ca2+ signaling by 68.7 ± 18.1% (Fig. 4c). Initial exposure of NSC34 neurons to thrombin generated the expected transient Ca2+ peak and this abolished subsequent KLK6 (400 nM) Ca2+ mobilization (90.6 ± 4.65% reduction) (Fig. 4d). To determine if KLK1 could disarm PAR1, KLK1 was applied to NSC34 neurons followed by addition of either PAR1-AP or thrombin. In neither case did KLK1 treatment alter the subsequent Ca2+ response (data not shown).

Fig. 4.

Fig. 4

KLK6 Ca2+ signaling is mediated by PAR1 in NSC34 neurons. Traces show Ca2+ responses in fura-2 loaded NSC34 neurons in response to PAR cross desen-sitization. Changes in the fluorescence ratio (F340/F380 nm) are shown from five representative cells. Arrows indicate the time of agonist application. (a) NSC34 neurons treated initially with KLK6 (400 nM) were desensitized to subsequent PAR1-AP (40 µM) exposure (n = 40); (b) NSC34 neurons initially exposed to PAR1-AP (40 µM) were desensitized to subsequent exposure to KLK6 (400 nM) (n = 40); (c) NSC34 neurons exposed initially to KLK6 (400 nM) showed a reduced signal to subsequent thrombin exposure (1 U) (n = 40); (d) NSC34 neurons exposed initially to thrombin (1 U) were desensitized to subsequent exposure to KLK6 (400 nM) (n = 40); n indicates total number of cells quantified.

To determine whether KLK6 activates PAR1 in astrocytes, additional cross desensitization experiments were performed using the Neu7 astrocyte cell line. Similar to results observed in NSC34 neurons, in Neu7 astrocytes initial exposure to KLK6 (400 nM) generated a robust and transient Ca2+ spike and KLK6 abolished subsequent Ca2+ flux in response to PAR1-AP (40 µM) (90.7 ± 3.66% reduction) (Fig. 5a). KLK6 pre-treatment only partially reduced subsequent thrombin (1 U) (Fig. 5c) induced Ca2+ signaling (66.9 ± 16.9% reduction). By contrast to NSC34 neurons, exposure to thrombin (1 U) induced a strong transient Ca2+ spike which reduced but did not abolish subsequent KLK6 (400 nM) Ca2+ signaling (82.9 ± 16.0% reduction) (Fig. 5d). Similarly, exposure of Neu7 astrocytes to PAR1-AP (40 µM) only partially reduced KLK6 (400 nM) mediated Ca2+ flux (56.0 ± 11.9% reduction) (Fig. 5b). The ability of thrombin to desensitize KLK6 signaling in astrocytes was shown to be dose dependent (Fig. S1a).

Fig. 5.

Fig. 5

KLK6 Ca2+ signaling in Neu7 astrocytes can be mediated by PAR1. Traces show Ca2+ responses in fura-2 loaded Neu7 astrocytes in response to PAR cross desensitization. Changes in the fluorescence ratio (F340/F380 nm) are shown from five representative cells. Arrows indicate the time of agonist application. (a) Neu7 astrocytes initially exposed to KLK6 (400 nM) were desensitized to subsequent PAR1-AP (40 µM) exposure (n = 60); (b) Neu7 astrocytes initially exposed to PAR1-AP (40 µM) were partially desensitized to subsequent treatment with KLK6 (400 nM) (n = 60); (c) Neu7 astrocytes initially exposed to KLK6 (400 nM) were partially desensitized to subsequent thrombin (1 U) exposure (n = 40); (d) Neu7 astrocytes exposed to thrombin (1 U) were partially desensitized to subsequent KLK6 (400 nM) exposure (n = 40); n indicates total number of cells quantified.

KLK6 activates PAR2 on Neu7 astrocytes

To determine whether KLK6 additionally activates PAR2 in Neu7 astrocytes, cross desensitization experiments using KLK6 and PAR2-AP were performed. Exposure of Neu7 astrocytes to KLK6 (400 nM) induced the expected robust yet transient Ca2+ spike and KLK6 reduced subsequent PAR2-AP (200 µM) induced Ca2+ signaling by 56.7 ± 13.7% (Fig. 6a). The desensitization of PAR2-AP by KLK6 was not as pronounced as that observed with subsequent PAR1-AP or thrombin exposure. Initial exposure of Neu7 astrocytes to PAR2-AP (200 µM) generated the expected strong Ca2+ peak, but this treatment did not significantly alter the Ca2+ peak observed upon subsequent exposure to KLK6 (400 nM) (27.5 ± 38.1% increase) (Fig. 6b). To determine whether KLK6 simultaneously signals through PAR1 and PAR2, cross desensitization experiments were performed with prior exposure to trypsin, a serine protease known to activate both PAR1 and PAR2 (Steinhoff et al. 2005). Initial treatment with KLK6 (400 nM) reduced subsequent trypsin (100 nM) induced signaling (Fig. 6c) (88.1 ± 4.24% reduction), while initial treatment with trypsin (100 nM) abolished subsequent KLK6 (400 nM) induced signaling (87.5 ± 5.42% reduction) (Fig. 6d). Notably, trypsin was shown to desensitize KLK6 signaling in astrocytes in a dose-dependent fashion (Fig. S1b).

Fig. 6.

Fig. 6

KLK6 Ca2+ signaling in Neu7 astrocytes can be mediated by PAR2. Calcium responses observed in fura-2 loaded Neu7 astrocytes in response to receptor cross desensitization. Changes in the fluorescence ratio (F340/F380 nm) are shown for five representative cells in each case. Arrows indicate the time of agonist application. (a) Neu7 astrocytes initially exposed to KLK6 (400 nM) were partially desensitized to subsequent PAR2-AP (200 µM) exposure (n = 60); (b) Neu7 astrocytes initially exposed to PAR2-AP (200 µM) were not desensitized to subsequent KLK6 (400 nM) exposure (n = 60); (c) Neu7 astrocytes initially exposed to KLK6 (400 nM) were desensitized to subsequent trypsin (100 nM) exposure (n = 40); (d) Neu7 astrocytes exposed to trypsin (100 nM) were desensitized to subsequent exposure to KLK6 (400 nM) (n = 40); n indicates total number of cells quantified.

KLK6 differentially regulates MAPK and AKT signaling in NSC34 neurons

Activation of mitogen-activated protein kinase (MAPK) family members (ERK, JNK, and p38) and AKT in response to KLK1 or KLK6 exposure was examined over a period of 1 h. NSC34 neurons were treated with either KLK1 (200 nM), KLK6 (200 nM), or the PAR1- (40 µM) or PAR2-APs (200 µM) for 5, 10, 15, 30, or 60 min. In NSC34 neurons, ERK phosphorylation was strongly induced by KLK1 (Fig. 7a) at 5 min after exposure. Subsequently, activated ERK remained elevated gradually decreasing over time. Exposure of NSC34 neurons to KLK6 by contrast induced significant ERK activation at 5 min, followed by return to baseline at 10 min, and a second peak of ERK activation at the 15 min time point (Fig. 7b). PAR1-AP induced strong ERK phosphorylation at 5 min while the phosphorylated form of ERK at subsequent time points was detected at far below basal levels (Fig. 7c). Both the elevation above and the drop below basal phosphorylation of ERK in response to PAR1-AP treatment were statistically significant. KLK1 treatment induced a significant increase in JNK activation at both 5 and 30 min after exposure (Fig. 7d). By contrast, KLK6 and the PAR1-AP did not induce statistically significant changes in JNK phosphorylation in NSC34 neurons (Fig. 7e and f). Neither p38, nor its phosphorylated form, were detected at significant levels in NSC34 neurons (not shown).

Fig. 7.

Fig. 7

KLK1, KLK6, and PAR1-AP induced signaling in NSC34 neurons. Western blots for MAPK family members and AKT following exposure of NSC34 neurons to KLK1, KLK6, or PAR1-AP. ERK phosphorylation following exposure to (a) KLK1 (200 nM), (b) KLK6 (200 nM), or (c) PAR1-AP (40 µM). JNK phosphorylation following exposure to (d) KLK1 (200 nM), (e) KLK6 (200 nM), or (f) PAR1-AP (40 µM). AKT phosphorylation following exposure to (g) KLK1 (200 nM), (h) KLK6 (200 nM), or (i) PAR1-AP (40 µM); *p < 0.05.

Both KLK1 and KLK6 exposure resulted in significant decreases in AKT phosphorylation 10 min following exposure, with the effect of KLK6 being most pronounced and visible at both the 5 and 10 min time points (Fig. 7g and h). A transient increase in AKT phosphorylation 30 min after KLK6 exposure was observed in two of four replicates, but did not achieve statistical significance. PAR1-AP produced a noticeable but not statistically significant decrease in the active form of AKT (Fig. 7i). PAR2-AP did not alter any of the intracellular signaling pathways examined (data not shown). Quantification of KLK and PAR–AP induced intracellular signaling in neurons is shown in Fig. S2.

KLK1 and KLK6 activate MAPK and AKT signaling in Neu7 astrocytes

Parallel to studies in neurons, the ability of KLK1 (200 nM), KLK6 (200 nM), PAR1- (40 µM), and PAR2-APs (200 µM) to activate MAPK family members or AKT was also examined in Neu7 astrocytes. KLK1, KLK6, PAR1- and PAR2-AP all promoted rapid phosphorylation of ERK by 5 min after exposure (Fig. 8a–d). ERK activation in each case was sustained through the 60 min time point examined except in the case of PAR1-AP in which basal levels of phosphorylation were reached by 30 min post-exposure. Peak levels of ERK activation were reached at 15 min in the case of KLK1 and across the 10 and 15 min time points in the case of KLK6. While robust ERK activation was observed with both PAR1- and PAR2-APs, across the three replicates examined the magnitude of ERK activation was not sufficient to reach the level of statistical significance. The activated form of p38 was not detected in Neu7 astrocytes following treatment with either KLK1 or KLK6 (Fig. 8e and f). However, both PAR1- and PAR2-APs generated a robust and transient increase in p38 phosphorylation at 5 min after exposure (Fig. 8g and h). Phosphorylated JNK was not detected in Neu7 astrocytes following treatment with KLK1 or KLK6 and the PAR1- and PAR2-APs did not generate a consistent pattern of JNK phosphorylation across the three replicates examined (data not shown).

Fig. 8.

Fig. 8

KLK1, KLK6, and PAR1- and PAR2-AP induced signaling in Neu7 astrocytes. Western blots for MAPK family members and AKT following exposure of Neu7 astrocytes to KLK1, KLK6, PAR1-, or PAR2-APs. ERK phosphorylation following exposure to (a) KLK1 (200 nM), (b) KLK6 (200 nM), (c) PAR1-AP (40 µM), or (d) PAR2-AP (200 µM). p38 phosphorylation following exposure to (e) KLK1 (200 nM), (f) KLK6 (200 nM), (g) PAR1-AP (40 µM), or (h) PAR2-AP (200 µM). AKT phosphorylation following exposure to (i) KLK1 (200 nM), (j) KLK6 (200 nM), (k) PAR1-AP (40 µM), or (l) PAR2-AP (200 µM); *p < 0.05.

Exposure of Neu7 astrocytes to KLK1 resulted in robust activation of AKT by 5 and at 10 min following exposure and this response was sustained over the 60 min period examined (Fig. 8i). KLK6 exposure promoted AKT phos-phorylation at the 5 and 10 min time points examined, but then decreased to levels below baseline (Fig. 8j). While the trend was consistent across the three replicates examined, neither KLK1 nor KLK6-induced AKT phosphorylation was sufficiently robust to reach the level of statistical significance. In response to PAR1-AP a small but statistically significant decrease in AKT phosphorylation was observed (Fig. 8k). PAR2-AP treatment produced a robust and sustained decrease in AKT phosphorylation beginning at 10 min through the 60 min time point examined (Fig. 8l). Quantification of KLK and PAR–AP induced intracellular signaling in astrocytes is shown in Fig. S3.

Differential effects of KLK1 and KLK6 on PAR and bradykinin receptors

Exposure of neurons to the PAR1-specific inhibitor, SCH79797 (70 nM), resulted in a significant decrease in KLK6-induced ERK phosphorylation (Fig. 9b). By contrast, this inhibitor had no effect on KLK1-induced ERK activation (Fig. 9a). Pre-treatment of cells with the B2-specific inhibitor, Icatibant (1 µM), significantly reduced activation of ERK in response to both KLK1 and KLK6 (Fig. 9c and d).

Fig. 9.

Fig. 9

Differential inhibition of KLK1- and KLK6-mediated ERK activation by PAR1 and B2 receptor inhibitors. Western blots show the level of ERK phosphorylation in NSC34 neurons. Neurons were exposed to (a) KLK1 (200 nM), or (b) KLK6 (200 nM), in the presence or absence of the PAR1 antagonist SCH79797 (70 nM). In (c and d), neurons were exposed to KLK1 or KLK6, respectively, in the presence or absence of B2 antagonist Icatibant (1 µM); *p < 0.05.

To further investigate KLK6-B2-dependent signaling, the ability of a B2 agonist to induce Ca2+ signaling was investigated. Exposure of neurons to the B2 agonist brady-kinin (1 µM) resulted in a robust Ca2+ signal (Fig. 10a), while similar exposure of astrocytes did not generate a signal even at concentrations up to 100 µM (Fig. 10b). To determine the relative contributions of KLK6-PAR1 and KLK6-B2 activation to the Ca2+ spike observed NSC34 neurons were exposed to either the PAR1 antagonist SCH79797 or the B2 antagonist Icatibant for at least 5 min prior to KLK6 application. Prior exposure of neurons to the PAR1 antagonist significantly reduced but did not eliminate KLK6-induced calcium signaling. Prior exposure of neurons to the B2 antagonist also significantly reduced the ability of KLK6 to generate a Ca2+ spike and this reduction was significantly greater than that generated by blocking PAR1 (Student’s t-test, p < 0.05) (Fig. 10c–e).

Fig. 10.

Fig. 10

Inhibition of KLK6-mediated Ca2+ signaling by PAR1 and B2 receptor inhibitors. Traces show Ca2+ responses in fura-2 loaded cells. Changes in the fluorescence ratio (F340/F380 nm) are shown from five representative cells. Traces show the Ca2 response of NSC34 neurons (n = 30) (a) or Neu7 astrocytes (n = 30) (b) to bradykinin (1 µM). Traces show the Ca2 response of NSC34 cells to KLK6 in the presence of the PAR1 antagonist SCH79797 (n = 60) (c) or the B2 antagonist Icatibant (n = 60) (d). Panel (e) shows a graph of the mean and SE of the baseline subtracted fluorescence ratio (F340/F380 nm) of KLK6 response in NSC34 neurons; n indicates total number of cells quantified and *p < 0.05.

Discussion

Given the abundant expression of KLKs in CNS, and their deregulation with CNS injury and disease (Scarisbrick et al. 2006b), it has become essential to further clarify their potential scope of physiologic action. In this study we demonstrate KLK1 and KLK6 use both PAR and non-PAR-dependent mechanisms to activate multiple signal transduc-tion pathways in neurons and astrocytes. Critical to understanding the role of KLK6 in CNS, we demonstrate this novel protease functionally activates PAR2 and the classic thrombin receptor, PAR1. The fundamental importance of KLK6 as a signaling molecule in CNS is further underscored by data which indicate KLK6 is also capable of activating the B2 receptor. As expected KLK1 had similar B2 activating effects, but notably was unable to activate PARs. Taken with the demonstrated ability of both KLK1 and KLK6 to activate components of the MAPK and AKT signaling cascades in CNS derived cells, these studies point to novel KLK functions in regulation of signal transduction pathways likely critical to CNS physiologic function, including roles in cellular differentiation and survival.

Our understanding of PAR function comes in large part from studies regarding their roles in hemostasis and thrombosis. PAR1 activates cellular responses to thrombin, as well as coagulation factor Xa, plasmin, and protein C. PAR2 is activated by trypsin-like serine proteases, including trypsin, mast cell tryptase, and factors VIIa and Xa. PAR3 and PAR4 signal primarily in response to thrombin, with PAR4 also activated by cathepsin G (Steinhoff et al. 2005). In cases of CNS injury or disease several of these proteases are up regulated, or extravasate across a compromised blood–brain barrier, resulting in ectopic PAR activation (Citron et al. 2000; Riek-Burchardt et al. 2002). In relation to this, a wealth of experimental work points to the activity of thrombolytic proteases in CNS pathogenesis. In vivo, thrombin promotes disruption of the brain-endothelial barrier, brain edema, seizures, and ischemia (Lee et al. 1997; Striggow et al. 2000; Kitaoka et al. 2002). Also, high doses of thrombin are neurotoxic in vivo (Festoff 1992; Nishino et al. 1993; Xue and Del Bigio 2001; Hamill et al. 2007), and in vitro (Jalink and Moolenaar 1992; Jiang et al. 2002). Thrombin additionally promotes astrogliosis (Nishino et al. 1993; Nicole et al. 2005), and microglial activation (Suo et al. 2002; Choi et al. 2003).

While it is increasingly apparent that thrombolytic proteases contribute to aberrant PAR activation in CNS disease, the endogenous activators of CNS PARs, which likely contribute to ongoing neuromodulatory activities (Gingrich et al. 2000; Almonte et al. 2007), are far from clear. Data presented herein, taken with that in the literature, support the hypothesis that select KLKs are endogenous CNS PAR activators. First, 12 of 15 KLKs are known to be expressed in uninjured human brain (KLK1, 2, and 5–14) (Clements et al. 2001; Scarisbrick et al. 2006a). Of these, KLK1, 2, 5, 6, 8, and 10–14 have known or predicted trypsin-like specificity hydrolyzing substrates C-terminal to either Arg or Lys (Borgono et al. 2007; Yoon et al. 2007). Activation of PAR1, -2, and -4 occurs with cleavage C-terminal to Arg. Activation of PAR3 requires cleavage C-terminal to Lys (Steinhoff et al. 2005). Thus, 10 of the 12 KLKs present in CNS are in a position to activate PAR. By contrast, KLK3, 7, and 9 are predicted to have chymotrypsin-like specificity (Borgono et al. 2007), and therefore unlikely to cleave PARs.

Further supporting the concept that KLKs activate CNS PARs are recent studies by Oikonomopoulou et al. (2006a,b) demonstrating physiologic activation of PAR2 by KLK5, KLK6 and KLK14 in non-neuronal cells. Mass spectral analysis of KLK6 generated cleavage products indicated this enzyme was also able to activate PAR1 (Oikonomopoulou et al. 2006a), while a fluorescence resonance energy transfer based cleavage assay suggested KLK6 could activate PAR2, but not PAR1 (Angelo et al. 2006). Results herein are the first, in any cell type, to clearly demonstrate KLK6 functionally activates PAR1. The present findings taken with the demonstrated abundance of both KLK6 (Scarisbrick et al. 1997, 2006a) and PAR1 in CNS (Junge et al. 2004), underscores the likely importance of the KLK6-PAR1 axis in CNS function and perhaps dysfunction. KLK6 was additionally shown to mobilize Ca2+ in a PAR2-dependent fashion in astrocytes pointing to the pleiotropic nature of this enzyme and that PAR activation is an important mechanism of action in the KLK6 repertoire. Demonstrating the specificity of KLK–PAR interactions, functional activation of PAR4 by KLK6, or any PAR by KLK1, was absent or below the detection limit of our assay.

Functional KLK6 activation of both PAR1 and PAR2 in astrocytes, but only PAR1 in neurons, likely relates to the high levels of PAR2 in the former. These findings may also underlie the fact that 10-fold lower levels of KLK6 were needed to trigger Ca2+ responses in astrocytes compared with neurons. Both the level of available protease, as well as the full complement of cognate receptors is therefore an important feature shaping KLK–PAR physiologic responses. The ability of KLK6 to activate both PAR1- and PAR2-dependent mechanisms would allow for significant expansion of its signaling capacity and provides a clear mechanism by which this novel protease likely mediates its CNS physiological and pathophysiological effects. Even small changes in KLK6 activity therefore would be significantly amplified by coordinate changes in PAR1 and/or PAR2, which are known to occur with CNS injury (Citron et al. 2000; Striggow et al. 2000; Rohatgi et al. 2004) and disease (Choi et al. 1995; Boven et al. 2003; Noorbakhsh et al. 2006; Afkhami-Goli et al. 2007). Notably, robust elevations in KLK6 levels have been demonstrated in MS, stroke, and spinal cord injury (Scarisbrick et al. 2002; Uchida et al. 2004; Scarisbrick et al. 2006b, 2008). Moreover, like thrombolytic enzymes, KLK6 is found at high levels in human serum, and may therefore enter the CNS with blood–brain barrier breakdown to participate in aberrant, likely pathogenic, PAR activation. Given that both KLK5 and KLK14 are also expressed in CNS (Scarisbrick et al. 2006b), and serum (Borgono and Diamandis 2004), and activate PARs (Oikonomopoulou et al. 2006a,b), findings herein point to PARs as an important site of integration of multiple KLK signaling cascades.

Cumulatively, the inability of the PAR1 inhibitor SCH79797 to block KLK1-induced ERK activation, taken with the inability of KLK1 to promote a Ca2+ response, indicate it is very unlikely that KLK1 activates PAR1. Rather than being PAR dependent, KLK1 signaling in CNS is likely to occur in a partially B2-dependent fashion, as the B2 inhibitor Icatibant strongly inhibited KLK1-induced ERK activation. This later result is not unexpected as KLK1 is best characterized by its kininogenase activity resulting in activation of B2. Like PARs, B2 receptors are constitutively expressed in a wide variety of tissues including CNS and are G protein-linked evoking Ca2+ responses and signaling cascades in numerous cell types (Bhoola et al. 2001). The ability of a B2 agonist but the inability of KLK1 to evoke Ca2+ signaling herein likely reflects the lack of kininogens in the Ca2+ imaging buffer. These results also suggest there is insufficient kininogen for KLK1 cleavage secreted into the media or on the surface of cells under the Ca2+ imaging conditions of this study. Prior studies link B2 receptor activation to brain edema in cases of CNS injury (Hellal et al. 2003; Lehmberg et al. 2003) or disease (Lorenzl et al. 1996). Given the up regulation of KLK1 and B2 receptors in stroke (Groger et al. 2005), results herein underscore the likely importance of the bradykinin receptor, rather than the PAR pathway, in mediating the CNS-specific effects of KLK1.

Of particular interest were observations in this study that KLK6-induced ERK activation in neurons was like that of KLK1, shutdown by the B2 inhibitor Icatibant. Furthermore, studies following up on this observation showed KLK6 mediated Ca2+ signaling in neurons to be dependent not only on PAR1 but also B2. Indeed KLK6-mediated activation of ERK and Ca2+ signaling appear to depend on the co-activation of PAR1 and B2. Thus in addition to activation of PAR1, observations herein point to a novel means of B2 activation in neurons mediated by KLK6. While understanding the precise mechanism of KLK6 activation of B2 will require substantial additional studies, several possible mechanisms of action can be considered. One possibility is that KLK6 directly or indirectly promotes generation of brady-kinin receptor activating kinins. This could explain B2 activation in the cell culture systems examined, but is more difficult to reconcile with the Ca2+ imaging assays in which KLK1, a known potent activator of kininogen, did not generate kinins in sufficient quantities to trigger a Ca2+ signal. Although direct KLK6-mediated kinin release is not ruled out by the current studies, it is not the most likely explanation as cleavage of kininogen to release Lys-bradykinin requires cleavage C-terminal to Lys, and this is not the preferred substrate specificity of KLK6 (Bernett et al. 2002; Blaber et al. 2002). An alternative mechanism may be that KLK6 activates another enzyme which in turn mediates kinin liberation. A further possible mechanism is direct activation of the B2 receptor by KLK6. Direct receptor activation is supported by prior studies showing that a variety of proteases including KLK1, trypsin, cathepsin G, and endoarginase C are able to activate the B2 receptor in Chinese hamster ovary, Madin–Darby canine kidney, and human embryonic kidney cells stably expressing B2 (Biyashev et al. 2006; Hecquet et al. 2006). Despite these intriguing results, independent studies suggest that local production of bradykinin by these cells, rather than direct B2 receptor activation by proteases, was responsible for the observed signaling (Houle et al. 2003). The results of the present study identify likely activation of B2 by KLK6, the mechanism of which will need to be addressed in future studies.

While the mechanism by which KLK6 activates B2 receptors remains to be determined, these findings demonstrate a previously unknown functional link between the KLK-related peptidase KLK6, and the well characterized tissue KLK–kininogen activation pathway. Given the widespread function of kinins in health and disease, including CNS disease (Chao and Chao 2006), these novel observations have important implications for understanding KLK6 function and B2 receptor physiology. These results additionally highlight the fact that KLK6 utilizes multiple signaling mechanisms, the net effect of which will be to amplify small changes in its concentration which may occur in normal and pathological conditions. For example in neurons, data presented suggest that KLK6-mediated Ca2+ flux and ERK activation require the co-activation of both the B2 and PAR1 receptors. Similar co-operativity between PAR1 and B2 has been demonstrated in Chinese hamster ovary and human endothelial cells. In these cell types arachidonic acid release in response to B2 receptor activation is significantly elevated when PAR1 is also activated (Hecquet et al. 2006).

Evidence presented indicates both KLK1 and KLK6 activate intracellular signaling pathways known to be involved in cellular survival and differentiation. KLK6 signaling occurred via PAR1 and B2 receptor dependent mechanisms while KLK1 signaling occurred by a non-PAR, B2-receptor dependent mechanism. In neurons both proteases promoted an early and pronounced decrease in activated AKT. In relation to this, we have previously demonstrated KLK1 and KLK6 promote rapid neurite retraction and degeneration of cortical neurons in vitro (Scarisbrick et al. 2008). Taken with strong evidence that AKT activation is linked to promotion of cell survival in a wide range of cell types (Brunet et al. 2001), we suggest KLK1 and KLK6 when present in excess, suppress phosphorylation of neuronal AKT thereby compromising cell survival. Both KLKs also promoted activation of ERK, which has been linked to diverse downstream effects in neurons, including neuron cell death, nociception, and neuronal plasticity (Selcher et al. 2003). The very robust neurotoxic properties of KLK1 (Scarisbrick et al. 2008) may relate to findings that this protease additionally promoted activation JNK, a pro-apoptotic protein (Arthur et al. 2007). Cumulatively these studies support the concept that both KLK1 and KLK6 represent important targets for CNS neuroprotective therapies.

By contrast to effects observed in neurons, in astrocytes there was a trend towards KLK1 and KLK6 promoting activation of AKT. Along with parallel elevations in activated ERK, we postulate KLK1 and KLK6 likely promote astrocyte survival and astrogliosis. Supporting this, prior studies indicate AKT activation promotes formation of reactive astrocytes (Choi et al. 2005; Neary et al. 2005), and PAR1 mediated ERK activation stimulates astrocyte proliferation (Wang et al. 2002a; Sorensen et al. 2003; Nicole et al. 2005; Luo et al. 2006; Wang et al. 2007). Notably, thrombin causes reversal of astrocyte stellation (Park et al. 2006) and KLK1 promotes astrocyte migration (Xia et al. 2004), each a hallmark of astrogliosis. The precise role of KLK1 and KLK6 in astrogliosis warrants further attention and is currently the subject of ongoing studies in our laboratory. This is a particularly important question in CNS injury as KLK6 is virtually absent from all astrocytes of normal CNS white matter, but is induced in astrocytes in cases of CNS injury or disease (Scarisbrick et al. 2002, 2006b). We propose autocrine or paracrine activity of astrocytic KLK6 activates PAR and bradykinin receptors to drive astrogliosis and neuron injury. Modulation of the KLK–PAR–bradykinin receptor axis therefore may offer an opportunity to modulate astrocytic glial scar formation and create an environment favorable to repair in the injured CNS.

Supplementary Material

Suppl Fig 1. Supporting information.

Additional Supporting information may be found in the online version of this article:

Fig. S1 Dose response of KLK6 following desensitization.

Suppl Fig 2

Fig. S2 Quantification of KLK1, KLKL6, and PAR1-AP induced signaling in NSC34 neurons.

Suppl Fig 3

Fig. S3 Quantification of KLK1, KLK6, PAR1, and PAR2-AP induced signaling in Neu7 astrocytes.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Acknowledgements

These studies were supported by RG3367-B-4 from the National Multiple Sclerosis Society, The Craig H. Neilsen Foundation, The Christopher and Dana Reeve Paralysis Foundation, NCR NCI P50CA108961 Career Development Award and NS52741 to IAS, and NS57771 to MB. NL was supported by the Mayo Rehabilitation Research Training Program – HDO7447. The authors gratefully acknowledge N. Kinzel, J. Tarara, and Dr Y. S. Prakash for their technical expertise. The authors also express thanks to Drs Herb Geller and Neil Cashman for kindly providing the Neu7 and NSC34 cell lines.

Abbreviations used

AKT

protein kinase B

AP

activating peptide

B2

bradykinin receptor 2

ERK

extracellular signal-regulated kinases

JNK

C-Jun N-terminal kinases

KLK

kallikrein

MAPK

mitogen-activated protein kinase

MS

multiple sclerosis

PAR

protease-activated receptor

RT

room temperature

References

  1. Afkhami-Goli A, Noorbakhsh F, Keller AJ, et al. Proteinase-activated receptor-2 exerts protective and pathogenic cell type-specific effects in Alzheimer’s disease. J. Immunol. 2007;179:5493–5503. doi: 10.4049/jimmunol.179.8.5493. [DOI] [PubMed] [Google Scholar]
  2. Almonte AG, Hamill CE, Chhatwal JP, et al. Learning and memory deficits in mice lacking protease activated receptor-1. Neurobiol. Learn. Mem. 2007;88:295–304. doi: 10.1016/j.nlm.2007.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Angelo PF, Lima AR, Alves FM, Blaber SI, Scarisbrick IA, Blaber M, Juliano L, Juliano MA. Substrate specificity of human kallikrein 6: salt and glycosaminoglycan activation effects. J. Biol. Chem. 2006;281:3116–3126. doi: 10.1074/jbc.M510096200. [DOI] [PubMed] [Google Scholar]
  4. Arthur PG, Matich GP, Pang WW, Yu DY, Bogoyevitch MA. Necrotic death of neurons following an excitotoxic insult is prevented by a peptide inhibitor of c-Jun N-terminal kinase. J. Neurochem. 2007;102:65–76. doi: 10.1111/j.1471-4159.2007.04618.x. [DOI] [PubMed] [Google Scholar]
  5. Bernett MJ, Blaber SI, Scarisbrick IA, Dhanarajan P, Thompson SM, Blaber M. Crystal structure and biochemical characterization of human kallikrein 6 reveals that a trypsin-like kallikrein is expressed in the central nervous system. J. Biol. Chem. 2002;277:24562–24570. doi: 10.1074/jbc.M202392200. [DOI] [PubMed] [Google Scholar]
  6. Bhoola K, Ramsaroop R, Plendl J, Cassim B, Dlamini Z, Naicker S. Kallikrein and kinin receptor expression in inflammation and cancer. Biol. Chem. 2001;382:77–89. doi: 10.1515/BC.2001.013. [DOI] [PubMed] [Google Scholar]
  7. Biyashev D, Tan F, Chen Z, Zhang K, Deddish PA, Erdos EG, Hecquet C. Kallikrein activates bradykinin B2 receptors in absence of kininogen. Am. J. Physiol. Heart Circ. Physiol. 2006;290:H1244–H1250. doi: 10.1152/ajpheart.00934.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Blaber SI, Scarisbrick IA, Bernett MJ, Dhanarajan P, Seavy MA, Jin Y, Schwartz MA, Rodriguez M, Blaber M. Enzymatic properties of rat myelencephalon-specific protease. Biochemistry. 2002;41:1165–1173. doi: 10.1021/bi015781a. [DOI] [PubMed] [Google Scholar]
  9. Blaber SI, Ciric B, Christophi GP, Bernett MJ, Blaber M, Rodriguez M, Scarisbrick IA. Targeting kallikrein 6-proteolysis attenuates CNS inflammatory disease. FASEB J. 2004;19:920–922. doi: 10.1096/fj.03-1212fje. [DOI] [PubMed] [Google Scholar]
  10. Borgono CA, Diamandis EP. The emerging roles of human tissue kallikreins in cancer. Nat. Rev. Cancer. 2004;4:876–890. doi: 10.1038/nrc1474. [DOI] [PubMed] [Google Scholar]
  11. Borgono CA, Gavigan JA, Alves J, Bowles B, Harris JL, Sotiropoulou G, Diamandis EP. Defining the extended substrate specificity of kallikrein 1-related peptidases. Biol. Chem. 2007;388:1215–1225. doi: 10.1515/BC.2007.124. [DOI] [PubMed] [Google Scholar]
  12. Boven LA, Vergnolle N, Henry SD, Silva C, Imai Y, Holden J, Warren K, Hollenberg MD, Power C. Up-regulation of proteinase-activated receptor 1 expression in astrocytes during HIV encephalitis. J. Immunol. 2003;170:2638–2646. doi: 10.4049/jimmunol.170.5.2638. [DOI] [PubMed] [Google Scholar]
  13. Brunet A, Datta SR, Greenberg ME. Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr. Opin. Neurobiol. 2001;11:297–305. doi: 10.1016/s0959-4388(00)00211-7. [DOI] [PubMed] [Google Scholar]
  14. Bushell TJ, Plevin R, Cobb S, Irving AJ. Characterization of proteinase-activated receptor 2 signalling and expression in rat hippocampal neurons and astrocytes. Neuropharmacology. 2006;50:714–725. doi: 10.1016/j.neuropharm.2005.11.024. [DOI] [PubMed] [Google Scholar]
  15. Cardin AD, Witt KR, Chao J, Margolius HS, Donaldson VH, Jackson RL. Degradation of apolipoprotein B-100 of human plasma low density lipoproteins by tissue and plasma kallikreins. J. Biol. Chem. 1984;259:8522–8528. [PubMed] [Google Scholar]
  16. Chao J, Chao L. Experimental therapy with tissue kallikrein against cerebral ischemia. Front Biosci. 2006;11:1323–1327. doi: 10.2741/1886. [DOI] [PubMed] [Google Scholar]
  17. Choi BH, Kim RC, Vaughan PJ, Lau A, Van Nostrand WE, Cotman CW, Cunningham DD. Decreases in protease nexins in Alzheimer’s disease brain. Neurobiol. Aging. 1995;16:557–562. doi: 10.1016/0197-4580(95)00060-r. [DOI] [PubMed] [Google Scholar]
  18. Choi SH, Joe EH, Kim SU, Jin BK. Thrombin-induced microglial activation produces degeneration of nigral dopaminergic neurons in vivo. J. Neurosci. 2003;23:5877–5886. doi: 10.1523/JNEUROSCI.23-13-05877.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Choi JS, Park HJ, Kim HY, Kim SY, Lee JE, Choi YS, Chun MH, Chung JW, Lee MY. Phosphorylation of PTEN and Akt in astrocytes of the rat hippocampus following transient forebrain ischemia. Cell Tissue Res. 2005;319:359–366. doi: 10.1007/s00441-004-1033-0. [DOI] [PubMed] [Google Scholar]
  20. Christophi GP, Isackson PJ, Blaber SI, Blaber M, Rodriguez M, Scarisbrick IA. Distinct promoters regulate tissue-specific and differential expression of kallikrein 6 in CNS demyelinating disease. J. Neurochem. 2004;91:1439–1449. doi: 10.1111/j.1471-4159.2004.02826.x. [DOI] [PubMed] [Google Scholar]
  21. Citron BA, Smirnova IV, Arnold PM, Festoff BW. Upregulation of neurotoxic serine proteases, prothrombin, and protease-activated receptor 1 early after spinal cord injury. J. Neurotrauma. 2000;17:1191–1203. doi: 10.1089/neu.2000.17.1191. [DOI] [PubMed] [Google Scholar]
  22. Clements J, Hooper J, Dong Y, Harvey T. The expanded human kallikrein (KLK) gene family: genomic organization, tissue-specific expression and potential functions. Biol. Chem. 2001;382:5–14. doi: 10.1515/BC.2001.002. [DOI] [PubMed] [Google Scholar]
  23. Eggett CJ, Crosier S, Manning P, Cookson MR, Menzies FM, McNeil CJ, Shaw PJ. Development and characterisation of a glutamate-sensitive motor neurone cell line. J. Neurochem. 2000;74:1895–1902. doi: 10.1046/j.1471-4159.2000.0741895.x. [DOI] [PubMed] [Google Scholar]
  24. Festoff BW, editor. Protease Cascade Dysregulation and Synaptic Degeneration in Amyotrophic Lateral Sclerosis. New York: Marcel Dekker; 1992. pp. 621–685. [Google Scholar]
  25. Fok-Seang J, Smith-Thomas LC, Meiners S, et al. An analysis of astrocytic cell lines with different abilities to promote axon growth. Brain Res. 1995;689:207–223. doi: 10.1016/0006-8993(95)00575-b. [DOI] [PubMed] [Google Scholar]
  26. Gingrich MB, Junge CE, Lyuboslavsky P, Traynelis SF. Potentiation of NMDA receptor function by the serine protease thrombin. J. Neurosci. 2000;20:4582–4595. doi: 10.1523/JNEUROSCI.20-12-04582.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Groger M, Lebesgue D, Pruneau D, Relton J, Kim SW, Nussberger J, Plesnila N. Release of bradykinin and expression of kinin B2 receptors in the brain: role for cell death and brain edema formation after focal cerebral ischemia in mice. J. Cereb. Blood Flow Metab. 2005;25:978–989. doi: 10.1038/sj.jcbfm.9600096. [DOI] [PubMed] [Google Scholar]
  28. Hamill CE, Caudle WM, Richardson JR, Yuan H, Pennell KD, Greene JG, Miller GW, Traynelis SF. Exacerbation of dopaminergic terminal damage in a mouse model of Parkinson’s disease by the G-protein-coupled receptor protease-activated receptor 1. Mol. Pharmacol. 2007;72:653–664. doi: 10.1124/mol.107.038158. [DOI] [PubMed] [Google Scholar]
  29. Hecquet C, Biyashev D, Tan F, Erdos EG. Positive co-operativity between the thrombin and bradykinin B2 receptors enhances arachidonic acid release. Am. J. Physiol. Heart Circ. Physiol. 2006;290:H948–H958. doi: 10.1152/ajpheart.00868.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hellal F, Pruneau D, Palmier B, Faye P, Croci N, Plotkine M, Marchand-Verrecchia C. Detrimental role of bradykinin B2 receptor in a murine model of diffuse brain injury. J. Neurotrauma. 2003;20:841–851. doi: 10.1089/089771503322385773. [DOI] [PubMed] [Google Scholar]
  31. Houle S, Molinaro G, Adam A, Marceau F. Tissue kallik-rein actions at the rabbit natural or recombinant kinin B2 receptors. Hypertension. 2003;41:611–617. doi: 10.1161/01.HYP.0000054971.03046.9B. [DOI] [PubMed] [Google Scholar]
  32. Jalink K, Moolenaar WH. Thrombin receptor activation causes rapid neural cell rounding and neurite retraction independent of classic second messengers. J. Cell Biol. 1992;118:411–419. doi: 10.1083/jcb.118.2.411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jiang Y, Wu J, Hua Y, Keep RF, Xiang J, Hoff JT, Xi G. Thrombin-receptor activation and thrombin-induced brain tolerance. J. Cereb. Blood Flow Metab. 2002;22:404–410. doi: 10.1097/00004647-200204000-00004. [DOI] [PubMed] [Google Scholar]
  34. Junge CE, Sugawara T, Mannaioni G, Alagarsamy S, Conn PJ, Brat DJ, Chan PH, Traynelis SF. The contribution of protease-activated receptor 1 to neuronal damage caused by transient focal cerebral ischemia. Proc. Natl Acad. Sci. USA. 2003;100:13019–13024. doi: 10.1073/pnas.2235594100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Junge CE, Lee CJ, Hubbard KB, Zhang Z, Olson JJ, Hepler JR, Brat DJ, Traynelis SF. Protease-activated receptor-1 in human brain: localization and functional expression in astrocytes. Exp. Neurol. 2004;188:94–103. doi: 10.1016/j.expneurol.2004.02.018. [DOI] [PubMed] [Google Scholar]
  36. Kitaoka T, Hua Y, Xi G, Hoff JT, Keep RF. Delayed argatroban treatment reduces edema in a rat model of intracerebral hemorrhage. Stroke. 2002;33:3012–3018. doi: 10.1161/01.str.0000037673.17260.1b. [DOI] [PubMed] [Google Scholar]
  37. Laxmikanthan G, Blaber SI, Bernett MJ, Scarisbrick IA, Juliano MA, Blaber M. 1.70 A X-ray structure of human apo kallikrein 1: structural changes upon peptide inhibitor/substrate binding. Proteins. 2005;58:802–814. doi: 10.1002/prot.20368. [DOI] [PubMed] [Google Scholar]
  38. Lee KR, Drury I, Vitarbo E, Hoff JT. Seizures induced by intracerebral injection of thrombin: a model of intracerebral hemorrhage. J. Neurosurg. 1997;87:73–78. doi: 10.3171/jns.1997.87.1.0073. [DOI] [PubMed] [Google Scholar]
  39. Lehmberg J, Beck J, Baethmann A, Uhl E. Bradykinin antagonists reduce leukocyte-endothelium interactions after global cerebral ischemia. J. Cereb. Blood Flow Metab. 2003;23:441–448. doi: 10.1097/01.WCB.0000052280.23292.35. [DOI] [PubMed] [Google Scholar]
  40. Little SP, Dixon EP, Norris F, et al. Zyme, a novel and potentially amyloidogenic enzyme cDNA isolated from Alzheimer’s disease brain. J. Biol. Chem. 1997;272:25135–25142. doi: 10.1074/jbc.272.40.25135. [DOI] [PubMed] [Google Scholar]
  41. Liu Y, Fields RD, Festoff BW, Nelson PG. Proteolytic action of thrombin is required for electrical activity-dependent synapse reduction. Proc. Natl Acad. Sci. USA. 1994;91:10300–10304. doi: 10.1073/pnas.91.22.10300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lorenzl S, Kodel U, Frei K, Pfister HW. Effect of the bradykinin B2 receptor antagonist Hoe140 in experimental pneu-mococcal meningitis in the rat. Eur. J. Pharmacol. 1996;308:335–341. doi: 10.1016/0014-2999(96)00375-5. [DOI] [PubMed] [Google Scholar]
  43. Luo W, Wang Y, Hanck T, Stricker R, Reiser G. Jab1, a novel protease-activated receptor-2 (PAR-2)-interacting protein, is involved in PAR-2-induced activation of activator protein-1. J. Biol. Chem. 2006;281:7927–7936. doi: 10.1074/jbc.M510784200. [DOI] [PubMed] [Google Scholar]
  44. McLaughlin BA, Nelson D, Silver IA, Erecinska M, Chesselet MF. Methylmalonate toxicity in primary neuronal cultures. Neuroscience. 1998;86:279–290. doi: 10.1016/s0306-4522(97)00594-0. [DOI] [PubMed] [Google Scholar]
  45. Monard D. Cell-derived proteases and protease inhibitors as regulators of neurite outgrowth. Trends Neurosci. 1988;11:541–544. doi: 10.1016/0166-2236(88)90182-8. [DOI] [PubMed] [Google Scholar]
  46. Neary JT, Kang Y, Tran M, Feld J. Traumatic injury activates protein kinase B/Akt in cultured astrocytes: role of extracellular ATP and P2 purinergic receptors. J. Neurotrauma. 2005;22:491–500. doi: 10.1089/neu.2005.22.491. [DOI] [PubMed] [Google Scholar]
  47. Nicole O, Goldshmidt A, Hamill CE, Sorensen SD, Sastre A, Lyuboslavsky P, Hepler JR, McKeon RJ, Traynelis SF. Activation of protease-activated receptor-1 triggers astrogliosis after brain injury. J. Neurosci. 2005;25:4319–4329. doi: 10.1523/JNEUROSCI.5200-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Nishino A, Suzuki M, Ohtani H, Motohashi O, Umezawa K, Nagura H, Yoshimoto T. Thrombin may contribute to the pathophysiology of central nervous system injury. J. Neurotrauma. 1993;10:167–179. doi: 10.1089/neu.1993.10.167. [DOI] [PubMed] [Google Scholar]
  49. Noorbakhsh F, Tsutsui S, Vergnolle N, et al. Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Exp. Med. 2006;203:425–435. doi: 10.1084/jem.20052148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Oikonomopoulou K, Hansen KK, Saifeddine M, et al. Kallikrein-mediated cell signalling: targeting proteinase-activated receptors (PARs) Biol. Chem. 2006a;387:817–824. doi: 10.1515/BC.2006.104. [DOI] [PubMed] [Google Scholar]
  51. Oikonomopoulou K, Hansen KK, Saifeddine M, et al. Proteinase-activated receptors, targets for kallikrein signaling. J. Biol. Chem. 2006b;281:32095–32112. doi: 10.1074/jbc.M513138200. [DOI] [PubMed] [Google Scholar]
  52. Ole-MoiYoi OK, Pinkus GS, Spragg J, Austen KF. Identification of human glandular kallikrein in the beta cell of the pancreas. N. Engl. J. Med. 1979;300:1289–1294. doi: 10.1056/NEJM197906073002301. [DOI] [PubMed] [Google Scholar]
  53. Park GH, Ryu JR, Shin CY, Choi MS, Han BH, Kim WK, Kim HC, Ko KH. Evidence that protease-activated receptor-2 mediates trypsin-induced reversal of stellation in cultured rat astrocytes. Neurosci. Res. 2006;54:15–23. doi: 10.1016/j.neures.2005.09.007. [DOI] [PubMed] [Google Scholar]
  54. Raidoo DM, Ramsaroop R, Naidoo S, Bhoola KD. Regional distribution of tissue kallikrein in the human brain. Immunopharmacology. 1996;32:39–47. doi: 10.1016/0162-3109(96)00007-0. [DOI] [PubMed] [Google Scholar]
  55. Riek-Burchardt M, Striggow F, Henrich-Noack P, Reiser G, Reymann KG. Increase of prothrombin-mRNA after global cerebral ischemia in rats, with constant expression of protease nexin-1 and protease-activated receptors. Neurosci. Lett. 2002;329:181–184. doi: 10.1016/s0304-3940(02)00645-6. [DOI] [PubMed] [Google Scholar]
  56. Rohatgi T, Henrich-Noack P, Sedehizade F, Goertler M, Wallesch CW, Reymann KG, Reiser G. Transient focal ischemia in rat brain differentially regulates mRNA expression of protease-activated receptors 1 to 4. J. Neurosci. Res. 2004;75:273–279. doi: 10.1002/jnr.10847. [DOI] [PubMed] [Google Scholar]
  57. Scarisbrick IA, Towner MD, Isackson PJ. Nervous system specific expression of a novel serine protease: regulation in the adult rat spinal cord by excitotoxic injury. J. Neurosci. 1997;17:8156–8168. doi: 10.1523/JNEUROSCI.17-21-08156.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Scarisbrick IA, Asakura K, Blaber S, Blaber M, Isackson PJ, Bieto T, Rodriguez M, Windebank AJ. Preferential expression of myelencephalon-specific protease by oligodendrocytes of the adult rat spinal cord white matter. Glia. 2000;30:219–230. doi: 10.1002/(sici)1098-1136(200005)30:3<219::aid-glia2>3.0.co;2-2. [DOI] [PubMed] [Google Scholar]
  59. Scarisbrick IA, Isackson PJ, Ciric B, Windebank AJ, Rodriguez M. MSP, a trypsin-like serine protease, is abundantly expressed in the human nervous system. J. Comp. Neurol. 2001;431:347–361. [PubMed] [Google Scholar]
  60. Scarisbrick IA, Blaber SI, Lucchinetti CF, Genain CP, Blaber M, Rodriguez M. Activity of a newly identified serine protease in CNS demyelination. Brain. 2002;125:1283–1296. doi: 10.1093/brain/awf142. [DOI] [PubMed] [Google Scholar]
  61. Scarisbrick IA, Blaber SI, Tingling JT, Rodriguez M, Blaber M, Christophi GP. Potential scope of action of tissue kallikreins in CNS immune-mediated disease. J. Neuroimmunol. 2006a;178:167–176. doi: 10.1016/j.jneuroim.2006.05.022. [DOI] [PubMed] [Google Scholar]
  62. Scarisbrick IA, Sabharwal P, Cruz H, et al. Dynamic role of kallikrein 6 in traumatic spinal cord injury. Eur. J. Neurosci. 2006b;24:1457–1469. doi: 10.1111/j.1460-9568.2006.05021.x. [DOI] [PubMed] [Google Scholar]
  63. Scarisbrick IA, Linbo R, Vandell A, et al. Kallikreins are associated with secondary progressive multiple sclerosis and promote neurodegeneration. Biol. Chem. 2008;389:739–745. doi: 10.1515/BC.2008.085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Seeds NW, Haffke S, Christensen K, Schoonmaker J. Cerebellar granule cell migration involves proteolysis. Adv. Exp. Med. Biol. 1990;265:169–178. doi: 10.1007/978-1-4757-5876-4_16. [DOI] [PubMed] [Google Scholar]
  65. Selcher JC, Weeber EJ, Christian J, Nekrasova T, Landreth GE, Sweatt JD. A role for ERK MAP kinase in physiologic temporal integration in hippocampal area CA1. Learn. Mem. 2003;10:26–39. doi: 10.1101/lm.51103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Siconolfi LB, Seeds NW. Induction of the plasminogen activator system accompanies peripheral nerve regeneration after sciatic nerve crush. J. Neurosci. 2001;21:4336–4347. doi: 10.1523/JNEUROSCI.21-12-04336.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Smirnova IV, Citron BA, Arnold PM, Festoff BW. Neuroprotective signal transduction in model motor neurons exposed to thrombin: G-protein modulation effects on neurite outgrowth, Ca(2+) mobilization, and apoptosis. J. Neurobiol. 2001;48:87–100. [PubMed] [Google Scholar]
  68. Smith-Swintosky VL, Cheo-Isaacs CT, D’Andrea MR, Santulli RJ, Darrow AL, Andrade-Gordon P. Protease-activated receptor-2 (PAR-2) is present in the rat hippocampus and is associated with neurodegeneration. J. Neurochem. 1997;69:1890–1896. doi: 10.1046/j.1471-4159.1997.69051890.x. [DOI] [PubMed] [Google Scholar]
  69. Sorensen SD, Nicole O, Peavy RD, Montoya LM, Lee CJ, Murphy TJ, Traynelis SF, Hepler JR. Common signaling pathways link activation of murine PAR-1, LPA, and S1P receptors to proliferation of astrocytes. Mol. Pharmacol. 2003;64:1199–1209. doi: 10.1124/mol.64.5.1199. [DOI] [PubMed] [Google Scholar]
  70. Steinhoff M, Vergnolle N, Young SH, et al. Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic mechanism. Nat. Med. 2000;6:151–158. doi: 10.1038/72247. [DOI] [PubMed] [Google Scholar]
  71. Steinhoff M, Buddenkotte J, Shpacovitch V, Rattenholl A, Moormann C, Vergnolle N, Luger TA, Hollenberg MD. Proteinase-activated receptors: transducers of proteinase-mediated signaling in inflammation and immune response. Endocr. Rev. 2005;26:1–43. doi: 10.1210/er.2003-0025. [DOI] [PubMed] [Google Scholar]
  72. Striggow F, Riek M, Breder J, Henrich-Noack P, Reymann KG, Reiser G. The protease thrombin is an endogenous mediator of hippocampal neuroprotection against ischemia at low concentrations but causes degeneration at high concentrations. Proc. Natl Acad. Sci. USA. 2000;97:2264–2269. doi: 10.1073/pnas.040552897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Suo Z, Wu M, Ameenuddin S, Anderson HE, Zoloty JE, Citron BA, Andrade-Gordon P, Festoff BW. Participation of protease-activated receptor-1 in thrombin-induced microglial activation. J. Neurochem. 2002;80:655–666. doi: 10.1046/j.0022-3042.2001.00745.x. [DOI] [PubMed] [Google Scholar]
  74. Terayama R, Bando Y, Takahashi T, Yoshida S. Differential expression of neuropsin and protease M/neurosin in oligodendrocytes after injury to the spinal cord. Glia. 2004;48:91–101. doi: 10.1002/glia.20058. [DOI] [PubMed] [Google Scholar]
  75. Tsirka SE, Rogove AD, Bugge TH, Degen JL, Strickland S. An extracellular proteolytic cascade promotes neuronal degeneration in the mouse hippocampus. J. Neurosci. 1997;17:543–552. doi: 10.1523/JNEUROSCI.17-02-00543.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Uchida A, Oka Y, Aoyama M, et al. Expression of myelencephalon-specific protease in transient middle cerebral artery occlusion model of rat brain. Mol. Brain Res. 2004;126:129–136. doi: 10.1016/j.molbrainres.2004.04.009. [DOI] [PubMed] [Google Scholar]
  77. Vergnolle N, Bunnett NW, Sharkey KA, et al. Proteinase-activated receptor-2 and hyperalgesia: a novel pain pathway. Nat. Med. 2001;7:821–826. doi: 10.1038/89945. [DOI] [PubMed] [Google Scholar]
  78. Wang H, Ubl JJ, Reiser G. Four subtypes of protease-activated receptors, co-expressed in rat astrocytes, evoke different physiological signaling. Glia. 2002a;37:53–63. doi: 10.1002/glia.10012. [DOI] [PubMed] [Google Scholar]
  79. Wang H, Ubl JJ, Stricker R, Reiser G. Thrombin (PAR-1)-induced proliferation in astrocytes via MAPK involves multiple signaling pathways. Am. J. Physiol. Cell Physiol. 2002b;283:C1351–C1364. doi: 10.1152/ajpcell.00001.2002. [DOI] [PubMed] [Google Scholar]
  80. Wang Y, Luo W, Reiser G. Proteinase-activated receptor-1 and -2 induce the release of chemokine GRO/CINC-1 from rat astrocytes via differential activation of JNK isoforms, evoking multiple protective pathways in brain. Biochem. J. 2007;401:65–78. doi: 10.1042/BJ20060732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Weinstein JR, Gold SJ, Cunningham DD, Gall CM. Cellular localization of thrombin receptor mRNA in rat brain: expression by mesencephalic dopaminergic neurons and codistribution with prothrombin mRNA. J. Neurosci. 1995;15:2906–2919. doi: 10.1523/JNEUROSCI.15-04-02906.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Xia CF, Yin H, Borlongan CV, Chao L, Chao J. Kallikrein gene transfer protects against ischemic stroke by promoting glial cell migration and inhibiting apoptosis. Hypertension. 2004;43:452–459. doi: 10.1161/01.HYP.0000110905.29389.e5. [DOI] [PubMed] [Google Scholar]
  83. Xue M, Del Bigio MR. Acute tissue damage after injections of thrombin and plasmin into rat striatum. Stroke. 2001;32:2164–2169. doi: 10.1161/hs0901.095408. [DOI] [PubMed] [Google Scholar]
  84. Yoon H, Laxmikanthan G, Lee J, Blaber SI, Rodriguez A, Kogot JM, Scarisbrick IA, Blaber M. Activation profiles and regulatory cascades of the human kallikrein-related peptidases. J. Biol. Chem. 2007;282:31852–31864. doi: 10.1074/jbc.M705190200. [DOI] [PubMed] [Google Scholar]
  85. Zarghooni M, Soosaipillai A, Grass L, Scorilas A, Mirazimi N, Diamandis EP. Decreased concentration of human kallikrein 6 in brain extracts of Alzheimer’s disease patients. Clin. Biochem. 2002;35:225–231. doi: 10.1016/s0009-9120(02)00292-8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl Fig 1. Supporting information.

Additional Supporting information may be found in the online version of this article:

Fig. S1 Dose response of KLK6 following desensitization.

Suppl Fig 2

Fig. S2 Quantification of KLK1, KLKL6, and PAR1-AP induced signaling in NSC34 neurons.

Suppl Fig 3

Fig. S3 Quantification of KLK1, KLK6, PAR1, and PAR2-AP induced signaling in Neu7 astrocytes.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

RESOURCES