Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Apr 17.
Published in final edited form as: FEBS Lett. 2009 Mar 25;583(8):1344–1348. doi: 10.1016/j.febslet.2009.03.039

T0901317, an LXR agonist, augments PKA-induced vascular cell calcification

Jeffrey J Hsu 1, Jinxiu Lu 2, Michael S Huang 1, Yifan Geng 1, Andrew P Sage 1, Michelle N Bradley 3, Peter Tontonoz 1,3, Linda L Demer 1,2, Yin Tintut 1
PMCID: PMC2692939  NIHMSID: NIHMS105156  PMID: 19327357

Abstract

We examined the effect of LXR agonists on vascular calcification, prevalent in atherosclerotic lesions. T0901317, an LXR agonist, augmented protein kinase A (PKA)-induced mineralization and alkaline phosphatase (ALP) activity in aortic smooth muscle cells isolated from wild-type, but not from Lxrβ-/- mice. A six-hour T0901317 treatment augmented the PKA-induced expression of the phosphate transporter Pit-1, a positive regulator of mineralization, suggesting a direct role. A ten-day T0901317 treatment attenuated PKA-induced expression of mineralization inhibitors, osteopontin and ectonucleotide pyrophosphatase/phosphodiesterase-1, suggesting an indirect role. The effects of T0901317 were attenuated by inhibition of ALP, Pit-1 and Rho-associated kinase, but not by inhibition of PKA. These results suggest that T0901317-augmented mineralization occurs downstream of PKA, involving both direct and indirect LXR-mediated pathways.

Keywords: T0901317, LXR, calcification, smooth muscle cells

Introduction

Liver X Receptor (LXR), the nuclear hormone receptor, plays a crucial role in cholesterol homeostasis. LXR activates expression of genes involved in cholesterol efflux, such as ABCA1, and reduces cytokine-induced gene expression (1, 2). In mice, synthetic LXR agonists reduce atherosclerosis, while LXR deficient hyperlipidemic mice have accelerated atherosclerosis (3-5). LXRα is expressed primarily in the liver, intestines, adipose tissue, adrenal glands, lungs, and kidneys, whereas LXRβ is expressed ubiquitously and is likely to mediate any direct effects on vascular cells. We and others have found that oxysterols, now known to be physiological ligands of LXR (6), stimulate matrix mineralization in vascular cells (7, 8). However, the effect of synthetic LXR agonists on vascular cell calcification is not known.

Vascular calcification, highly prevalent in atherosclerosis, as well as in diabetes and chronic kidney disease (9), is increasingly being used as a surrogate marker for atherosclerosis. Its presence is associated with a poor prognosis, specifically a greater likelihood of cardiovascular events such as myocardial infarction, stroke, and death (10). Vascular calcification is promoted by monocyte-macrophages and inflammatory cytokines commonly present in atherosclerotic plaques (11-13).

Under physiological conditions, vascular calcification is constitutively suppressed by local factors in the extracellular milieu (14, 15). Extracellular pyrophosphate (PPi) is generated from cleavage of nucleotide triphosphates by ectonucleotide pyrophosphatase/phosphodiesterase 1 (Enpp1/Npp1/PC-1). Absence of this enzyme leads to a congenital, life-threatening vascular calcification in humans (16). Additionally, in vitro studies showed that osteopontin (OPN), an extracellular structural protein, also negatively regulates vascular calcification (17). In contrast, vascular calcification is stimulated by increased phosphate levels and increased alkaline phosphatase (ALP) activity. High phosphate acts, at least in part, through Pit-1, a type III sodium-dependent phosphate cotransporter (18, 19). Terkeltaub, Millan and colleagues showed that the primary in vivo role of ALP is to cleave the mineralization inhibitor, PPi (20).

We previously established an in vitro model of PKA-induced vascular cell calcification (21, 22). This model has a physiological basis since PKA is a mediator of parathyroid hormone (PTH), which when chronically elevated leads to aortic calcification in rodent models (23) and is associated with increased atherosclerotic calcification in patients with end-stage renal disease (24). In the present study, we tested the effects of LXR agonists on this in vitro PKA-induced calcification model in primary aortic cells isolated from wild-type (WT) and Lxrβ-/- mice.

Materials and Methods

Materials

Forskolin was from Calbiochem, T0901317 and Y27632 from Cayman Chemical, and GW3965, 25-hydroxycholesterol, and phosphonoformic acid from Sigma-Aldrich.

Cell culture

Vascular cells (passages 4-8) were isolated from the thoracic aorta of mice (25). Lxrβ-/- mice were a gift of Dr. David Mangelsdorf (UT Southwestern). The cells were immunoreactive for smooth muscle α-actin, (Dako Corp.) but not for endothelial markers (von Willebrand factor; Dako Corp.). Cells were treated at confluence with the indicated reagents in α-minimal essential medium ( -MEM) supplemented with 10% fetal bovine serum and 5 mM β-glycerophosphate (Sigma). Media was replaced with fresh agents every 3-4 days.

Mineral incorporation

Matrix calcium levels (normalized to total protein) were analyzed by the o-cresolphthalein complexone method (Teco Diagnostics) in quintuplicate (21).

Alkaline phosphatase activity

ALP activity (normalized to total protein) was assessed colorimetrically and assayed in quintuplicate (21).

Gene expression

Realtime RT-qPCR was performed using 1-step qRT-PCR (Biochain Institute, Inc.) in the Mx3005P (Stratagene). Primer sequences are indicated previously (21), except for ABCA1 - (sense) CGTGTGAGCAAAGCCAAG, (antisense) AAGATGATAATGACCAGTGTAGC; LXRα-(sense) TACAACCGGGAAGACTTTGC, (antisense) TGCAGAGAAGATGCTGATGG; and LXRβ-(sense) CAGGAGATTGTGGACTTTGC, (antisense) TTGTAGCGTCTGGCTGTTTC. β-actin was used as a normalizing gene.

Data analysis

Each experiment was performed in ≥ triplicate wells and repeated ≥ three times. Data are expressed as the mean ± SEM. Means were compared using one-way ANOVA, with comparison of different groups by Fisher’s protected least significant difference test. A value of p ≤ 0.05 was considered significant.

Results

LXR isotype expression

The level of LXRα expression is similar in aortic cells from WT and Lxrβ-/- cells, whereas LXRβ is reduced by 95% in the Lxrβ-/- cells (Fig. 1A). The residual Lxr transcript detected in the Lxrβ-/- cells does not encode a functional protein (data not shown). Consistent with this expression profile, T0901317 upregulated expression of ABCA1, a known LXR target, by 10- fold in WT cells but only 2-fold in Lxrβ-/- cells (Fig. 1B).

FIG. 1. LXR expression and activation.

FIG. 1

Open in a new tab

(A) RT-qPCR analysis of LXRα and LXRβ expression in aortic cells cultured for 3 days. Results are from a single experiment with N=3. (B) RT-qPCR analysis of ABCA1 expression (normalized to β-actin) in WT and Lxrβ-/- cells treated for 10 days with vehicle or T0901317 (5 μM). *p < 0.0001, **p < 0.005, NS – not significant.

Matrix mineralization

Treatment with the PKA activator forskolin (Fsk) for 10 days significantly increased matrix mineralization (Fig. 2A). T0901317 alone had no significant effect, whereas cotreatment with T0901317 augmented Fsk-induced mineralization (Fig. 2A). This effect was not observed in Lxrβ-/- cells (Fig. 2A). Other known LXR agonists, GW3965 and 25-hydroxycholesterol (25-OH), also augmented the Fsk-induced mineralization (Fig. 2A-B). Consistent with previous results (8), and in contrast to the synthetic LXR agonists, 25-OH alone enhanced mineral incorporation, suggesting that 25-OH has effects independent of LXR activation.

FIG. 2. Matrix mineralization and ALP activity.

FIG. 2

Open in a new tab

(A) Mineral incorporation of cells treated for 10 days with vehicle, T0901317 (5 μM), GW3965 (2μM) and/or Fsk (25 μM). (B) Mineral incorporation of cells treated for 15 days with vehicle, 25-hydroxycholesterol (25-OH; 5 μM), and/or Fsk (25 μM). (C) ALP activity of WT cells treated for 4 days with vehicle, T0901317 (5 μM) ± Fsk (25 μM). (D) ALP activity of Lxrβ-/- cells treated for 4 days, as indicated in panel B. *p < 0.0005, NS – not significant.

Next, we examined the effects of LXR agonists on regulators of mineralization. Cotreatment with either T0901317 or GW3965 augmented the Fsk-induced ALP activity in WT (Fig. 2C) but not in Lxrβ-/- cells (Fig. 2D). Treatment with Fsk for 6 hrs induced Pit-1 mRNA in both WT and Lxrβ-/- cells (Fig. 3A). Cotreatment with T0901317 significantly augmented Fsk-induced Pit-1 expression in WT, but not in Lxrβ-/- cells (Fig. 3A). At this time point, T0901317 did not alter Fsk-induced expression of osteopontin (OPN) and Enpp1 (Fig. 3B-C). However, longer (10 days) T0901317 treatment attenuated Fsk-induced expression of both Enpp1 and OPN in WT (Fig. 3B-C), but not in Lxrβ-/- cells (data not shown), suggesting an indirect regulation by T0901317.

FIG. 3. Gene expression.

FIG. 3

Open in a new tab

(A) RT-qPCR analysis of Pit-1 expression in WT or Lxrβ-/- cells treated for 6 hr with vehicle, Fsk (10 μM) ± T0901317 (5 μM). *p < 0.001, §p<0.05. (B) RT-qPCR analysis of Enpp1 expression in WT cells treated for 6 hr or 10 days with vehicle, T0901317 (5 μM) ± Fsk (25 μM). *p < 0.0001, ‡p < 0.001. (C) RT-qPCR analysis of OPN in WT cells treated for 6 hrs or 10 days with vehicle, T0901317 (5 μM) ± Fsk (25 μM). *p < 0.0001, ‡p < 0.005.

ALP and Pit-1 Inhibition

To determine whether inhibition of ALP and Pit-1 attenuates the effects of T0901317, we used their respective inhibitors, levamisole (Lev) and phosphonoformic acid (PFA). Cotreatment with Lev inhibited both Fsk- and Fsk/T0901317-induced matrix mineralization (Fig. 4A). Similarly, cotreatment with PFA inhibited the effects of T0901317 (Fig. 4B).

FIG. 4. Inhibition of ALP and Pit-1 activity.

FIG. 4

Open in a new tab

(A) Levamisol (Lev). Mineral incorporation of WT cells treated for 10 d with vehicle, Fsk (25 μM), Lev (0.1 mM), and/or T0901317 (5 μM). * p < 0.0001. (B) Phosphonoformic Acid (PFA). Mineral incorporation of WT cells treated for 10 d with vehicle, Fsk (25 μM), PFA (0.5 mM), and/or T0901317 (5 μM). *p<0.0001, NS - not significant.

Intracellular signaling

An inhibitor of PKA, H89, was used to assess whether the effects of T0901317 were upstream or downstream of PKA. In the presence of H89, T0901317 was still able to augment mineralization (Fig. 5A, compare Fsk+H89 to Fsk+T0+H89), suggesting that T0901317 acts downstream of PKA. Since Rho-associated kinase (ROCK-II) has been shown to mediate the calcifying effects of 7-ketocholesterol (7), we next examined its role in T0901317-induced mineralization. Y27632, a ROCK-II inhibitor, partially inhibited Fsk-induced calcification and completely attenuated Fsk/T0901317-induced mineralization (Fig. 5B).

FIG. 5. Signaling Pathways.

FIG. 5

Open in a new tab

(A) H89. Mineral incorporation of WT cells treated for 10 d with vehicle, Fsk (25 μM), H89 (10 μM), and/or T0901317 (5 μM). *p < 0.0001. (B), Y27632. Mineral incorporation of WT cells treated for 10 d with vehicle, Fsk (25 μM), Y27632 (10 μM), and/or T0901317 (5 μM). *p<0.0001, **p=0.001, NS – not significant. (C) Schematic model of possible mechanisms of effects of LXR agonist, T0901317, on Fsk-induced mineralization.

Discussion

Given that LXR agonists have anti-atherogenic effects and that calcification is highly prevalent in atherosclerotic plaques, we investigated the effects of synthetic LXR agonists on vascular cell mineralization using synthetic LXR agonists in aortic cells isolated from WT and Lxrβ-/- mice. Results showed that although LXR agonists alone had no significant effect, they augmented PKA-induced mineralization in WT cells. The effect appears to be LXRβ-dependent, since it is not seen in Lxrβ-/- cells.

Results suggest that LXR agonists augmented Fsk-induced mineralization by enhancing positive regulators of mineralization, such as ALP activity and, possibly, Pit-1 and/or by attenuating inhibitors of mineralization, OPN and Enpp1, as depicted in Fig. 5C. Interestingly, the role of Enpp1 is complex since excess Enpp1 can also promote calcification by providing a substrate for ALP (26). Indeed, this may explain how Fsk can induce calcification despite its induction of Enpp1. Short-term regulation of Pit-1 induction by T0901317 suggests a direct, genomic effect of LXR, whereas inhibition of OPN and Enpp1 required longer treatment, suggesting an indirect mechanism. Results also suggest that T0901317 action occurs downstream of PKA and may be mediated by ROCK-II, which regulates myofibroblast differentiation, extracellular matrix production (27) and matrix mineralization induced by 7-ketocholesterol (7). ROCK-II also appears to contribute to PKA-mediated calcification itself since Fsk-induced mineralization was partially blocked by Y27632.

Evidence suggests that high phosphate levels induce matrix mineralization by vascular smooth muscle cells via Pit-1 (17, 28). Pit-1 is also a downstream effector for other mineralization factors, including BMP-2 (29). In the present study, Fsk-induced Pit-1 expression was augmented by short-term treatment with T0901317, suggesting transcriptional regulation. Indeed, two putative LXR response elements are located in the promoter region of Pit-1, and studies of their functional role are underway. In our results, the attenuation of matrix mineralization by PFA, which inhibits Pit-1 (29-31), suggests a role of Pit-1 induction in effects of LXR agonists. However, since PFA is also a PPi analog, it is also possible that PFA inhibition is through this alternative mechanism rather than through Pit-1. Further studies are required to discern whether Pit-1 has a role in the LXR agonist effects.

Chronic inflammation, responsible for atherogenesis, also induces vascular cell calcification (11-13), suggesting that similar pathways may regulate both pathogenic processes. Since LXR activation attenuates inflammation, it is less likely that LXR poses adverse effects in arteries lacking atherosclerosis. However, our findings suggest that LXR activation could adversely affect arteries exposed to other pathological factors such as high phosphate and increased PTH signaling seen in end stage renal patients with hyperparathyroidism.

Acknowledgments

We thank Dr. Mangelsorf (UT Southwestern) for the Lxrβ-/- mice. This research was supported by grants from the National Institutes of Health (DK076009-01, YT and HL081202, LLD), the American Heart Association (JJH and APS) and the Howard Hughes Medical Institute (JJH, PT, MNB).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003;9:213–219. doi: 10.1038/nm820. [DOI] [PubMed] [Google Scholar]
  • 2.Ogawa D, Stone JF, Takata Y, Blaschke F, Chu VH, Towler DA, Law RE, Hsueh WA, Bruemmer D. Liver x receptor agonists inhibit cytokine-induced osteopontin expression in macrophages through interference with activator protein-1 signaling pathways. Circ Res. 2005;96:e59–67. doi: 10.1161/01.RES.0000163630.86796.17. [DOI] [PubMed] [Google Scholar]
  • 3.Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, Hseuh WA, Collins JL, Tangirala RK, Tontonoz P. Ligand activation of LXR beta reverses atherosclerosis and cellular cholesterol overload in mice lacking LXR alpha and apoE. J Clin Invest. 2007;117:2337–2346. doi: 10.1172/JCI31909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Terasaka N, Hiroshima A, Koieyama T, Ubukata N, Morikawa Y, Nakai D, Inaba T. T-0901317, a synthetic liver X receptor ligand, inhibits development of atherosclerosis in LDL receptor-deficient mice. FEBS Lett. 2003;536:6–11. doi: 10.1016/s0014-5793(02)03578-0. [DOI] [PubMed] [Google Scholar]
  • 5.Joseph SB, McKilligin E, Pei L, Watson MA, Collins AR, Laffitte BA, Chen M, Noh G, Goodman J, Hagger GN, Tran J, Tippin TK, Wang X, Lusis AJ, Hsueh WA, Law RE, Collins JL, Willson TM, Tontonoz P. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc Natl Acad Sci U S A. 2002;99:7604–7609. doi: 10.1073/pnas.112059299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, Mangelsdorf DJ. Structural requirements of ligands for the oxysterol liver X receptors LXRalpha and LXRbeta. Proc Natl Acad Sci U S A. 1999;96:266–271. doi: 10.1073/pnas.96.1.266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Saito E, Wachi H, Sato F, Seyama Y. 7-ketocholesterol, a major oxysterol, promotes pi-induced vascular calcification in cultured smooth muscle cells. J Atheroscler Thromb. 2008;15:130–137. doi: 10.5551/jat.e556. [DOI] [PubMed] [Google Scholar]
  • 8.Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF-beta 1 and 25-hydroxycholesterol stimulate osteoblast-like vascular cells to calcify. J Clin Invest. 1994;93:2106–2113. doi: 10.1172/JCI117205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Shao JS, Cai J, Towler DA. Molecular mechanisms of vascular calcification: lessons learned from the aorta. Arterioscler Thromb Vasc Biol. 2006;26:1423–1430. doi: 10.1161/01.ATV.0000220441.42041.20. [DOI] [PubMed] [Google Scholar]
  • 10.Iribarren C, Sidney S, Sternfeld B, Browner WS. Calcification of the aortic arch: risk factors and association with coronary heart disease, stroke, and peripheral vascular disease. Jama. 2000;283:2810–2815. doi: 10.1001/jama.283.21.2810. [DOI] [PubMed] [Google Scholar]
  • 11.Al-Aly Z, Shao JS, Lai CF, Huang E, Cai J, Behrmann A, Cheng SL, Towler DA. Aortic Msx2-Wnt calcification cascade is regulated by TNF-alpha-dependent signals in diabetic Ldlr-/- mice. Arterioscler Thromb Vasc Biol. 2007;27:2589–2596. doi: 10.1161/ATVBAHA.107.153668. [DOI] [PubMed] [Google Scholar]
  • 12.Tintut Y, Patel J, Parhami F, Demer LL. Tumor necrosis factor-alpha promotes in vitro calcification of vascular cells via the cAMP pathway. Circulation. 2000;102:2636–2642. doi: 10.1161/01.cir.102.21.2636. [DOI] [PubMed] [Google Scholar]
  • 13.Tintut Y, Patel J, Territo M, Saini T, Parhami F, Demer LL. Monocyte/macrophage regulation of vascular calcification in vitro. Circulation. 2002;105:650–655. doi: 10.1161/hc0502.102969. [DOI] [PubMed] [Google Scholar]
  • 14.Harmey D, Hessle L, Narisawa S, Johnson KA, Terkeltaub R, Millan JL. Concerted regulation of inorganic pyrophosphate and osteopontin by akp2, enpp1, and ank: an integrated model of the pathogenesis of mineralization disorders. Am J Pathol. 2004;164:1199–1209. doi: 10.1016/S0002-9440(10)63208-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Johnson K, Goding J, Van Etten D, Sali A, Hu SI, Farley D, Krug H, Hessle L, Millan JL, Terkeltaub R. Linked deficiencies in extracellular PP(i) and osteopontin mediate pathologic calcification associated with defective PC-1 and ANK expression. J Bone Miner Res. 2003;18:994–1004. doi: 10.1359/jbmr.2003.18.6.994. [DOI] [PubMed] [Google Scholar]
  • 16.Rutsch F, Vaingankar S, Johnson K, Goldfine I, Maddux B, Schauerte P, Kalhoff H, Sano K, Boisvert WA, Superti-Furga A, Terkeltaub R. PC-1 nucleoside triphosphate pyrophosphohydrolase deficiency in idiopathic infantile arterial calcification. Am J Pathol. 2001;158:543–554. doi: 10.1016/S0002-9440(10)63996-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wada T, McKee MD, Steitz S, Giachelli CM. Calcification of vascular smooth muscle cell cultures: inhibition by osteopontin. Circ Res. 1999;84:166–178. doi: 10.1161/01.res.84.2.166. [DOI] [PubMed] [Google Scholar]
  • 18.Mizobuchi M, Ogata H, Hatamura I, Koiwa F, Saji F, Shiizaki K, Negi S, Kinugasa E, Ooshima A, Koshikawa S, Akizawa T. Up-regulation of Cbfa1 and Pit-1 in calcified artery of uraemic rats with severe hyperphosphataemia and secondary hyperparathyroidism. Nephrol Dial Transplant. 2006;21:911–916. doi: 10.1093/ndt/gfk008. [DOI] [PubMed] [Google Scholar]
  • 19.Giachelli CM, Jono S, Shioi A, Nishizawa Y, Mori K, Morii H. Vascular calcification and inorganic phosphate. Am J Kidney Dis. 2001;38:S34–37. doi: 10.1053/ajkd.2001.27394. [DOI] [PubMed] [Google Scholar]
  • 20.Hessle L, Johnson KA, Anderson HC, Narisawa S, Sali A, Goding JW, Terkeltaub R, Millan JL. Tissue-nonspecific alkaline phosphatase and plasma cell membrane glycoprotein-1 are central antagonistic regulators of bone mineralization. Proc Natl Acad Sci U S A. 2002;99:9445–9449. doi: 10.1073/pnas.142063399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Huang MS, Sage AP, Lu J, Demer LL, Tintut Y. Phosphate and pyrophosphate mediate PKA-induced vascular cell calcification. Biochem Biophys Res Commun. 2008;374:553–558. doi: 10.1016/j.bbrc.2008.07.062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tintut Y, Parhami F, Bostrom K, Jackson SM, Demer LL. cAMP stimulates osteoblast-like differentiation of calcifying vascular cells. Potential signaling pathway for vascular calcification. J Biol Chem. 1998;273:7547–7553. doi: 10.1074/jbc.273.13.7547. [DOI] [PubMed] [Google Scholar]
  • 23.Neves KR, Graciolli FG, dos Reis LM, Graciolli RG, Neves CL, Magalhaes AO, Custodio MR, Batista DG, Jorgetti V, Moyses RM. Vascular calcification: contribution of parathyroid hormone in renal failure. Kidney Int. 2007;71:1262–1270. doi: 10.1038/sj.ki.5002241. [DOI] [PubMed] [Google Scholar]
  • 24.Block G, Port FK. Calcium phosphate metabolism and cardiovascular disease in patients with chronic kidney disease. Semin Dial. 2003;16:140–147. doi: 10.1046/j.1525-139x.2003.160301.x. [DOI] [PubMed] [Google Scholar]
  • 25.Miyoshi T, Tian J, Matsumoto AH, Shi W. Differential response of vascular smooth muscle cells to oxidized LDL in mouse strains with different atherosclerosis susceptibility. Atherosclerosis. 2006;189:99–105. doi: 10.1016/j.atherosclerosis.2005.12.001. [DOI] [PubMed] [Google Scholar]
  • 26.Johnson K, Pritzker K, Goding J, Terkeltaub R. The nucleoside triphosphate pyrophosphohydrolase isozyme PC-1 directly promotes cartilage calcification through chondrocyte apoptosis and increased calcium precipitation by mineralizing vesicles. J Rheumatol. 2001;28:2681–2691. [PubMed] [Google Scholar]
  • 27.Akhmetshina A, Dees C, Pileckyte M, Szucs G, Spriewald BM, Zwerina J, Distler O, Schett G, Distler JH. Rho-associated kinases are crucial for myofibroblast differentiation and production of extracellular matrix in scleroderma fibroblasts. Arthritis Rheum. 2008;58:2553–2564. doi: 10.1002/art.23677. [DOI] [PubMed] [Google Scholar]
  • 28.Jono S, McKee MD, Murry CE, Shioi A, Nishizawa Y, Mori K, Morii H, Giachelli CM. Phosphate regulation of vascular smooth muscle cell calcification. Circ Res. 2000;87:E10–17. doi: 10.1161/01.res.87.7.e10. [DOI] [PubMed] [Google Scholar]
  • 29.Li X, Yang HY, Giachelli CM. BMP-2 promotes phosphate uptake, phenotypic modulation, and calcification of human vascular smooth muscle cells. Atherosclerosis. 2008 doi: 10.1016/j.atherosclerosis.2007.11.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Li X, Yang HY, Giachelli CM. Role of the sodium-dependent phosphate cotransporter, Pit-1, in vascular smooth muscle cell calcification. Circ Res. 2006;98:905–912. doi: 10.1161/01.RES.0000216409.20863.e7. [DOI] [PubMed] [Google Scholar]
  • 31.Wang W, Xu J, Du B, Kirsch T. Role of the progressive ankylosis gene (ank) in cartilage mineralization. Mol Cell Biol. 2005;25:312–323. doi: 10.1128/MCB.25.1.312-323.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES