Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2009 Apr 17;75(12):4202–4205. doi: 10.1128/AEM.02606-08

Characterization of P450 FcpC, the Enzyme Responsible for Bioconversion of Diosgenone to Isonuatigenone in Streptomyces virginiae IBL-14▿ †

Wei Wang 1, Feng-Qing Wang 1, Dong-Zhi Wei 1,*
PMCID: PMC2698366  PMID: 19376895

Abstract

A new cytochrome P450 monooxygenase, FcpC, from Streptomyces virginiae IBL-14 has been identified. This enzyme is found to be responsible for the bioconversion of a pyrano-spiro steroid (diosgenone) to a rare nuatigenin-type spiro steroid (isonuatigenone), which is a novel C-25-hydroxylated diosgenone derivative. A whole-cell P450 system was developed for the production of isonuatigenone via the expression of the complete three-component electron transfer chain in an Escherichia coli strain.


Nuatigenin-type steroids, such as nuatigenin and isonuatigenin (9, 13, 22), are rare natural steroidal sapogenins that are important pharmacological compounds. They are found in several healthy foods and traditional medicinal herbs. These compounds have been shown to have potential anticancer effects, antagonistic effects on rheumatoid arthritis, beneficial cardiovascular activities, and antimalarial activities. Examples include ophiofurospiside in Ophiopogon japonicus (28), nuatigenosido in Solanum sisymbriifolium (13), avenacoside in oat (20), and glycosides in Paris polyphylla SM (7). Since the majority of these nuatigenin-type steroids are very rare, strategies for their isolation can lead to very high production costs. As a result, with a more economical production process in mind, it would be worthwhile to search for a suitable reagent capable of converting the abundant amounts of pyrano-spirostanol sapogenins found in nature, such as diosgenone, to rare nuatigenin-type steroids. At this time, we plan to focus on microbial transformation systems.

A previous article (25) described an actinomycete strain named Streptomyces virginiae IBL-14, isolated from soil, that can transform diosgenone to isonuatigenone by introducing a hydroxyl group to the tertiary C-25 atom of the F-ring (Fig. 1). To our knowledge, this was the first report of producing a rare nuatigenin-type spiro steroid from diosgenone by microbial biotransformation. The present study was conducted in order to identify the determinant enzyme from S. virginiae IBL-14 that catalyzes the biotransformation and to design a whole-cell cytochrome P450 system to produce isonuatigenone by using Escherichia coli.

FIG. 1.

FIG. 1.

(Bio)synthetic conversion of diosgenone (1) to isonuatigenone (2) and nuatigenone (3). Diosgenone can be transformed into isonuatigenone by cytochrome P450 FcpC from S. virginiae IBL-14. Nuatigenone is the rearrangement product of isonuatigenone during acidic work-up (8).

Initial attempts to clone the genetic determinant for the biocatalytical activity.

Based on preliminary biochemical results suggesting that the catalytic enzyme in the IBL-14 strain is a cytochrome P450 monooxygenase (CYP), we attempted to isolate diverse CYP genes from S. virginiae IBL-14. The CYP-encoding genes cyp10, cyp20, cyp24, cyp71, wbyA, and yxlB were isolated by PCR using degenerate primers (Table 1) designed to bind to the conserved oxygen- and heme-binding domains of CYPs (12, 14). Four additional CYPs (expressed by cyp72, cyp73, cyp165, and fcpC) in this strain were also identified using high-stringency primers (Table 1) designed specifically against genes for CYPs that are related to the bioconversion of steroids and tertiary hydroxylations (4, 21).

TABLE 1.

PCR primers used for identifying CYP genes in this study

Primer Primer sequencea (5′ to 3′)
O2-binding domain primers
    OBD1 VTSGCSGGSCACGAGACSAC
    OBD2 TSCTSCTSATCGCSGGSCACGAGAC
Heme-binding domain
        primers
    HBD1 GCSAGGTTCGTSCCSAGGCACTGGTG
    HBD2 GCACTGGTGSAYSCCGTGSCCGAA
    HBD3 GCACTGGTGSACSCCGAASCGGAA
    HBD4 GCAGAAGTGSACSCCGTGSCCGAA
High-stringency primers
    1F CATGGACGACCCGSAGCAC
    1R CTGCCCCAGGCACTGGTG
    2F CGCCGGGCACCAGACCAC
    2R TTCTGCCCGAGGCACTGGTG
    3F CTCATCGCAGGGCACGAGA
    3R TGTCCCGGTGGATGTCGAA
    4F CGGACCACACCAGGYTGCG
    4R GTCTCGTAGCCAGCGATSAGCAG
    5F CGGAGATCTGCGGGATGTAC
    5R CCGATGCAGTAGTGGATGCC
    6F TACGACCCGCCGGAGCACA
    6R TGGTGAACGCCGTGYCCGA
a

Ambiguity codes: S, C or G; Y, C or T; and V, G or A or C.

The fcpC gene product serves as the enzyme for the C-25 hydroxylation of diosgenone.

To establish the in vivo function of the CYP gene products, we developed a genetic system in IBL-14 and disrupted each cyp gene by single-crossover homologous recombination. The inactivation of fcpC [to create the SCWF1 (ΔfcpC) mutant] by the insertion of PKC1139 (5, 27), a temperature-sensitive plasmid containing an apramycin resistance gene, led to significant disruption in the production of isonuatigenone (Fig. 2, line b).

FIG. 2.

FIG. 2.

High-pressure liquid chromatography and ESI-MS analyses of the bioconversion of diosgenone catalyzed by wild-type IBL-14, mutants, and recombinant E. coli cells. The ESI-MS analyses of diosgenone (1) and isonuatigenone (2) show ion peaks at m/z 413.7 ([M + H]+) and 429.6 ([M + H]+), respectively. Lines correspond to the wild type (a), SCWF1 (ΔfcpC) (b), SCWF2 (SCWF1::pCFCP11) (c), and E. coli resting cells expressing fcpC and redox partners (d).

A 0.8-kb fragment of fcpC was used as a probe against an IBL-14 subgenomic library in order to identify the full-length gene (Fig. 3). fcpC encodes a peptide of 397 amino acids (with a molecular mass of 43.77 kDa) that belongs to the CYP105 family. The closest match in the databases to the deduced amino acid sequence is the sequence of a putative P450 monooxygenase encoded by a secondary-metabolite biosynthetic gene cluster in Kitasatospora putterlickiae (GenBank accession number DQ792514), sharing 65% identity with FcpC. The fcpD gene, downstream of fcpC in the genome, is considered to encode the native ferredoxin for FcpC. The start codon of fcpD is GTG instead of ATG, as in fcpC, and the first nucleotide of its initiation codon immediately precedes the stop codon of fcpC. In addition, a possible ribosome-binding site (GGGA) 6 nucleotides upstream of the initiation codon was found.

FIG. 3.

FIG. 3.

Schematic diagram of the fcpCD operon of S. virginiae IBL-14. The size of each open reading frame in nucleotides (nt) and the predicted molecular mass in kilodaltons and the pI of each gene product are shown. In the sequence below, the start codon of fcpD is indicated by an arrow. The overlapping stop codon of fcpC and start codon of fcpD are underlined. The sequence of a possible ribosome-binding site (RBS) in fcpD is in italics.

A complementation test for the fcpC disruption was conducted by introducing fcpCD (1.5 kb) under the control of a constitutively expressed ermE* promoter (26). To this end, fcpCD was inserted into the plasmid pIB139 (creating pCFCP11, with a switch to kanamycin resistance) before conjugation into strain SCWF1. The diosgenone hydroxylation activity was restored in strain SCWF2 (SCWF1::pCFCP11) (Fig. 2, line c). These results clearly show that the enzyme FcpC is responsible for isonuatigenone production.

Conversion of diosgenone to isonuatigenone in vitro.

The fcpC gene was amplified from genomic DNA using PCR with the following primers: 5′-GCCCCCcatatgAGTGAGTCCCTCCACACCGTC (where an NdeI recognition sequence is in lowercase and the start of the coding sequence of fcpC is underlined) and 5′-GGAGgaattcACTTCGCGTCCCAGGTGAC (where the sequence in lowercase is an EcoRI recognition site and the underlined sequence is the reverse complement of the fcpC translation stop codon and is followed by the 3′-end sequence of the fcpC gene). The resulting fcpC DNA fragment was digested with NdeI/EcoRI and ligated into a pET28 vector previously digested with NdeI/EcoRI (creating pFCP1). This strategy generated an N-terminally His6-tagged FcpC construct (2, 24) for further biochemical characterization. After Ni-nitrilotriacetic acid chromatography (14, 29), the purified, red, recombinant P450 displayed (upon reduction) a signature peak at 450 nm in the CO difference spectrum (15, 19). Following desalting, FcpC was dissolved in 100 mM K2HPO4-KH2PO4, pH 7.3. A typical reaction mixture consisted of 1.90 ml of protein (containing 50 to 100 μg of FcpC), 3.5 μM spinach ferredoxin (Sigma), and 0.1 U of ferredoxin-NADPH reductase (Sigma) in a total assay volume of 2.0 ml (6). A total of 1 μl of the diosgenone substrate (as a solution in isopropanol) was added to obtain final concentrations varying between 0.1 and 20 μM. Following incubation at 30°C for 5 min, the reaction was started by the addition of NADPH to obtain a final concentration of 0.2 mM. The activity of the purified His-tagged FcpC was measured spectrophotometrically, following the consumption of NADPH at 340 nm and 30°C for 10 min (18). The data were used to fit the Lineweaver-Burk equation (in Microsoft Excel) in order to determine the enzymatic kinetic parameters. The production of isonuatigenone was detected by high-pressure liquid chromatography and electrospray ionization mass spectrometry (ESI-MS) analyses (data not shown).

Our results indicate that FcpC has a Km of 2.4 ± 0.8 μM, a Vmax of 0.024 ± 0.011 μmol/min/mg, and a turnover number of 1.06 min−1 for diosgenone hydroxylation. In comparison, the well-characterized bacterial CYP enzyme EryF, which is responsible for the hydroxylation of 6-deoxyerythronolide B to form erythronolide B in Saccharopolyspora erythraea, shows a turnover number of 52.8 min−1 for its natural substrate (1, 23). Since diosgenone is not the natural substrate for FcpC, this artificial substrate may not interact very well with the active site, leading to the observed lower turnover number. In addition, because the diosgenone substrate is not soluble in water (diosgenone concentration, <20 μM), it had to be dissolved in isopropanol in order to be added to the assay mixture. When the substrate solution was mixed with water, precipitation was observed immediately (diosgenone concentration, >60 μM). Given these observations, it is possible that the substrate may not have formed a proper solution under our assay conditions.

Bioconversion of diosgenone by E. coli resting cells expressing fcpC and redox partners.

CYPs are highly attractive biocatalysts due to their abilities to catalyze a variety of regio- and stereospecific oxidation reactions of complex organic compounds under mild conditions. This remarkable feat is accomplished by taking advantage of the two-electron activated dioxygen, which is often challenging in organic synthesis (10). In order to activate molecular oxygen, a redox partner(s) is required to sequentially transfer two reducing equivalents from NAD(P)H to CYP (11). This inherent requirement of cytochome P450 enzymes for protein partners significantly limits their application in biotechnology (16).

FcpC belongs to the class I P450 system, in which electrons are transferred from NADH or NADPH to the enzyme via a flavin adenine dinucleotide-containing reductase (ferredoxin reductase) and an iron-sulfur protein (ferredoxin). FcpD is considered to be the native ferredoxin for FcpC; however, the gene encoding the native S. virginiae IBL-14 ferredoxin reductase has not yet been cloned. Instead, preliminary CO-reduced spectrum results (see Fig. S11 in the supplemental material) indicate that SC4B10, one of three ferredoxin reductases from Streptomyces coelicolor A3(2) (3, 15, 17), helps increase the amount of active FcpC (11, 15, 16, 17). We constructed an operon in pFCP1 consisting of three genes and one expression plasmid by cloning fcpD and the ferredoxin reductase SC4B10 gene downstream of fcpC (Fig. 4). This new construct, pFCP2, was then expressed in E. coli BL21 Star(DE3)(pRARE).

FIG. 4.

FIG. 4.

Construction of an operon containing the S. virginiae IBL-14 cytochrome P450 gene fcpC, the corresponding ferredoxin gene fcpD, and the S. coelicolor SC4B10 ferredoxin reductase gene. The introduced gene fragments with restriction enzyme sites contained in pFCP2 are schematically presented.

After induction for 24 h with 0.2 mM IPTG (isopropyl-β-d-thiogalactopyranoside) at 20°C, transformed E. coli cells were harvested by centrifugation and resuspended in reaction buffer containing 100 mM K2HPO4-KH2PO4 and 1% (vol/vol) glycerol, pH 7.5. Following the addition of a 0.15% (vol/vol) solution of diosgenone in isopropanol (30 mg/ml), the reaction was allowed to proceed at 20°C, with shaking at 160 rpm. The level of conversion achieved a product yield exceeding 5% after 24 h of incubation (Fig. 2, d).

The biotransformation of E. coli cells to express the complete electron transfer chain resulted in a 12-fold increase in the rate of isonuatigenone production compared to the rate obtained using an E. coli strain expressing only fcpC and fcpD (0.42%). As a control, all E. coli strains expressing only one of the three proteins of the electron transfer chain showed no substrate conversion. The increase in isonuatigenone production was mediated by the inclusion of ferredoxin and ferredoxin reductase, which together stabilize the P450 enzyme and provide an optimal electron transfer system (11, 15, 16, 17).

In conclusion, compared to the traditional isolation strategy (9, 13, 22), our whole-cell system using FcpC from S. virginiae IBL-14 expressed in E. coli can be a potentially valuable method for producing rare nuatigenin-type steroids. Our future work will focus on improving the present fcpC biotransformation system by using different hosts, promoters, vectors, and cloned redox partners for the extensive utilization of novel derivatives of steroidal drugs.

Nucleotide sequence accession number.

The GenBank accession number for the fcpC and fcpD gene sequences identified in this study is EF646279.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank Hei-Qing Wang (Zhejiang University) for providing diosgenin and Mark Buttner (John Innes Institute, England) for providing plasmid PKC1139.

This research was financially supported by grants from the National Natural Science Foundation of China (no. 20777016) and the National Basic Research Program of China (no. 2009CB724703).

Footnotes

▿

Published ahead of print on 17 April 2009.

†

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1.Andersen, J. F., and C. R. Hutchinson. 1992. Characterization of Saccharopolyspora erythraea cytochrome P450 genes and enzymes, including 6-deoxyerythronolide B hydroxylase. J. Bacteriol. 174:725-735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bell, S. G., and L. L. Wong. 2007. P450 enzymes from the bacterium Novosphingobium aromaticivorans. Biochem. Biophys. Res. Commun. 360:666-672. [DOI] [PubMed] [Google Scholar]
  • 3.Bentley, S. D., K. F. Chater, A. M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147. [DOI] [PubMed] [Google Scholar]
  • 4.Bernhardt, R. 2006. Cytochromes P450 as versatile biocatalysts. J. Biotechnol. 124:128-145. [DOI] [PubMed] [Google Scholar]
  • 5.Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49. [DOI] [PubMed] [Google Scholar]
  • 6.Cane, D. E., and E. I. Graziani. 1998. Methymycin biosynthesis. Isolation of P450 monooxygenase activity in a cell-free system from Streptomyces venezuelae. J. Am. Chem. Soc. 120:2682-2683. [Google Scholar]
  • 7.Chen, C. X., Y. T. Zhang, and J. Zhou. 1995. The glycosides of aerial parts of Paris polyphylla var. yunnanensis. Acta Bot. Yunnan 17:473-478. [Google Scholar]
  • 8.Faini, F., R. Torres, and M. Castillo. 1983. (25R)-Isonuatigenin, an unusual steroidal sapogenin from Vestia lycioides. Phytochemistry 23:1301-1303. [Google Scholar]
  • 9.Ferro, E. A., N. L. Alvarenga, D. A. Ibarrola, M. C. Hellión-Ibarrola, and A. G. Ravelo. 2005. A new steroidal saponin from Solanum sisymbriifolium roots. Fitoterapia 76:577-579. [DOI] [PubMed] [Google Scholar]
  • 10.Guengerich, F. P. 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14:611-650. [DOI] [PubMed] [Google Scholar]
  • 11.Hannemann, F., A. Bichet, K. M. Ewen, and R. Bernhardt. 2007. Cytochrome P450 systems—biological variations of electron transport chains. Biochim. Biophys. Acta 1770:330-344. [DOI] [PubMed] [Google Scholar]
  • 12.Hyun, C.-G., J. M. Kim, S. K. Hong, and J. W. Suh. 1998. An efficient approach for cloning P450 hydroxylase genes from Actinomycetes. J. Microbiol. Biotechnol. 8:295-299. [Google Scholar]
  • 13.Ibarrola, D. A., M. C. Hellion-Ibarrola, N. L. Alvarenga, E. A. Ferro, N. Hatakeyama, N. Shibuya, M. Yamazaki, Y. Momose, S. Yamamura, and K. Tsuchida. 2006. Cardiovascular action of nuatigenosido from Solanum sisymbriifolium. Pharm. Biol. 44:378-381. [Google Scholar]
  • 14.Jungmann, V., I. Molnár, P. E. Hammer, D. S. Hill, R. Zirkle, T. G. Buckel, D. Buckel, J. M. Ligon, and J. P. Pachlatko. 2005. Biocatalytic conversion of avermectin to 4‴-oxo-avermectin: characterization of biocatalytically active bacterial strains and of cytochrome P450 monooxygenase enzymes and their genes. Appl. Environ. Microbiol. 71:6968-6976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li, L., M. R. Waterman, A. J. Fulco, S. L. Kelly, and D. C. Lamb. 2003. Availability of specific reductases controls the temporal activity of the cytochrome P450 complement of Streptomyces coelicolor A3(2). Proc. Natl. Acad. Sci. USA 101:494-499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Li, S. Y., L. M. Podust, and D. H. Sherman. 2007. Engineering and analysis of a self-sufficient biosynthetic cytochrome P450 PikC fused to the RhFRED reductase domain. J. Am. Chem. Soc. 129:12940-12941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Molnár, I., D. S. Hill, R. Zirkle, P. E. Hammer, F. Gross, T. G. Buckel, V. Jungmann, J. P. Pachlatko, and J. M. Ligon. 2005. Biocatalytic conversion of avermectin to 4‴-oxo-avermectin: heterologous expression of the ema1 cytochrome P450 monooxygenase. Appl. Environ. Microbiol. 71:6977-6985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nebert, D. W., and H. V. Gelboin. 1968. Substrate-inducible microsomal aryl hydroxylase in mammalian cell culture. I. Assay and properties of induced enzyme. J. Biol. Chem. 243:6242-6249. [PubMed] [Google Scholar]
  • 19.Omura, T., and R. Sato. 1964. The carbon monoxide binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J. Biol. Chem. 239:2370-2378. [PubMed] [Google Scholar]
  • 20.Osbourn, A. E. 1996. Preformed antimicrobial compounds and plant defense against funga1 attack. Plant Cell 8:1821-1831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Parajuli, N., D. B. Basnet, H. C. Lee, J. K. Sohng, and K. Liou. 2004. Genome analyses of Streptomyces peucetius ATCC 27952 for the identification and comparison of cytochrome P450 complement with other Streptomyces. Arch. Biochem. Biophys. 425:233-241. [DOI] [PubMed] [Google Scholar]
  • 22.Saijo, R., C. Fuke, K. Murakami, T. Nohara, and T. Tomimatsu. 1983. Two steroidal glycosides, aculeatiside A and B from Solanum aculeatissimum. Phytochemistry 22:733-736. [Google Scholar]
  • 23.Shafiee, A., and C. R. Hutchinson. 1987. Macrolide antibiotic biosynthesis: isolation and properties of two forms of 6-deoxyerythronolide B hydroxylase from Saccharopolyspora erythraea (Streptomyces erythreus). Biochemistry 26:6204-6210. [DOI] [PubMed] [Google Scholar]
  • 24.Taylor, M., D. C. Lamb, R. Cannell, M. Dawson, and S. L. Kelly. 1999. Cytochrome P450105D1 (CYP105D1) from Streptomyces griseus: heterologous expression, activity, and activation effects of multiple xenobiotics. Biochem. Biophys. Res. Commun. 263:838-842. [DOI] [PubMed] [Google Scholar]
  • 25.Wang, F. Q., B. Li, W. Wang, C. G. Zhang, and D. Z. Wei. 2007. Biotransformation of diosgenin to nuatigenin-type steroid by a newly isolated strain, Streptomyces virginiae IBL-14. Appl. Microbiol. Biotechnol. 77:771-777. [DOI] [PubMed] [Google Scholar]
  • 26.Wilkinson, C. J., Z. A. Hughes-Thomas, C. J. Martin, I. Bohm, T. Mironenko, M. Deacon, M. Wheatcroft, G. Wirtz, J. Staunton, and P. F. Leadlay. 2002. Increasing the efficiency of heterologous promoters in actinomycetes. J. Mol. Microbiol. Biotechnol. 4:417-426. [PubMed] [Google Scholar]
  • 27.Xiang, L. K., and B. S. Moore. 2002. Inactivation, complementation, and heterologous expression of encP, a novel bacterial phenylalanine ammonia-lyase gene J. Biol. Chem. 277:32505-32509. [DOI] [PubMed] [Google Scholar]
  • 28.Xu, T. H., Y. J. Xu, S. X. Xie, H. F. Zhao, D. Han, Y. Li, J. Z. Niu, and D. M. Xu. 2008. A novel steroidal glycoside, ophiofurospiside A from Ophiopogon japonicus (Thunb.) Ker-Gawl. J. Asian Nat. Prod. Res. 10:415-418. [DOI] [PubMed] [Google Scholar]
  • 29.Xue, Y., D. Wilson, L. Zhao, H. W. Liu, and D. H. Sherman. 1998. Hydroxylation of macrolactones YC-17 and narbomycin is mediated by the pikC-encoded cytochrome P450 in Streptomyces venezuelae. Chem. Biol. 5:661-667. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES