Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2009 Apr 24;191(13):4372–4382. doi: 10.1128/JB.00376-09

Role of Quorum Sensing in Sinorhizobium meliloti-Alfalfa Symbiosis▿ †

Nataliya Gurich 1, Juan E González 1,*
PMCID: PMC2698488  PMID: 19395488

Abstract

The ExpR/Sin quorum-sensing system of the gram-negative soil bacterium Sinorhizobium meliloti plays an important role in the establishment of symbiosis with its host plant Medicago sativa. A mutant unable to produce autoinducer signal molecules (sinI) is deficient in its ability to invade the host, but paradoxically, a strain lacking the quorum-sensing transcriptional regulator ExpR is as efficient as the wild type. We compared the whole-genome expression profile of the wild-type strain with strains missing one of the quorum-sensing regulatory components to identify genes controlled by the ExpR/Sin system throughout the different phases of the bacterial growth cycle, as well as in planta. Our analyses revealed that ExpR is a highly versatile regulator with a unique ability to show different regulatory capabilities in the presence or absence of an autoinducer. In addition, this study provided us with insight into the plant invasion defect displayed by the autoinducer mutant. We also discovered that the ExpR/Sin quorum-sensing system is repressed after plant invasion. Therefore, quorum sensing plays a crucial role in the regulation of many cell functions that ensures the successful invasion of the host and is inactivated once symbiosis is established.


Sinorhizobium meliloti is a gram-negative soil bacterium that can form a symbiotic association with its host plant Medicago sativa (alfalfa). To initiate this process, alfalfa secretes flavonoids that attract the bacteria toward its roots and activate transcription of the S. meliloti genes responsible for the production of a lipochitooligosaccharide signal molecule termed Nod factor. These Nod factors induce root hair curling and cell division leading to root nodule formation. S. meliloti then enters these nodules through a plant-induced, tubelike structure called the infection thread (24, 48). In the commonly used S. meliloti laboratory strain Rm1021, this process requires the synthesis of at least one of two symbiotically essential exopolysaccharides, succinoglycan or EPS II, to allow the invasion of a developing nodule (10, 20, 32, 57). Once inside the nodule, the bacteria stop dividing and differentiate into morphologically new forms called bacteroids, where they reduce atmospheric nitrogen into nitrogenated compounds for the plant. Symbiotic nitrogen fixation is a finely tuned process, and the inability to properly attach, produce exopolysaccharides, travel through the infection thread, or fully develop into bacteroids may result in a failed host-bacterium interaction (10, 17, 37).

As the bacteria move toward the host, they cluster around the roots and the cell population density rises. This increase in numbers leads to the coordinated regulation of bacterial genes in a process known as quorum sensing (23, 63). The ability to detect quorum is a widespread phenomenon in bacteria (31, 61). It relies on the production of specific signal molecules called autoinducers, which are used to detect the presence of other self-like bacteria in the environment and adjust the expression of specific genes accordingly. The best characterized of these signal molecules are N-acyl homoserine lactones (AHLs) produced by many gram-negative bacteria, such as S. meliloti, Photobacterium fischeri, Pseudomonas aeruginosa, and Agrobacterium tumefaciens (8, 15, 16, 22, 49, 51, 62, 63). AHLs accumulate with a rise of cell population density and, once they reach a particular threshold level, bind to their cognate transcriptional regulators. These active complexes interact with specific DNA sequences to facilitate the activation or repression of target genes (33). A variety of bacterial functions such as exopolysaccharide synthesis, motility, biofilm formation, and virulence are tightly controlled by quorum sensing in an array of symbiotic and pathogenic organisms (28, 35, 36, 38, 42, 59).

S. meliloti possesses a quorum-sensing system composed of two transcriptional regulators, SinR and ExpR, and the SinR-controlled autoinducer synthase SinI, which is responsible for the biosynthesis of AHLs (43, 44). These AHLs, in conjunction with the ExpR regulator, control a variety of downstream genes (34). Work in our laboratory has shown that the ExpR/Sin system induces the production of both succinoglycan and EPS II and plays an important role in adjusting motility and chemotaxis in response to cell population density (34, 35, 42). EPS II is encoded by the exp genes (11), and its synthesis is abolished in the absence of one or more of the quorum-sensing regulatory components (42, 50). The production of succinoglycan, which is encoded by the exo genes, decreases without a functional ExpR/Sin system (28). Expression of a majority of the motility and chemotaxis genes is downregulated by quorum sensing at a high cell population density (34, 35). Interestingly, inoculation of plants with a sinI-deficient strain results in a significant reduction in the total number of nodules per plant compared to that in the wild type, as well as a delay in the appearance of nitrogen-fixing nodules, leading to a decrease in plant development (42). Paradoxically, an ExpR transcriptional regulator mutant invades plants as efficiently as the wild type, irrespective of its ability to make AHLs (44).

The reason for the plant invasion deficiency by the sinI mutant, as well as the full spectrum of genes dependent on quorum sensing throughout all phases of the bacterial growth cycle, remain unclear. Hoang et al. investigated the genome-wide role of the ExpR/Sin quorum-sensing system by comparing wild-type bacteria during their mid-log phase of growth to sinI and expR quorum-sensing mutants (34). S. meliloti quorum sensing appeared to regulate over 200 genes, including those involved in exopolysaccharide synthesis, motility and chemotaxis, metal transport, and other metabolic functions. That work provided only a “snapshot” of the role of quorum sensing in S. meliloti, but its function during other stages of the bacterial growth cycle was not determined. Additionally, the role, if any, of the ExpR/Sin quorum-sensing system once the bacteria invaded the nodule was unknown.

Here we compared the whole-genome expression profiles between the strain with intact expR and sinI genes (Rm8530) and strains that lack either the sinI (Rm8530 sinI) or the expR (Rm1021) gene during the early, mid-, and late-log phases of growth. Since the Rm1021 strain contains a disruption of the expR gene, we refer to the expR plus strain (Rm8530) as the “wild type” throughout the text. The analyses of these strains provided us with a deeper understanding of the timing and intensity of the quorum-sensing control of many cell functions throughout the bacterial growth cycle in the free-living state. We identified groups of genes dependent on one or more regulatory components, including several novel genes, investigated their expression patterns, and assessed their effect on plant invasion. These extensive microarray analyses allowed us to propose a group of genes that might be responsible for the invasion defect shown by the sinI mutant and to explain the observation that the expR mutant is as proficient in symbiosis as the wild type. Furthermore, we evaluated the role of quorum sensing after the establishment of symbiosis by measuring bacterial gene expression inside of mature nodules. These studies have led us to determine the role of this regulatory system in free-living bacteria from low to high cell population density and through the course of the plant-bacterial interactions.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

For genetic manipulations, S. meliloti strains (Table 1) were grown in Luria-Bertani broth or agar supplemented with 2.5 mM MgSO4, 2.5 mM CaCl2, and the appropriate antibiotics. For RNA isolation, starter cultures were grown in 2 ml of TYC broth (5 g of tryptone, 3 g of yeast extract, and 0.4 g of CaCl2/liter) with streptomycin (500 μg/ml) for 48 h at 30°C. The strains were then subcultured (1:100) in 20 ml of minimal glutamate mannitol (MGM) low-phosphate medium (50 mM morpholineethanesulfonic acid [MOPS], 19 mM sodium glutamate, 55 mM mannitol, 0.1 mM K2HPO4/KH2PO4, 1 mM MgSO4, 0.25 mM CaCl2, 0.004 mM biotin, pH 7) and grown at 30°C with constant shaking. When necessary, chloramphenicol (20 μg/ml), gentamicin (75 μg/ml for S. meliloti and 10 μg/ml for Escherichia coli), hygromycin (75 to 100 μg/ml), or neomycin (200 μg/ml) was added.

TABLE 1.

Bacterial strains and plasmids used in this work

Strain or plasmid Relevant characteristicsa Source or reference
Strains
    Sinorhizobium meliloti
        Rm1021 Su47 str-21 expR 45
        Rm8530 Rm1021 expR+ 50
        Rm11527 Rm8530 sinI::Kmr 42
        Rm11511 Rm1021 sinI::Kmr 43
        Rm11601 Rm8530 flaA flaB This work
        Rm11602 Rm11527 flaA flaB This work
    Escherichia coli
        DH5α See source Life Technologies
Plasmids
    pRK600 pRK2013 (npt::Tn9), Cmr 19
    pMB419 pBluescript SK(−) derivative carrying a hygromycin cassette 6
    pJQ200SK Shuttle vector carrying sacB and a gentamicin cassette 52
    pJN105 araC-PBAD cassette cloned in pBBR1MCS-5 46
    pJNvisNvisR pJN105 containing the visN and visR genes, Gmr This work
    pflaA flaB/sacB flaA flaB-XbaI fragment in pJQ200SKGm This work
    pflaA flaB::Hy/sacB pflaA flaB/sacB carrying a hygromycin cassette within the flaA and flaB genes This work
a

Cmr, chloramphenicol resistance; Gmr, gentamicin resistance; Kmr, kanamycin resistance.

Construction of S. meliloti strains.

For construction of the flaA flaB mutant, we first amplified and cloned a fragment containing the flaA and flaB open reading frames into the XbaI site of pJQ200SK and created pflaA flaB/sacB using the following primers with XbaI (underlined) restriction endonucleases: XbaI-flaA-flaB long FWD (5′-GCCTCTAGATTGCCACCTTCATAATCG-3′) and XbaI-flaA-flaB long REV (5′-GCGTCTAGAGTTCATCAACCGCATAGG-3′). Second, a hygromycin cassette containing flaA- or flaB-specific 5′ linkers (underlined) was amplified from pMB419 with primers flaA-Hy FWD (5′-ACTCCGCAATGGCCGCGCTGCTGCAGAAAGGAATTACCAC-3′) and flaB-Hy REV (5′-GCGGAAGAGCGTAAGGACGCTAGTAACATAGATGACACCGCGC-3′). The amplified hygromycin cassette was then used as a primer for insertion/deletion PCR with pflaA flaB/sacB as a template using a modified version of the protocol described by Geiser et al. (26). The PCR conditions were as follows: 95°C for 5 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 68°C for 13 min; and a final extension at 70°C for 10 min (KOD polymerase; Novagen). The plasmid carrying the flaA flaB mutation was transformed into E. coli DH5α, transferred into Rm8530 by triparental mating, and selected on medium containing 5% sucrose and the appropriate antibiotics. The mutations were retransferred back into the Rm8530 and Rm8530 sinI strains by using the transducing phage φM12 as described previously (27).

To express the visN and visR genes constitutively in the Rm1021 strain, an arabinose-inducible pJNvisNvisR plasmid was constructed by ligation of a 1560-bp PCR fragment containing the open reading frame of visN and visR into an EcoRI/XbaI-digested pJN105 (46). The visN and visR fragment flanked by EcoRI and XbaI linkers (underlined) was amplified from Rm8530 with the primers EcoRI-visNvisR-XbaI FWD (5′-CGGAATTCTCCGGCACGGGGG-3′) and EcoRI-visNvisR-XbaI REV (5′-GCTCTAGATCCGCTGCCCCTGG-3′). The plasmid pJNvisNvisR was introduced into E. coli DH5α by transformation which was then used as a donor in a triparental mating with S. meliloti. Transconjugants were selected by plating on the appropriate antibiotics.

Plant nodulation assays.

Plant assays with the symbiotic host M. sativa were carried out in triplicate with at least 25 plants per strain per experiment. Five-milliliter S. meliloti cultures were grown in Luria-Bertani broth or agar supplemented with 2.5 mM MgSO4, 2.5 mM CaCl2 with the appropriate antibiotics at 30°C for 48 h. Cultures were washed four times with sterile water and 1 ml of a 1:100 dilution was used to inoculate 3-day-old plant seedlings on Jensen's agar as described previously (40). Plates were incubated at 22°C with 60% relative humidity and a 16-h light cycle. Plants were examined weekly, and after a 4-week period, the number of pink (nitrogen-fixing) and white nodules was recorded and averaged.

Complementation assays.

AHLs were extracted from Rm8530 cultures grown to late-log phase in 20 ml of MGM low-phosphate medium. Cells and supernatants were extracted with an equal volume of dichloromethane, dried, and resuspended in 200-μl aliquots of 70% methanol (44). These aliquots were added to growing cultures of Rm8530 sinI and Rm1021 sinI at optical densities at 600 nm (OD600s) of 0.1, 0.15, 0.5, and 1.0. Cells were then collected at a final OD600 of 0.2 or 1.2, RNA was extracted, and quantitative real-time PCR analysis was performed as described below.

Bacterial RNA isolation.

Cultures were grown at 30°C to OD600s of 0.2, 0.8, and 1.2 in MGM low-phosphate medium. Cells were harvested by centrifugation (14,000 × g for 2 min at 4°C), and the cell pellets were immediately frozen in liquid nitrogen. Total RNA was purified by using the RNeasy mini kit (Qiagen). Cells were resuspended in 10 mM Tris-HCl (pH 8) and disrupted in RNA lysis-Thiocyanate buffer (RLT) (supplemented with β-mercaptoethanol) in Fast Protein tubes (Qbiogene) by using a Ribolyser (Hybaid) (40 s, level 6.5) prior to spin column purification according to the RNeasy mini kit RNA purification protocol. The RNA samples were then treated with the Qiagen on-column RNase-free DNase. Samples were DNase treated a second time with the TURBO RNase-free DNase from Ambion according to the manufacturer's protocol, and RNA clean-up steps were performed according to the RNeasy mini kit's instructions (34). RNA integrity was determined in an Agilent 2100 Bioanalyzer, and the concentrations were measured with a Nanodrop spectrophotometer ND-1000.

Nodule RNA isolation.

Four-week-old nodules were harvested and RNA was isolated as described before (7). In short, a minimum of 800 mg of nodules was collected, frozen in liquid nitrogen, and stored at −80°C. For RNA isolation, nodules were ground in a previously chilled mortar to a powder and mixed with RLT lysis buffer (450 μl of RLT per each 135 mg of nodules). The mixture was then loaded on QIAshredder spin columns and centrifuged (14,000 × g for 2 min at room temperature). The flowthrough was transferred into a new collection tube and mixed with a 0.5 volume of 100% ethanol. Samples were loaded on an RNeasy column and RNA was isolated as described above in the bacterial RNA purification protocol. The amount of bacterial RNA in the nodules was determined based on the prokaryotic-to-eukaryotic rRNA ratios using the Agilent 2100 Bioanalyzer. On average, 30 to 33% of total RNA was identified as bacterial and 67 to 70% as plant derived.

Microarray experiments and data analyses.

Ten micrograms of total RNA from bacterial cultures grown to early, mid-, and late-logarithmic phases (OD600 values of 0.2, 0.8, and 1.2, respectively) was used for each experiment. To evaluate gene expression in bacteroids, 30 μg of total nodule RNA was prepared per sample to ensure a sufficient amount of bacterial RNA in each experiment. All RNA samples were prepared from two independent biological replicates per strain. The cDNA synthesis, labeling, and hybridizations to the S. meliloti/Medicago truncatula Affymetrix GeneChip (Santa Clara, CA) were performed according to a previously described protocol (7) by the Core Microarray Facility at UT Southwestern Medical Centre (Dallas, TX). A GeneChip Scanner 3000 was used to measure the signal intensity of each array, and all probe sets were scaled to the target signal value of 500. The .CEL files that were generated by the Affymetrix GeneChip Operating Software (GCOS version 1.4) were used for data analyses by the GeneSifter (VizX Labs) software. The arrays for gene expression in Rm8530 (considered here as the wild-type strain) were used as the baseline. The fold change in gene expression was calculated as the log2 X/Y, where X is the signal intensity for the mutant and Y is the signal intensity for Rm8530. Genes were considered to be differentially expressed if the fold change in expression was ≥2 or ≤−2 and the P value was ≤0.05.

Quantitative real-time PCR and reverse transcription-PCR (RT-PCR).

One microgram of RNA isolated from bacteria grown in culture was used per reaction. In order to equalize the amount of bacterial RNA isolated from bacteria grown in culture to RNA extracted from nodule bacteroids, 0.7 μg of culture and 2 μg of bacteroid RNA were used for cDNA synthesis. One microliter of the cDNA prepared with the RETROscript kit from Ambion was used as a template for the quantitative real-time PCR. The oligonucleotide sequences used for real-time PCR analysis are listed in Table 2.

TABLE 2.

Oligonucleotide sequences used in quantitative real-time PCR and RT-PCR analyses

Gene or locus tag Primer sequence (5′→3′)
Forward Reverse
SMc00128 GCAGTTCGACGAGCTGGATC TTGCGATCTTCGACAGCGG
16S RNA CTTAACCCAACATCTCACGACAC ACCTTACCAGCCCTTGACATC
SMc04171 TTTTCGTTCGCAGGTGTG GCAGCAGACCGAATGTATC
SMa2111 GATTACGCCGCAATATCC GTTTCCCTTAACCGACAG
SMb21543 CGGCAGCAGGTTTGACGAC GAACGATGTCCTCCAGCGAATC
visN GACGAACTGCTCCAGCATCTC GAACGGGCCGAAATCCGAGA
rem CGAAAGCCACATCAGCAAGC ATTCCAGTCGATGCAGTAGCC
flbT GTGACCTTCCTCCTGGAAAACC TCTGGGCGATGAAATAGAGCTG
expE2 GCCAAACACACGCTCGTCAT GCCACTCTCCGCAAGAGAAA
exsH CGGCGAACTTCGAGAACCTC TTCCCGACCCACCCTTTATGA
rhbA CACAGACGCCTTACATC CGTGCTGGATCATTCG
shmR GGTGGTGGACGCCCGAAAG CGGCTGAGCGGACGATGAG
sinI CCGGAAATCCGTAGTGCGTC ATGCGCGATCCTGGGAGATT
expR TTCGACTTCTACGGCATCGTG TCGGATCGATAACGACGTATTTCT
nifH ATATCGTTCAGCACGCAG GTCGCTCTTCATGATTCC
ftsZ2 ATGACGGAATACAAGAAGC GTTTGCGGCGATGAAATC

For quantitative real-time PCR analysis using SYBR green dye, each reaction mixture contained 0.3 μM of the sense oligonucleotide, 0.3 μM of the antisense oligonucleotide, 0.5× of SYBR green 1 (Sigma), and half of an OmniMix Hot Start PCR bead (each PCR bead contains 1.5 U of Taq DNA polymerase, 10 mM Tris-HCl [pH 9.0], 50 mM KCl, 1.5 mM MgCl2, 200 μM deoxynucleotide triphosphate, and stabilizers, including bovine serum albumin) in a 25-μl reaction volume. The experiment was performed in a Cepheid Smart Cycler version 2.0c as previously described (34). Expression of SMc00128 was used as an internal control for normalization as described previously (39).

For RT-PCR, 2.5 μl of 10× PCR buffer, 5 μl of 5× PCR buffer, 1 μl of deoxynucleotide triphosphate mix (10 mM), 1 μl of sense primer (30 μM), 1 μl of reverse primer (30 μM), and 0.2 μl of Taq DNA polymerase (2.5 U) were added to 1 μl of the target cDNA. The PCR conditions were as follows: 95°C for 5 min; 29 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. We used 16S RNA as a control for normalization (13). Products were electrophoresed on a 1% gel and stained with ethidium bromide for visualization.

RESULTS

In this study, we evaluated the role of the ExpR/Sin quorum-sensing system in S. meliloti at the early, mid-, and late-log phases of the bacterial growth cycle, as well as after the symbiosis establishment. Previous work in our laboratory identified over 200 genes as being quorum-sensing controlled at the mid-log phase of the bacterial growth cycle through the use of oligonucleotide arrays (34). Expression profile analyses of the wild-type strain (Rm8530) and strains that lacked either the autoinducer synthase gene sinI (Rm8530 sinI) or the transcriptional regulator expR (Rm1021) at different time points allowed us to identify the full spectrum of genes regulated at low and high cell population densities, mimicking the stages of growth found under natural conditions in bulk soil and in the plant milieu (see Table S1 in the supplemental material). The use of Affymetrix GeneChip arrays allowed for more accurate gene expression measurements, as well as the validation of previous findings. Analyses of the microarray data measuring expression throughout the bacterial growth cycle identified 473 and 267 genes either upregulated or downregulated by at least twofold in an expR mutant and a sinI mutant, respectively (see Fig. S1 in the supplemental material). A number of genes differentially expressed in both the sinI and expR mutants overlapped, and in total 530 unique genes were regulated in at least one of the compared strains over the entire course of cell growth in culture. Out of 530 genes, 250 genes were differentially expressed during the early log phase. That number increased to 362 at mid-log phase and to 376 at late-log phase. After further examination, we divided the ExpR/Sin-controlled genes into two main groups. Group I contained genes whose expression was found to be dependent on the ExpR transcriptional regulator but were independent of the presence of the sinI-encoded autoinducer molecules. The second group consisted of genes that require both ExpR and SinI for their proper expression (Fig. 1). Group II was further subdivided into genes that were differentially expressed in both the expR and sinI mutants early and maintained throughout all growth phases in culture (subgroup A) and genes that displayed a change in expression only during the early or later stages of growth (subgroup B). The expression of the genes in subgroup B appeared to be dependent on the bacterial growth phase, following the pattern most commonly associated with quorum-sensing-controlled genes. Detailed evaluation of the microarray data identified a small number of genes that were SinI dependent but independent of ExpR; however, most of them were excluded due to signal inconsistency or because the transcription levels were too close to the baseline. Therefore, AHL activity is intimately coupled to a functional ExpR for regulation of transcription. We chose representatives from the main identified groups to analyze in more detail.

FIG. 1.

FIG. 1.

Categories of genes controlled by the ExpR/Sin quorum-sensing system. Microarray analyses allowed us to divide the ExpR/Sin quorum-sensing system-dependent genes into two groups. Expression of the genes in group I depended on the transcriptional regulator ExpR and was independent of the presence of AHLs. Genes in group II required both ExpR and AHLs for proper expression and were subdivided into subgroups A and B. Subgroup A contained genes that were differentially expressed in both the expR and sinI mutants compared to that in the wild type during all phases of the bacterial growth cycle. Subgroup B consisted of genes that were differentially expressed only during early or later phases of growth.

Group I. ExpR-dependent SinI-independent genes.

Genes in group I were differentially expressed only in the expR mutant (Rm1021) compared to the wild-type (Rm8530) strain. The number of genes varied from 120 at low cell population density to 197 at high cell population density. One hundred forty-five of the 197 genes were induced in the presence of ExpR, while 52 were repressed. Out of the total number of genes, 96 were located on the chromosome, 33 on the pSymA, and 68 on the pSymB plasmids. Notably, 38 alleles on the second symbiotic plasmid were clustered (SMb20258 to SMb20394), and all were downregulated in the absence of ExpR. Among them were metabolic genes, genes encoding transporters, and five genes encoding transcriptional regulators (SMb20258, SMb20285, SMb20337, SMb20367, and SMb20392). SMb20258 and SMb20392 belong to the GntR, SMb20337 and SMb20367 to the TetR, and SMb20285 to the LysR families of regulators, all of which are predicted to control a variety of metabolic pathways (41, 53, 60). In addition, endoribonuclease L-PSP (SMa0089) was upregulated 42-fold at the early log phase and 77-fold at the late-log phase of growth in the expR mutant. To confirm that the presence of AHLs did not play a role in the regulation of genes belonging to group I, we measured by quantitative real-time PCR analysis the expression of several genes in a wild-type strain and in expR, expR sinI, and expR sinI, complemented with AHLs, strains. The presence or absence of autoinducer molecules had no significant effect on the transcription levels of these genes, but the presence of a functional expR was essential for their activation or repression, suggesting that ExpR can act as a regulator independent of AHLs. For example, expression of the endoribonuclease L-PSP (SMa0089) gene was about 200-fold higher (Fig. 2), while the transcription of genes such as fatty aldehyde dehydrogenase (SMb20262) and the spermidine putrescine transporter (SMb20284) was completely abolished in all strains that lacked a functional expR irrespective of the sinI status (data not shown).

FIG. 2.

FIG. 2.

Expression of the endoribonuclease L-PSP (SMa0089) gene is ExpR dependent and SinI independent. Gene expression was analyzed at late-log phase by quantitative real-time PCR and represented as a fold change in expression between the indicated strains and the wild type (wt). The expR sinI strain was complemented in trans by the addition of crude AHLs. Activity of SMa0089 is independent of AHLs and requires the presence of the intact expR gene.

The expR strain displayed a slight (one to two generations) but reproducible delay in reaching stationary phase in minimal medium, which could be due to its inability to activate one or more of the metabolic genes described above (data not shown). However, since the expR strain shows no plant invasion deficiencies, we concluded that these genes are not essential under our experimental conditions. Nevertheless, the regulatory role of ExpR in nature on survival and symbiosis establishment remains to be determined.

Group II. ExpR/SinI-dependent genes.

Genes included in group II required both the presence of the sin AHLs and the ExpR transcriptional regulator for proper regulation. In the absence of either one of these components, expression of these genes differed in both mutants compared to that in the wild type. The number of ExpR/Sin-dependent genes increased with bacterial growth from 71 at early log phase to 117 at late-log phase. Out of the total number of differentially expressed genes, 43 resided on the chromosome, 18 on the symbiotic plasmid pSymA, and 56 on pSymB.

Genes in group II were further divided into subgroups A and B. Subgroup A contained genes that appeared as differentially expressed in the sinI and the expR mutants throughout the bacterial growth cycle. Exopolysaccharide and calcium-binding protein synthesis genes made up a greater part of this category. Subgroup B genes were either upregulated or downregulated by the ExpR/Sin system during particular time points of the bacterial growth cycle. We evaluated the motility and chemotaxis genes as representatives of this set.

Subgroup A. ExpR/SinI-dependent, growth-phase-independent genes: regulation of the exopolysaccharide and calcium-binding protein genes.

The S. meliloti wild-type strain produces two symbiotically important exopolysaccharides, EPS II and succinoglycan. The requirement of AHLs and ExpR for EPS II synthesis at high cell population density has been previously described (42, 50). Based on our microarray studies, we established that in the wild-type strain, production of EPS II is strongly controlled by the ExpR/Sin system at all stages of growth (Table 3). All 22 of the EPS II biosynthetic genes (exp operon) were induced at the early log phase and were continuously upregulated with an increase in cell population density. The expression of selected genes was measured by quantitative real-time PCR, and the same trends in gene expression that we observed in the microarray analyses were confirmed (data not shown). These data expand our understanding of EPS II synthesis regulation, which depends on the presence of a functional ExpR and an autoinducer synthase and has a lower AHL concentration threshold for induction than other genes. This suggests that the ExpR-AHL complex has a high affinity for regulatory sequences involved in the expression of the exp gene family.

TABLE 3.

Microarray data of exopolysaccharide and calcium-binding protein genes induced by the ExpR/Sin quorum-sensing system

Locus tag Gene Fold change at indicated phasea
Early log
Mid-log
Late log
sinI vs wt expR vs wt sinI vs wt expR vs wt sinI vs wt expR vs wt
EPS II
    SMb21307 expE8 5.2 5.7 4.1 7.2 15.7 9.8
    SMb21308 expE7 10.5 9.0 35.5 17.3 31.6 23.4
    SMb21309 expE6 1.1 8.8 53.7 30.9 37.3 50.1
    SMb21310 expE5 7.7 7.7 13.3 13.2 22.6 20.6
    SMb21311 expE4 12.1 10.4 23.9 23.3 40.3 53.1
    SMb21312 expE3 14.2 13.4 36.2 76.9 161.1 60.9
    SMb21313 expE2 1.3 8.3 42.9 41.3 57.5 40.4
    SMb21314 expE1 5.6 4.1 16.3 24.5 27.8 38.7
    SMb21315 expD2 4.5 2.2 23.3 9.6 13.6 13.7
    SMb21316 expD1 3.2 1.7 4.5 5.7 4.1 4.6
    SMb21317 expG 2.4 2.1 10.8 18.3 10.1 13.6
    SMb21318 expC 11.9 5.9 27.7 45.0 30.3 29.6
    SMb21319 expA1 64.1 51.9 80.9 119.4 118.0 79.3
    SMb21320 expA23 24.2 19.5 52.2 89.3 36.8 76.0
    SMb21321 expA4 47.6 21.6 221.6 87.2 102.6 301.0
    SMb21322 expA5 22.5 21.3 57.8 47.6 65.8 59.1
    SMb21323 expA6 14.2 14.3 24.9 23.7 22.7 27.8
    SMb21324 expA7 27.5 11.1 7.7 7.2 19.3 14.7
    SMb21325 expA8 12.9 18.9 52.2 10.6 19.4 38.8
    SMb21326 expA9 94.5 69.3 52.3 69.0 286.2 105.1
    SMb21327 expA10 5.0 7.3 7.0 9.1 8.0 16.5
Succinoglycan
    SMb20932 exsH 14.3 7.3 26.8 15.5 14.5 15.9
    SMb20951 exoI 3.6 2.9 9.3 27.9 8.2 12.5
    SMb20955 exoK 2.1 1.2 4.1 2.2 2.5 1.8
    SMb20957 exoA 3.1 1.7 3.5 2.1 2.7 1.8
    SMb20958 exoM 3.2 1.5 5.9 2.3 2.9 2.9
    SMb20959 exoO 3.3 1.8 2.8 2.2 3.4 2.9
    SMb20960 exoN 2.5 1.7 4.5 2.6 2.8 2.6
    SMb20961 exoP 2.0 1.1 3.4 2.7 2.2 2.5
Calcium-binding proteins
    SMc04171 20.4 13.4 57.7 23.1 28.7 22.0
    SMa2111 6.5 9.2 21.6 19.5 24.2 30.6
    SMb21543 14.6 7.6 42.1 44.5 70.3 62.9
a

Values indicate fold change (upregulation) in gene expression in the wild-type (wt) strain compared to that in mutant strains. Bacterial cultures were collected at OD600s of 0.2 (early log phase), 0.8 (mid-log phase), and 1.2 (late-log phase).

Biosynthesis of succinoglycan has also been shown to be regulated by quorum sensing in a manner similar to EPS II. A number of succinoglycan biosynthetic genes (exo operon) appeared to be under ExpR/Sin system control as was previously described (28). Synthesis of the endo-1,3-1,4-β-glycanases encoded by exsH and exoK were induced during all phases of growth. These glycanases are essential for the production of the symbiotically active low-molecular-weight fraction of succinoglycan (65). Additional succinoglycan-related genes such as exoI, exoA, exoM, exoO, exoN, and exoP were upregulated in the wild-type strain (Table 3). Therefore, succinoglycan synthesis, and especially the production of its low-molecular-weight form, is induced by the ExpR/Sin system independent of cell population density.

In addition, we identified a set of genes (SMc04171, SMa2111, and SMb21543) with regulation patterns similar to those of the EPS II biosynthetic genes (Table 3). In the wild-type strain, these genes were induced by the ExpR/Sin system at all cell population densities but were not expressed in the sinI and expR mutants. Microarray data were confirmed by quantitative real-time PCR, and a dramatic difference in the expression of these genes between the wild type and both mutants was observed at all stages of growth (data not shown). All three genes encode putative calcium-binding proteins and, based on sequence analysis, have glycine-rich nanopeptide repeats characteristic of exported type I secretion proteins (14). The reliance on the ExpR/Sin system for expression at all cell population densities, the similarity in expression pattern with the EPS genes, and the putative extracellular location of these proteins suggest a possible functional link between exopolysaccharides and the calcium-binding proteins. This and other hypotheses are under further investigation at the present time.

Subgroup B. ExpR/SinI-dependent, growth-phase-dependent genes: regulation of motility during different phases of growth.

Recent studies in our laboratory and others described the control of motility and chemotaxis in S. meliloti by quorum sensing (4, 34, 35). Microarray and quantitative real-time PCR analyses revealed that the ExpR/Sin system adjusts the expression of the transcriptional regulators VisN/VisR and Rem, which in turn modulate downstream motility genes in a population-density-dependent manner (35). The wild-type strain is motile during the early log phase of growth but it shuts down flagella synthesis genes during the mid- and late-log phases. In contrast, the sinI mutant expresses the motility genes throughout all phases of growth, and at the late-log phase, 35 motility and chemotaxis genes were identified as differentially expressed compared to those of the wild type. On the other hand, the expR mutant displays a decrease in the expression of the motility genes during the entire growth cycle. Complementation of an expR strain with a plasmid carrying the visN and visR genes expressed under a constitutive promoter during the early log phase allowed us to bypass control by expR and restored expression of the motility genes to wild-type levels (Fig. 3). This suggests that at a low cell population density, ExpR acts as an activator of the motility and chemotaxis genes.

FIG. 3.

FIG. 3.

The transcriptional regulator ExpR is required for activation of the motility genes at a low cell population density. Expression of the motility genes visN, rem, and flbT in the wild-type strain versus the expR mutant and the expR mutant complemented with constitutively expressed visN and visR on a plasmid during the early log phase of growth (OD600, 0.2). The relative expression is calculated as the fold change between the wild type and mutant strains. The positive number indicates upregulation of gene expression in the mutant, and the negative number indicates downregulation compared to that in the wild type. Constitutive expression of visN and visR bypasses the need of ExpR for activation of the motility genes.

The role of AHL concentration on gene regulation.

An extensive evaluation of the microarray data from different time points of the bacterial growth cycle identified genes that require both a functional ExpR transcriptional regulator and an autoinducer synthase. Within this group, we identified genes that were differentially expressed in the sinI strain compared to those in the wild type consistently at all cell densities (subgroup A) or only during the early log phase or later stages of growth (subgroup B). Genes in subgroup A, such as the previously discussed exopolysaccharide and calcium-binding protein genes, displayed dramatic differences in transcription throughout the entire bacterial growth cycle and were defined as growth phase independent. Low concentrations of AHLs found in the early growth phases were sufficient for high levels of expression of these genes, indicating that production of EPS and calcium-binding proteins is independent of cell population density, despite requiring a functional sinI. On the other hand, genes in subgroup B were defined as growth phase dependent. For example, in the wild-type strain, rhizobactin biosynthesis genes (SMa2337, SMa2339, and SMa2400 to SMa2414) showed lower levels of expression than the sinI mutant during the early stages of growth. That difference was eliminated at the mid- and late-log phases. Other genes, such as the Sinorhizobium heme receptor (SMc02726 or shmR) (2), were upregulated in the sinI mutant upon reaching the logarithmic phase and continued to be induced throughout the stationary phase (see Table S1 in the supplemental material). As for the motility genes, slight variations were detected at the early log phase, which amplified with cell growth. In order to determine whether growth-dependent changes in gene expression were the result of the concentration of AHLs, we examined the dependence of gene expression on AHLs by complementation assays. We added exogenous AHLs collected from the wild-type strain at late-log phase to the sinI mutant strain, stopped growth during the early and late-log phases, and measured the transcription levels of particular genes. We observed that expression of the exopolysaccharide and calcium-binding protein genes (subgroup A) was restored to the late-log-phase, wild-type levels at both phases of growth (Fig. 4A). However, the addition of AHLs failed to bring expression of the flagellar genes (subgroup B) during the early log phase of growth to the late-log-phase wild-type level (Fig. 4B). High concentrations of AHLs were not sufficient to repress genes for flagella synthesis at low cell density in the sinI mutant, although supplementation with signal molecules at the late-log phase successfully shuts off motility gene expression. These findings suggest that while some cell functions in S. meliloti adjust to late-log-phase levels with high concentrations of AHLs, others require the presence of additional phase-related factors.

FIG. 4.

FIG. 4.

Dependence of gene expression on AHL concentration during the different phases of the bacterial growth cycle. Expression of representative genes from ExpR/SinI-dependent, growth phase-independent (expE2) (A), and growth phase-dependent (rem) (B) subgroups was measured by quantitative real-time PCR in the wild type (wt), the sinI mutant, and the sinI mutant complemented with AHLs. Cultures were grown to early (OD600, 0.2) and late log (OD600, 1.2) phases. Results were compared to the respective gene expression in the wild-type strain at the early log phase of growth. The addition of AHLs to the sinI mutant restored expE2 expression to the late-log-phase, wild-type level regardless of the growth phase but failed to repress expression of rem at the early log phase. wt, wild type.

Repression of the motility genes is essential for effective nodule invasion.

Plants inoculated with the sinI mutant formed approximately 30% fewer nodules than plants inoculated with the wild-type strain (Fig. 5). In addition, the sinI mutant did not invade the plant as efficiently as the wild-type strain, resulting in fewer nitrogen-fixing pink nodules than white nodules. At the same time, the expR and expR sinI mutants showed no deficiencies in plant invasion. To determine the reason for this phenomenon, we evaluated the microarray results and isolated genes that were differentially expressed in the sinI strain, but not in the expR strain, compared to wild type at the late-log phase of growth. Sixty-two genes were identified, 26 of which were motility-related genes. This suggested that the inability of the sinI mutant to repress flagella synthesis at high cell population density might be detrimental to successful plant invasion and that the expR mutant can form a symbiosis with its host as well as the wild-type strain due to downregulation of the motility genes during all phases of growth. Failure to block flagellar synthesis when S. meliloti accumulates in the plant milieu may interfere with efficiency of the symbiosis establishment.

FIG. 5.

FIG. 5.

The inability to shut down flagellum synthesis in the sinI mutant interferes with its invasion efficiency. High levels of expression of the motility genes in the sinI mutant resulted in a reduction of the percentage of invaded nodules compared to that of the wild type. Strains with the expR and the expR sinI mutations showed no invasion defects since the presence of ExpR is necessary for activation of the motility genes. Mutation of the flagellum structural genes flaA and flaB in the sinI background restored the sinI mutant's symbiosis ability to wild-type levels, suggesting that the presence of flagella interferes with plant invasion. Data are significant at a P level of < 0.01.

To test this hypothesis, we introduced a mutation in the flagellin synthesis genes flaA and flaB into the wild type and the sinI backgrounds, which resulted in a complete loss of flagellum production (54; data not shown). If the sinI strain was to have a disadvantage in establishing symbiosis because of the inappropriate presence of flagella during the invasion process, then a strain unable to synthesize flagella should be able to invade successfully, regardless of the status of the quorum-sensing system. Figure 5 shows the invasion efficiency of the wild-type strain and the sinI, expR, expR sinI, flaA flaB, and sinI flaA flaB mutants 4 weeks postinoculation. The ratio of pink to white nodules is 9:1 in the wild type. Strains with expR, expR sinI, and flaA flaB mutations invaded plants as efficiently as the wild type, while the ratio of pink to white nodules was altered to 6:4 in the sinI mutant. However, blocking flagellar synthesis in the sinI strain (sinI flaA flaB) completely restored its competency for establishing symbiosis to wild-type levels. Therefore, the suppression of flagellum production by the ExpR/Sin quorum-sensing system at a high cell population density plays an important role in plant invasion and may provide a competitive edge for strains possessing it.

Quorum sensing in the nodule.

To evaluate the role of the ExpR/Sin quorum-sensing system in planta, we performed a genome-wide expression profile analysis using cDNA of RNA from bacteroids isolated from nodules 4 weeks postinoculation. Our study revealed a limited number of genes differentially expressed between the quorum-sensing mutants and the wild type in the nodule, but these differences were either too close to the baseline or inconsistent between the strains, suggesting that quorum sensing does not play a role in gene regulation after the invasion is completed (see Table S2 in the supplemental material). To validate our findings, we compared the expression levels of genes in free-living bacteria and in bacteroids. We observed the activation of genes involved in nitrogenase synthesis (nif) and microoxic respiration (fix) in bacteroids. On the other hand, many ribosomal (rplM, rpsA), translation (infA, fusA), metabolic (phoB, rhbABCDEF), and cell division (ftsZ1, ftsZ2) genes were repressed in planta compared to free-living bacteria. Our data correlate with previously published findings by other laboratories, which have evaluated bacterial gene expression inside the nodule (3, 9, 12, 13). All ExpR/Sin quorum-sensing components (sinR, sinI, and expR) were dramatically downregulated inside the nodule. Transcription levels in wild-type bacteroids were reduced by 149-fold for sinR, 39-fold for sinI, and 23-fold for expR. All quorum-sensing-induced genes, such as EPS and calcium-binding protein genes, were repressed as well. The microarray data were confirmed by quantitative real-time (data not shown) and RT-PCR analyses using samples collected at different time points of plant development (Fig. 6). Expression of expR and sinI was detected only in free-living cultures and could no longer be observed in bacteroids. A similar pattern was observed for ExpR/Sin-dependent genes, such as the calcium-binding protein synthesis gene SMc04171. Transcription of the nitrogen fixation genes, for example, nifH, was induced in the nodules 8 days postinoculation and increased over time, while the expression of cell division genes such as ftsZ2 decreased, as previously reported (3, 9, 12, 13). We used the constitutively expressed ribosomal gene 16S as a control. Based on our studies, we conclude that the ExpR/Sin quorum-sensing system plays an essential role in gene regulation before and during plant invasion but is inactivated once symbiosis is established.

FIG. 6.

FIG. 6.

RT-PCR expression analysis of the ExpR/Sin system components and quorum-sensing-dependent genes in free-living bacteria and bacteroids. Expression levels of the sinI, expR, and quorum-sensing-dependent, calcium-binding protein SMc04171 genes were evaluated in the wild type grown to the late-log phase (OD600, 1.2) and in bacteroids formed by this strain in nodules 8 days and 4 weeks postinoculation. Expression levels of the previously evaluated genes nifH and ftsZ2 were used as a reference and the 16S rRNA gene as a control. Quorum-sensing regulatory components and genes dependent on them are inactive after the symbiosis establishment.

DISCUSSION

Quorum sensing is defined as a fine-tuning mechanism of gene regulation in response to cell population density and is common among bacteria that can form symbiotic or pathogenic associations with eukaryotic hosts. In the classic quorum-sensing model, bacterial cells produce signal molecules, autoinducers, which are released into the environment. With an increase in cell population density, autoinducers accumulate, reach a particular threshold concentration level, and bind to their cognate transcriptional regulators, resulting in the induction or repression of target genes. However, more recent studies of P. aeruginosa indicate that gene regulation depends on more than just the signal concentration (55, 56, 64). The addition of autoinducer to cultures or expression of quorum-sensing system components during different growth phases resulted in variable gene expression. Some genes were activated or repressed during the early phases of growth, while others were activated or repressed only during the stationary phase, suggesting that additional factors play a crucial role in the timing of gene regulation. In this study, the potential for a similar complexity of gene regulation by the quorum-sensing system of S. meliloti was examined.

We performed our studies with the idea of providing a regulatory “road map” of the genes dependent on quorum sensing, their timing of expression in free-living S. meliloti, and the role of the ExpR/Sin regulatory system after symbiosis establishment. Another goal was to ascertain why the sinI mutant, but not the expR mutant, is deficient in plant invasion. We evaluated the role of quorum sensing in gene regulation during the lag- (early), middle of the logarithmic (mid-log), and beginning of the stationary (late) phases of the bacterial growth cycle and assessed its function inside the nodule.

These extensive analyses identified 530 genes that were differentially expressed in at least one of the mutant strains compared to the wild type over the entire course of the bacterial growth in culture. Comparing the levels and timing of gene expression allowed us to classify these genes into two main groups: group I, ExpR-dependent and SinI-independent genes; and group II, ExpR/SinI-dependent genes (Fig. 1). As the classification suggests, a functional ExpR is required for proper expression of the genes in both groups. Genes in group I are controlled irrespective of the presence of AHLs, indicating that ExpR can act as a gene regulator without AHLs. The majority of the group I genes appeared to be activated by ExpR and involved in metabolic processes. Genes in group II need autoinducer molecules for regulation, suggesting that an interaction between ExpR and AHLs is required for proper gene expression. Interestingly, some of these genes showed differences in transcript levels during all phases of growth in culture while others did so only during the early or later stages. Based on this observation, genes in the first category were called growth phase independent (subgroup A) and the later ones growth phase dependent (subgroup B).

Genes in subgroup A were involved in regulating the synthesis of the symbiotically important exopolysaccharides, succinoglycan and EPS II, and a series of the secreted calcium-binding proteins (SMc04171, SMa2111, and SMb21543). It appears that even the small amounts of AHLs observed during the early (prequorum) growth phases are sufficient for activation of these genes in conjunction with ExpR. Production of exopolysaccharides by a single cell is important for water retention and protection against environmental toxic compounds and desiccation (58); therefore, the early biosynthesis of exopolysaccharides and these particular calcium-binding proteins may be critical for bacterial survival in the environment. Previous work in our laboratory has described the role of quorum sensing in the regulation of exopolysaccharide synthesis (28, 42). The precise role of the calcium-binding proteins in S. meliloti is still unknown. The similarity in their gene expression pattern to that of the EPS genes and the putative extracellular location of these proteins suggest that in the wild-type bacteria, calcium-binding proteins may play a role in plant invasion.

Motility and chemotaxis genes represented a large part of the genes that appeared to be dependent on the growth phase for regulation by the ExpR/Sin quorum-sensing system (subgroup B). In the wild-type strain, the accumulation of AHLs causes repression of the motility and chemotaxis genes (35). Elegant work by Bahlawane et al. (4) recently showed that AHL-bound ExpR binds to the promoter region of the transcriptional regulator visN and inhibits its expression, resulting in repression of flagellum synthesis and a decrease in swarming. This correlates with our observations of a decrease in the expression of the motility genes in the absence of this regulator (35) and suggests that ExpR is required for activation of these genes at a low cell population density (i.e., no AHLs or low levels of AHLs). Complementation of the expR strain with constitutively expressed visN and visR on a plasmid allowed us to bypass the need for ExpR and restore expression of the motility genes during the early log phase of growth to wild-type levels. This confirms that ExpR is essential for the early activation of the visN and visR transcriptional regulators and consequently the other motility genes, as well as their repression in conjunction with AHLs. It seems that free ExpR and the ExpR-AHL complex compete for control of the motility genes. At a low cell population density, free ExpR is available for induction of visN and visR. With a rise in cell population density and AHL concentration, the ExpR-AHL complex outcompetes the AHL-unbound ExpR, binds upstream of visN and visR, and blocks their expression as shown by Bahlawane et al. (4).

ExpR belongs to the orphan LuxR homolog family of transcriptional regulators (21, 47). These regulators often control a variety of cell functions depending on the AHL concentration. For example, in Erwinia species in the absence of AHLs, the transcriptional regulator VirR/ExpR2 inhibits virulence genes by repressing the expression of another regulator, RsmA. At a high cell population density, AHLs bind to VirR/ExpR2 and sequester it from the rsmA promoter, resulting in the induction of virulence factors (5, 47). In other cases, AHL synthesis is not required for the regulatory activity of the LuxR. For instance, in Xanthomonas species, orphan LuxRs OryR and XccR mediate gene regulation in the absence of AHLs, suggesting alternative mechanisms for their activation (18, 66). Interestingly, both patterns of control are observed in the case of ExpR. During low cellular AHL concentrations, motility is activated through ExpR, while with increasing concentrations of AHLs, motility is repressed. Concomitantly, ExpR regulates the genes in group I independent of the presence or absence of AHLs. This suggests that unbound ExpR can control expression of genes and gains additional regulatory properties in conjunction with AHLs. To our knowledge, this is the first report of a single orphan LuxR homolog possessing both capabilities. The mode of action of this unique quorum-sensing regulator requires further investigation.

Our expression analysis also allowed us to explain the particular observation that the sinI mutant does not invade plants efficiently, while the expR mutant invades as well as the wild type. These data suggested that the sinI mutant's inability to repress the synthesis of flagella at a high cell population density interfered with the establishment of symbiosis, leading to a reduction in the total number of nodules produced by the plant and a decrease in the pink-to-white nodule ratio compared to plants inoculated with the wild-type strain or the expR mutant. Indeed, a sinI mutant incapable of producing flagella regained the full capacity to establish symbiosis. Therefore, the ExpR/Sin quorum-sensing system plays a critical role in the timely control of expression of the motility and chemotaxis genes. In nature, activation of these genes at low cell population densities is essential for the bacteria's ability to find nutrients or to reach their host. At high cell population densities, such as those found in close proximity to the host root, repression of flagellar production might be necessary for proper plant invasion. It is unclear at this stage if the presence of flagella interferes with bacterial attachment to the plant roots, blocks its movement through the infection thread, or leads to an inappropriate plant defense response. The role of flagellin as an elicitor of the innate host defense response in animals and plants is well documented. Exposure of Arabidopsis thaliana seedlings to the flagellin-derived peptide, flg22, from Pseudomonas syringae results in callose deposition, inhibition of growth, and activation of the host defense genes. In contrast, a corresponding peptide from S. meliloti is inactive as an elicitor in A. thaliana (1, 29, 30). However, the possibility that S. meliloti flagella can induce a series of defense responses in its associated plant host remains to be explored.

Clearly, the ExpR/Sin quorum-sensing system plays an important regulatory role in free-living S. meliloti as well as during the host invasion process. Its role once inside the plant host remained elusive. Given the fact that bacteria are found within nitrogen-fixing nodules in high numbers, allowing for the possible accumulation of AHLs, we investigated whether the ExpR-AHL complex continues to regulate gene expression in bacteroids. Our microarray and detailed expression analyses show that all key quorum-sensing genes and the genes controlled by them are repressed in bacteroids. Recently, Gao et al. measured expression of the sinI and the EPS II transcriptional regulator expG genes fused to a gus reporter in planta (25). Their work showed an increase in the transcription of these genes inside the nodule. However, the use of fusions has the potential for accumulation of the reporter protein. The direct assessment of transcript levels circumvents this possibility, providing a more accurate measurement of gene expression. Based on our results, we conclude that quorum sensing does not play a regulatory role once symbiosis is established.

In free-living S. meliloti, the ExpR/Sin quorum-sensing system controls numerous cell functions essential for successful plant invasion. Some genes require only ExpR, regardless of the presence or absence of AHLs, while others need both ExpR and AHLs for proper regulation. Genes such as those involved in exopolysaccharide biosynthesis and the production of calcium-binding proteins are activated by the ExpR/Sin quorum-sensing system early and continue to be expressed during all phases of growth until nodule invasion. In contrast, cell functions, such as flagellar and rhizobactin synthesis, are induced or repressed during particular stages of the bacterial growth cycle, taking advantage of the versatility of ExpR to act in different ways depending on the status of the cell. Once symbiosis is established, quorum sensing is repressed by a yet-undetermined mechanism, and all metabolic functions of the bacteroids are directed toward nitrogen fixation.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank Ann Hirsch and the members of our laboratory for helpful discussions and critical reading of the manuscript.

This work was supported by National Science Foundation grant MCB-9733532 and National Institutes of Health grant 1R01GM069925 to J.E.G.

Footnotes

▿

Published ahead of print on 24 April 2009.

†

Supplemental material for this article may be found at http://jb.asm.org/.

REFERENCES

  • 1.Abramovitch, R. B., J. C. Anderson, and G. B. Martin. 2006. Bacterial elicitation and evasion of plant innate immunity. Nat. Rev. Mol. Cell Biol. 7601-611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Amarelle, V., M. R. O'Brian, and E. Fabiano. 2008. ShmR is essential for utilization of heme as a nutritional iron source in Sinorhizobium meliloti. Appl. Environ. Microbiol. 746473-6475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ampe, F., E. Kiss, F. Sabourdy, and J. Batut. 2003. Transcriptome analysis of Sinorhizobium meliloti during symbiosis. Genome Biol. 4R15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bahlawane, C., M. McIntosh, E. Krol, and A. Becker. 2008. Sinorhizobium meliloti regulator MucR couples exopolysaccharide synthesis and motility. Mol. Plant-Microbe Interact. 211498-1509. [DOI] [PubMed] [Google Scholar]
  • 5.Barnard, A. M., and G. P. Salmond. 2007. Quorum sensing in Erwinia species. Anal. Bioanal. Chem. 387415-423. [DOI] [PubMed] [Google Scholar]
  • 6.Barnett, M. J., V. Oke, and S. R. Long. 2000. New genetic tools for use in the Rhizobiaceae and other bacteria. BioTechniques 29240-245. [DOI] [PubMed] [Google Scholar]
  • 7.Barnett, M. J., C. J. Toman, R. F. Fisher, and S. R. Long. 2004. A dual-genome Symbiosis Chip for coordinate study of signal exchange and development in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA 10116636-16641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bassler, B. L. 1999. How bacteria talk to each other: regulation of gene expression by quorum sensing. Curr. Opin. Microbiol. 2582-587. [DOI] [PubMed] [Google Scholar]
  • 9.Becker, A., H. Bergès, E. Krol, C. Bruand, S. Rüberg, D. Capela, E. Lauber, E. Meilhoc, A. Ampe, F. J. de Bruijn, J. Fourment, A. Francez-Charlot, D. Kahn, H. Küster, C. Liebe, A. Pühler, S. Weidner, and J. Batut. 2004. Global changes in gene expression in Sinorhizobium meliloti 1021 under microoxic and symbiotic conditions. Mol. Plant-Microbe Interact. 17292-303. [DOI] [PubMed] [Google Scholar]
  • 10.Becker, A., S. Rüberg, B. Baumgarth, P. A. Bertram-Drogatz, I. Quester, and A. Pühler. 2002. Regulation of succinoglycan and galactoglucan biosynthesis in Sinorhizobium meliloti. J. Mol. Microbiol. Biotechnol. 4187-190. [PubMed] [Google Scholar]
  • 11.Becker, A., S. Rüberg, H. Kuster, A. A. Roxlau, M. Keller, T. Ivashina, H. P. Cheng, G. C. Walker, and A. Pühler. 1997. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products. J. Bacteriol. 1791375-1384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cabanes, D., P. Boistard, and J. Batut. 2000. Identification of Sinorhizobium meliloti genes regulated during symbiosis. J. Bacteriol. 1823632-3637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Capela, D., C. Filipe, C. Bobik, J. Batut, and C. Bruand. 2006. Sinorhizobium meliloti differentiation during symbiosis with alfalfa: a transcriptomic dissection. Mol. Plant-Microbe Interact. 19363-372. [DOI] [PubMed] [Google Scholar]
  • 14.Delepelaire, P. 2004. Type I secretion in gram-negative bacteria. Biochim. Biophys. Acta 1694149-161. [DOI] [PubMed] [Google Scholar]
  • 15.Engebrecht, J., K. Nealson, and M. Silverman. 1983. Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32773-781. [DOI] [PubMed] [Google Scholar]
  • 16.Engebrecht, J., and M. Silverman. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl. Acad. Sci. USA 814154-4158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ferguson, G. P., R. M. Roop II, and G. C. Walker. 2002. Deficiency of a Sinorhizobium meliloti BacA mutant in alfalfa symbiosis correlates with alteration of the cell envelope. J. Bacteriol. 1845625-5632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ferluga, S., J. Bigirimana, M. Höfte, and V. Venturi. 2007. A LuxR homologue of Xanthomonas oryzae pv. oryzae is required for optimal rice virulence. Mol. Plant Pathol. 8529-538. [DOI] [PubMed] [Google Scholar]
  • 19.Finan, T. M., B. Kunkel, G. F. De Vos, and E. R. Signer. 1986. Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes. J. Bacteriol. 16766-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fraysse, N., F. Couderc, and V. Poinsot. 2003. Surface polysaccharide involvement in establishing the rhizobium-legume symbiosis. Eur. J. Biochem. 2701365-1380. [DOI] [PubMed] [Google Scholar]
  • 21.Fuqua, C. 2006. The QscR quorum-sensing regulon of Pseudomonas aeruginosa: an orphan claims its identity. J. Bacteriol. 1883169-3171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fuqua, C., and E. P. Greenberg. 1998. Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr. Opin. Microbiol. 1183-189. [DOI] [PubMed] [Google Scholar]
  • 23.Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 50727-751. [DOI] [PubMed] [Google Scholar]
  • 24.Gage, D. J. 2004. Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol. Mol. Biol. Rev. 68280-300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Gao, M., and M. Teplitski. 2008. RIVET: a tool for in vivo analysis of symbiotically relevant gene expression in Sinorhizobium meliloti. Mol. Plant-Microbe Interact. 21162-170. [DOI] [PubMed] [Google Scholar]
  • 26.Geiser, M., R. Cebe, D. Drewello, and R. Schmitz. 2001. Integration of PCR fragments at any specific site within cloning vectors without the use of restriction enzymes and DNA ligase. BioTechniques 3188-92. [DOI] [PubMed] [Google Scholar]
  • 27.Glazebrook, J., and G. C. Walker. 1991. Genetic techniques in Rhizobium meliloti. Methods Enzymol. 204398-418. [DOI] [PubMed] [Google Scholar]
  • 28.Glenn, S. A., N. Gurich, M. A. Feeney, and J. E. González. 2007. The ExpR/Sin quorum-sensing system controls succinoglycan production in Sinorhizobium meliloti. J. Bacteriol. 1897077-7088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gómez-Gómez, L., and T. Boller. 2002. Flagellin perception: a paradigm for innate immunity. Trends Plant Sci. 7251-256. [DOI] [PubMed] [Google Scholar]
  • 30.Gómez-Gómez, L., G. Felix, and T. Boller. 1999. A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J. 18277-284. [DOI] [PubMed] [Google Scholar]
  • 31.González, J. E., and M. M. Marketon. 2003. Quorum sensing in nitrogen-fixing rhizobia. Microbiol. Mol. Biol. Rev. 67574-592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.González, J. E., G. M. York, and G. C. Walker. 1996. Rhizobium meliloti exopolysaccharides: synthesis and symbiotic function. Gene 179141-146. [DOI] [PubMed] [Google Scholar]
  • 33.Hanzelka, B. L., and E. P. Greenberg. 1995. Evidence that the N-terminal region of the Vibrio fischeri LuxR protein constitutes an autoinducer-binding domain. J. Bacteriol. 177815-817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hoang, H. H., A. Becker, and J. E. González. 2004. The LuxR homolog ExpR, in combination with the Sin quorum sensing system, plays a central role in Sinorhizobium meliloti gene expression. J. Bacteriol. 1865460-5472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hoang, H. H., N. Gurich, and J. E. González. 2008. Regulation of motility by the ExpR/Sin quorum-sensing system in Sinorhizobium meliloti. J. Bacteriol. 190861-871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hussain, M. B., H. B. Zhang, J. L. Xu, Q. Liu, Z. Jiang, and L. H. Zhang. 2008. The acyl-homoserine lactone-type quorum-sensing system modulates cell motility and virulence of Erwinia chrysanthemi pv. zeae. J. Bacteriol. 1901045-1053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jones, K. M., H. Kobayashi, B. W. Davies, M. E. Taga, and G. C. Walker. 2007. How rhizobial symbionts invade plants: the Sinorhizobium-Medicago model. Nat. Rev. Microbiol. 5619-633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Koutsoudis, M. D., D. Tsaltas, T. D. Minogue, and S. B. von Bodman. 2006. Quorum-sensing regulation governs bacterial adhesion, biofilm development, and host colonization in Pantoea stewartii subspecies stewartii. Proc. Natl. Acad. Sci. USA 1035983-5988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Krol, E., and A. Becker. 2004. Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011. Mol. Genet. Genomics 2721-17. [DOI] [PubMed] [Google Scholar]
  • 40.Leigh, J. A., E. R. Signer, and G. C. Walker. 1985. Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 826231-6235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Maddocks, S. E., and P. C. Oyston. 2008. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 1543609-3623. [DOI] [PubMed] [Google Scholar]
  • 42.Marketon, M. M., S. A. Glenn, A. Eberhard, and J. E. González. 2003. Quorum sensing controls exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 185325-331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Marketon, M. M., and J. E. González. 2002. Identification of two quorum-sensing systems in Sinorhizobium meliloti. J. Bacteriol. 1843466-3475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Marketon, M. M., M. R. Gronquist, A. Eberhard, and J. E. González. 2002. Characterization of the Sinorhizobium meliloti sinR/sinI locus and the production of novel N-acyl homoserine lactones. J. Bacteriol. 1845686-5695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Meade, H. M., S. R. Long, G. B. Ruvkun, S. E. Brown, and F. M. Ausubel. 1982. Physical and genetic characterization of symbiotic and auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5 mutagenesis. J. Bacteriol. 149114-122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Newman, J. R., and C. Fuqua. 1999. Broad-host-range expression vectors that carry the l-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227197-203. [DOI] [PubMed] [Google Scholar]
  • 47.Patankar, A. V., and J. E. González. Orphan LuxR regulators of quorum sensing. FEMS Microbiol. Rev., in press. [DOI] [PubMed]
  • 48.Patriarca, E. J., R. Tate, and M. Iaccarino. 2002. Key role of bacterial NH4+ metabolism in Rhizobium-plant symbiosis. Microbiol. Mol. Biol. Rev. 66203-222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Pearson, J. P., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1995. A second N-acylhomoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 921490-1494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Pellock, B. J., M. Teplitski, R. P. Boinay, W. D. Bauer, and G. C. Walker. 2002. A LuxR homolog controls production of symbiotically active extracellular polysaccharide II by Sinorhizobium meliloti. J. Bacteriol. 1845067-5076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Piper, K. R., S. Beck von Bodman, and S. K. Farrand. 1993. Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature 362448-450. [DOI] [PubMed] [Google Scholar]
  • 52.Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 12715-21. [DOI] [PubMed] [Google Scholar]
  • 53.Ramos, J. L., M. Martinez-Bueno, A. J. Molina-Henares, W. Teran, K. Watanabe, X. Zhang, M. T. Gallegos, R. Brennan, and R. Tobes. 2005. The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69326-356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Scharf, B., H. Schuster-Wolff-Bühring, R. Rachel, and R. Schmitt. 2001. Mutational analysis of the Rhizobium lupini H13-3 and Sinorhizobium meliloti flagellin genes: importance of flagellin A for flagellar filament structure and transcriptional regulation. J. Bacteriol. 1835334-5342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Schuster, M., and E. P. Greenberg. 2007. Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon. BMC Genomics 8287-298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Schuster, M., C. P. Lostroh, T. Ogi, and E. P. Greenberg. 2003. Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis. J. Bacteriol. 1852066-2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Skorupska, A., M. Janczarek, M. Marczak, A. Mazur, and J. Król. 2006. Rhizobial exopolysaccharides: genetic control and symbiotic functions. Microb. Cell Fact. 57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Vriezen, J. A., F. J. de Bruijn, and K. Nüsslein. 2007. Responses of rhizobia to desiccation in relation to osmotic stress, oxygen, and temperature. Appl. Environ. Microbiol. 733451-3459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wagner, V. E., and B. H. Iglewski. 2008. P. aeruginosa biofilms in CF infection. Clin. Rev. Allergy Immunol. 35124-134. [DOI] [PubMed] [Google Scholar]
  • 60.Wang, Y., A. M. Chen, A. Y. Yu, L. Luo, G. Q. Yu, J. B. Zhu, and Y. Z. Wang. 2008. The GntR-type regulators GtrA and GtrB affect cell growth and nodulation of Sinorhizobium meliloti. J. Microbiol. 46137-145. [DOI] [PubMed] [Google Scholar]
  • 61.Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell Dev. Biol. 21319-346. [DOI] [PubMed] [Google Scholar]
  • 62.White, C. E., and S. C. Winans. 2007. Cell-cell communication in the plant pathogen Agrobacterium tumefaciens. Philos. Trans. R. Soc. Lond. B 3621135-1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Whitehead, N. A., A. M. Barnard, H. Slater, N. J. Simpson, and G. P. Salmond. 2001. Quorum-sensing in Gram-negative bacteria. FEMS Microbiol. Rev. 25365-404. [DOI] [PubMed] [Google Scholar]
  • 64.Whiteley, M., K. M. Lee, and E. P. Greenberg. 1999. Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 9613904-13909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.York, G. M., and G. C. Walker. 1998. The Rhizobium meliloti ExoK and ExsH glycanases specifically depolymerize nascent succinoglycan chains. Proc. Natl. Acad. Sci. USA 954912-4917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Zhang, L., Y. Jia, L. Wang, and R. Fang. 2007. A proline iminopeptidase gene upregulated in planta by a LuxR homologue is essential for pathogenicity of Xanthomonas campestris pv. campestris. Mol. Microbiol. 65121-136. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES