Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2009 Apr 15;83(13):6652–6663. doi: 10.1128/JVI.00260-09

Herpes Simplex Virus Type 1 Suppresses RNA-Induced Gene Silencing in Mammalian Cells▿

Zetang Wu 1,§, Yali Zhu 2, David M Bisaro 1,3, Deborah S Parris 1,2,*
PMCID: PMC2698522  PMID: 19369325

Abstract

RNA-induced silencing is a potent innate antiviral defense strategy in plants, and suppression of silencing is a hallmark of pathogenic plant viruses. However, the impact of silencing as a mammalian antiviral defense mechanism and the ability of mammalian viruses to suppress silencing in natural host cells have remained controversial. The ability of herpes simplex virus type 1 (HSV-1) to suppress silencing was examined in a transient expression system that employed an imperfect hairpin to target degradation of transcripts encoding enhanced green fluorescent protein (EGFP). HSV-1 infection suppressed EGFP-specific silencing as demonstrated by increased EGFP mRNA levels and an increase in the EGFP mRNA half-life. The increase in EGFP mRNA stability occurred despite the well-characterized host macromolecular shutoff functions of HSV-1 that globally destabilize mRNAs. Moreover, mutant viruses defective in these functions increased the stability of EGFP mRNA even more than did the wild-type virus in silenced cells compared to results in control cells. The importance of RNA silencing to HSV-1 replication was confirmed by a significantly enhanced virus burst size in cells in which silencing was knocked down with small inhibitory RNAs directed to Argonaute 2, an integral component of the silencing complex. Given that HSV-1 encodes several microRNAs, it is possible that a dynamic equilibrium exists between silencing and silencing suppression that is capable of modulating viral gene expression to promote replication, to evade host defenses, and/or to promote latency.


Herpes simplex virus type 1 (HSV-1) is the prototypic member of the alphaherpesvirus subfamily, which induces lytic infections in epithelial cells of its native host (47, 65). A multiplicity of viral functions has evolved to modulate the host cell environment in order to ensure the efficient production of new infectious virus during lytic infection. These include functions that promote viral gene transcription, inhibition of host mRNA processing, increased degradation of mRNA, and a shutoff of host protein synthesis (29, 52, 58). In addition, HSV-1 encodes functions that interfere with host defense mechanisms, including innate and adaptive immune responses (47). Despite the wealth of functions that promote lytic replication in epithelial cells, HSV-1 establishes lifelong latency in sensory neurons (29, 47). Latency is characterized by silencing of mRNA expression from the majority of the viral genome, though the mechanisms by which silencing and latency are established by HSV-1 in vivo remain largely unknown. Because lytic replication requires that such silencing be regulated, inhibited, or blocked, we were interested in examining the ability of HSV-1 to interfere with a specific type of silencing pathway, known as RNA-induced gene silencing or RNA interference (RNAi).

RNAi is a mechanism by which most eukaryotic organisms, including plants, animals, fungi, and fission yeast, developmentally and temporally regulate gene expression (reviewed in references 1, 2, 54, and 68). RNAi is mediated by small (21- to 24-nucleotide [nt]) antisense RNAs that induce gene-specific silencing by virtue of complete or partial complementarity with their respective target mRNAs (2, 13, 72, 73, 75). The best characterized of these small RNAs are small interfering RNAs (siRNAs) and microRNAs (miRNAs). Though the means by which they are formed differ, both are incorporated into ribonucleoprotein complexes termed RISC (RNA-induced silencing complex) and unwound, and the guide strand (complementary to an mRNA target) is selected to form the active or holo-RISC complex. Generally, both miRNAs and siRNAs with perfect base-pairing to mRNA target that mRNA for degradation, whereas imperfect base-pairing to mRNA targets predominantly leads to translational repression (10, 75).

In plants, which do not have a classical immune system, RNA silencing is an important antiviral defense strategy (9, 69). Virus replication leads to the production of double-stranded RNA (dsRNA), which triggers the RNA silencing response and robust production of siRNA. This silencing response leads to reduced levels of viral proteins, and in the case of cells infected with an RNA virus, viral sense or antisense genomes can also be targeted for degradation by siRNA. The RNA silencing response to viral infection is so robust that all major groups of plant viruses examined to date, including those with DNA genomes, have been shown to encode one or more RNA silencing suppressors (RSSs) which act as pathogenicity determinants (4, 34). Some RSSs interfere not only with siRNA-directed silencing but also with miRNA-directed silencing. Indeed, even in the absence of virus infection, expression of many plant virus RSSs produces virtually the same developmental “symptoms” in plants as those produced by virus infection (11, 28).

A primary innate response to viral infections of mammalian cells is the interferon (IFN) response. A major mediator of the IFN response is dsRNA, which can induce signaling that leads to transcriptional activation of IFN genes and can also activate RNA-dependent protein kinase, a major downstream effector of the IFN response. Although most mammalian viruses, including RNA and DNA viruses, provoke an IFN response, an amazing array of countermeasures has evolved among different virus families, including the herpesviruses, to inhibit it (44). Remarkably, several animal virus proteins known to act as IFN pathway antagonists have been shown to act as RSSs in a variety of cells, including insect, worm, and mammalian cells (8, 34). These include the influenza virus A NS1 protein, vaccinia virus E3L protein, hepatitis C virus core protein, human immunodeficiency virus type 1 Tat protein, primate foamy virus Tas protein, and Ebola virus protein VP35 (3, 19, 33, 35, 71). Nevertheless, the presence and importance of RNA-induced silencing as an antiviral response to natural infections in mammalian cells has been widely debated (7, 12, 17, 18, 55). Interestingly, proof of functional interplay between the IFN and RNA silencing pathways was recently demonstrated by Pederson et al. (43). These investigators showed that beta IFN alters the expression of cellular miRNAs, some of which are directed to hepatitis C virus transcripts and attenuate viral replication. These results provide strong evidence that mammalian cells use RNA silencing mechanisms for antiviral defense and point to the potential utility of virus-encoded RSSs to counter this defense.

If mammalian cells do mount a silencing response to HSV-1 infection, we hypothesized that HSV-1 would be able to suppress silencing in cells in which it can replicate productively. To test this hypothesis, we established and characterized an assay to silence a transiently expressed target gene irrelevant to virus replication. Silencing of the target gene is accompanied by an increased rate of mRNA degradation specific to the transcript encoding the target gene. Remarkably, HSV-1 infection can suppress silencing by specifically stabilizing the target mRNA, despite the presence of two virus-encoded functions which globally destabilize transcripts in infected cells. Viral mutants deficient in either of these functions further increase the stability of the target mRNA in silenced cells, compared to results with the wild-type virus, demonstrating the potent ability of HSV-1 to suppress RNA silencing. The results define an additional mechanism by which HSV-1 can elude host responses capable of limiting viral replication.

MATERIALS AND METHODS

Propagation of cells and viruses.

Baby hamster kidney (BHK), HEp-2, and African green monkey kidney (Vero) cells were cultivated as described previously (42). A clone of Vero cells, designated 2-2 cells (a kind gift of Roz Sandri-Goldin, University of California, Irvine), expresses the HSV-1 ICP27 gene under the control of its own promoter (59). The 2-2 cells were cultivated in the presence of G418 (active concentration, 400 μg/ml). Human embryonic kidney (HEK) 293T cells were grown in Dulbecco modified minimum essential medium supplemented with 10% fetal bovine serum and were dissociated for passage using enzyme-free dissociation solution (Invitrogen, Carlsbad, CA).

The wild-type strain of HSV-1 used was KOS, originally obtained from Priscilla Schaffer (Harvard Medical School, Boston, MA). Mutant virus vhs-1 (a gift of G. Sullivan Read, University of Missouri, Kansas City) contains a missense point mutation in the HSV-1 UL41 gene, and its phenotype has been described previously (45). Wild-type and vhs-1 viruses were propagated by low-multiplicity passage in Vero cells as described previously (42). The mutant virus designated 27-LacZ (a gift of Roz Sandri-Goldin) is a null mutant that contains the Escherichia coli lacZ gene inserted into the ICP27 coding sequence (59). The 27-LacZ mutant virus was propagated in complementing 2-2 cells as described previously (59). Both vhs-1 and 27-LacZ mutant viruses were derived from the KOS strain of HSV-1. Virus titers were determined by plaque assay in Vero (KOS and vhs-1) or in 2-2 cells (27-LacZ) using an overlay of Dulbecco modified minimum essential medium containing 5% fetal bovine serum and 2% methylcellulose as described previously (42).

Plasmids.

Except where indicated, the target plasmid used in silencing assays was pEGFP-C2, purchased from Clontech (Mountain View, CA). Plasmid pintronEGFP was derived from pEGFP-C2 by inserting a short chimeric intron between the promoter and the enhanced green fluorescent protein (EGFP) open reading frame (ORF). The intron-encoding sequence (136 bp) was derived from the plasmid pRL-CMV from Promega (Madison, WI) and contains the 5′-donor splice site from the first intron of the human β-globin gene and the branch site plus 3′-acceptor sequences from an intron preceding an immunoglobulin heavy chain variable region (5, 22, 23, 56). Plasmid pcDNA-β-actin (gift of William Lafuse, Ohio State University) contained the cDNA of the human β-actin gene and was used for the preparation of hybridization probes.

Plasmids which express imperfect hairpins corresponding to EGFP (pmidsEGFP) or lacZ (pmidsLacZ) were constructed in a modified pUC19 vector into which the human U6 promoter had been cloned (pUC-Hu6) (30). The sequences of the upper and lower oligonucleotides used for each construct are shown in Table 1. The imperfect hairpins were designed using the program RNAioligoretriever (http://katahdin.cshl.org:9331/RNAi/html/rnai.html) (40, 48). The resulting constructs were predicted to generate RNA polymerase III (Pol III) transcripts that contained 27 nt of Hu6 snRNA at the 5′ end (BamHI), 28 nt antisense to nt 121 to 148 of the EGFP ORF (pmidsEGFP) or 28 nt antisense to nt 58 to 85 in the E. coli lacZ ORF (pmidsLacZ), 9 nt of loop sequence, and a 28-nt inverted-repeat “sense” sequence into which several mismatches with the relevant antisense portion were introduced (Fig. 1). All DNA oligonucleotides were purchased from IDT (Coralville, IA).

TABLE 1.

Oligonucleotides and PCR amplificationa

Product/application (length) Template Oligonucleotide sequences (5′ to 3′) Amplification conditions
Hu6 promoter (303 bp) HEp-2 cellular DNA Upper: TCTTTGGAATTCAAGGTCGGGCAGGAAGGCCTA 94°C, 2 min/60°C, 30s/70°C, 1 min; 25 cycles
Lower: CGCGGATCCTAGTATATGTGCTGCCGAAGCGAGGAC
EGFP probe (267 bp) pEGFP-C2 Upper: CGCTACCCCGACCACA 94°C, 2 min/70°C, 1 min; 40 cycles
Lower: TGATGCCGTTCTTCTGCT
β-Actin probe (328 bp) pcDNA-β-actin Upper: TCGCAATGGAAGAAGAAATC 94°C, 2 min/65°C, 30 s/70°C, 1 min; 25 cycles
Lower: GGGGCCTCGGTCAGAAGCAC
Ago2 qRT-PCR standard (150 bp) HEK 293T cell DNA Upper: GTGGAGCTGGAGGTCACG 94°C, 2 min/65°C, 30 s/70°C, 1 min; 25 cycles
Lower: CAGGGCCTGGATCGTCTC
18S rRNA qRT-PCR standard HEK 293T cell DNA Upper: TCAAGAACGAAAGTCGGAGG 94°C, 2 min/56°C, 30 s/72°C, 30 s; 25 cycles
Lower: GGACATCTAAGGGCATCACA
midsEGFP hairpin (65-nt transcript) NA Upper: pGATCCTGCAGATGAACTTCAGGGTCAGCTTGCCGAAGCTTGGGCAGGCTGATCCTGAGGTTCATCTGCATCATTTTTT NA; cloned into pUC-Hu6
Lower: pCTAGAAAAAAATGATGCAGATGAACCTCAGGATCAGCCTGCCCAAGCTTCGGCAAGCTGACCCTGAAGTTCATCTGCAG
midslacZ hairpin (65-nt transcript) NA Upper: pGATCCCAAGGCGATTAAGTTGGGTAACGCCAGGGAAGCTTGCTTGGCGTTATCCGACTTAGTCGCCTTGCAGTTTTTT NA; cloned into pUC-Hu6
Lower: pCTAGAAAAATGATGCAGATGAACCTCAGGATCAGCCTGCCCAAGCTTCGGCAAGCTGACCCTGAAGTTCATCTGCAG
Ago2 siRNA NA Upper: GCACGGAAGUCCAUCUGAAUU NA
Lower: pUUCAGAUGGACUUCCGUGCUU
a

NA, not applicable. The “p” at the 5′ ends of some sequences indicates that the sequences were phosphorylated. Upper and lower sequences were annealed to form a partial duplex. Sequences that are underlined were single stranded following annealing.

FIG. 1.

FIG. 1.

Schematic diagram of transcripts and imperfect hairpins encoded by pmidsEGFP or pmidsLacZ. Transcripts predicted to be expressed from the Pol III human U6 promoter within the plasmids following their introduction into BHK cells are illustrated. Specific details of the plasmid constructs are described in Materials and Methods. Transcripts contained 27 nt of U6 RNA at the 5′ end linked to a 28-nt antisense sequence with perfect complementarity to sequences close to the 5′ end of the ORF of either EGFP (pmidsEGFP) or lacZ (pmidslacZ) mRNA, a 9-nt spacer designed to form a loop, and a 28-nt “sense” sequence containing an imperfect inverted repeat (IR) of the antisense portion. The transcripts were predicted to fold into imperfect hairpins with three mismatches as shown.

Transient transfections and silencing.

DNA was transfected into subconfluent cells 18 to 24 h after seeding. Transfection mixtures contained 700 ng total DNA for 35-mm dishes or 2.5 μg DNA for 60-mm dishes and were mixed with an equal volume of Lipofectamine 2000 (diluted 1:20) according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA). For RNA transfections in 35-mm dishes, 200 pmol of RNA duplex was employed.

Except where indicated, EGFP transient silencing assays were conducted in 35-mm dishes and used equimolar amounts of pEGFP-C2 target (420 ng) and pmidsEGFP or pmidslacZ hairpin plasmid (280 ng). An Argonaute 2 (Ago2)-specific siRNA duplex with 2-nt 3′ overhangs (Table 1) was used to knock down Ago2 gene expression (38). The RNA oligonucleotides and the nontarget RISC-free control RNA duplex were purchased from Dharmacon (Chicago, IL).

RNA analysis.

The 32P-labeled probes for detection of EGFP and human β-actin mRNA were prepared from 25 ng gel-purified PCR product using the Rediprime II random priming system from GE Healthcare (Piscataway, NJ) according to the instructions of the manufacturer. The oligonucleotide primers and amplification conditions for each PCR product are shown in Table 1.

Total RNA was isolated using the RNAeasy Plus kit from Qiagen (Valencia, CA) according to the manufacturer's instructions. RNA (5 to 10 μg/lane) was separated by electrophoresis through a formaldehyde-containing 1% agarose gel (50). Gels stained with ethidium bromide were examined under UV light, and the relative 18S rRNA levels were determined using a Bio-Rad gel documentation apparatus (Hercules, CA) and associated software. Northern blots of RNA transferred to neutral nylon membranes (GE Healthcare, Piscataway, NJ) were prepared and hybridized by standard procedures (50). Membranes were prehybridized for 4 h at 40°C in hybridization buffer, radioactive EGFP probe (1.2 to 3.0 × 107 dpm) was added, and incubation was continued overnight (∼14 h) at 40°C. Blots were washed twice at room temperature in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) containing 0.1% sodium dodecyl sulfate and then twice at 50°C in 0.5× SSC-0.1% sodium dodecyl sulfate. The ∼700-nt EGFP mRNA bands were quantified using a Typhoon 9200 Multi-Image analyzer (GE Healthsciences, Piscataway, NJ) and ImageQuant software. For detection of β-actin mRNA, the previously probed blots were boiled for 1 min in distilled water and hybridized with radioactive β-actin probe as described above. The mRNA amounts present were normalized to the amount of 18S rRNA in each lane.

Determination of mRNA half-life.

A stock solution (5 mg/ml) of actinomycin D (Act D) (Sigma, St. Louis, MO) was prepared in dimethyl sulfoxide. A concentration of Act D (5 μg/ml culture medium) sufficient to block new transcription (31) was added to cells at the times indicated for each experiment, and the amount of mRNA in samples harvested thereafter was plotted as a function of time following Act D addition. The data were fit to an exponential decay function (equation 1), and the mRNA half-life was estimated according to equation 2, as follows:

graphic file with name M1.gif (1)
graphic file with name M2.gif (2)

where Ei is the proportion of mRNA remaining at time (t) following the addition of Act D compared to the amount present at the time of Act D addition (E0), k is the decay constant, and t[1/2] is the half-life of the mRNA.

qRT-PCR.

Reverse transcription of RNA samples was conducted using the Superscript Reverse Transcriptase II kit from Invitrogen (Carlsbad, CA). Ago2 cDNA was synthesized using the Ago2-specific lower primer shown in Table 1, and reverse transcription was performed for 90 min at 42°C. Random hexamers were employed for the cDNA synthesis of 18S rRNA, and reverse transcription was performed for 90 min at 48°C. The quantitative real-time PCRs (qRT-PCRs) were conducted in a total volume of 20 μl using the Sybr green master mix from Roche (Pleasanton, CA) according to the manufacturer's instructions. Ago2 and 18S rRNA qRT-PCRs were carried out using primers at a final concentration of 0.063 and 0.25 μM, respectively. Primers and amplification conditions are indicated in Table 1. Known concentrations of PCR products amplified from Ago2 and 18S rRNA genes (Table 1) were utilized as templates to prepare standard curves.

RESULTS

Optimization of transient silencing.

As a means to determine the ability of HSV-1 to suppress silencing, a transient silencing system was established and optimized. The system utilized two plasmids, one (pEGFP-C2) encoding the target gene, EGFP, under the control of the human cytomegalovirus immediate-early RNA Pol II promoter, and the other encoding a short imperfect hairpin, expressed under the control of the Pol III human U6 promoter. All transcribed hairpins contained 27 nt of the Hu6 snRNA at the 5′ end (Fig. 1) and are described in detail in Materials and Methods. The imperfect hairpins transcribed from pmidsEGFP (dsEGFP) were designed such that a 28-nt antisense portion would possess perfect complementarity with a region within the 5′ coding portion of the EGFP mRNA. The sense portion of the hairpin contained three G:U mismatches with the antisense portion in order to resemble a pre-miRNA. Control imperfect hairpins (dslacZ) were expressed from pmidslacZ and possessed the same structure except that the antisense portions were designed to be perfectly complementary to an irrelevant (E. coli lacZ) mRNA not expected to be found in cells. BHK cells were cotransfected with EGFP target-expressing plasmid and either pmidsEGFP (silenced cells) or pmidslacZ (control cells). Cell cultures were harvested 52 h after transfection, and the steady-state levels of EGFP mRNA were determined by Northern blotting and normalized to 18S rRNA levels (Fig. 2A). The results demonstrate that the dsEGFP hairpins reduce the EGFP mRNA level approximately sevenfold from that in cells in which the control dslacZ hairpin is expressed (Fig. 2B).

FIG. 2.

FIG. 2.

Steady-state mRNA levels in cells cotransfected with EGFP- and hairpin-expressing plasmids. BHK cells were cotransfected with equimolar amounts of EGFP-expressing plasmid (pEGFP-C2) and either pmidsEGFP to express dsEGFP hairpins or pmidsLacZ to express dslacZ hairpins. (A) Total RNA was isolated from cells harvested 52 h after transfection and separated by electrophoresis on denaturing agarose gels. The bottom panel shows the ethidium bromide-stained 18S rRNA bands from five replicate plates in which the EGFP target was silenced (EGFP+dsEGFP) or from five control plates (EGFP+dsLacZ). The upper panel shows the EGFP mRNA bands from a Northern blot of the gel probed with EGFP-specific sequences. The bands were quantified, and the amounts were normalized to 18S rRNA levels. The average amounts (in arbitrary units ± standard deviations) are indicated for each set of samples. (B) The relative effects of the different hairpins on EGFP mRNA levels are shown. For purposes of comparison, the average level of EGFP mRNA in silenced samples was set to 1.0.

To optimize the transient silencing system, the molar ratio of hairpin to target plasmid was varied, keeping the amount of target-expressing plasmid constant. Hu6-pUC19 DNA, the parent vector into which the hairpin sequences were inserted, was added as necessary to keep the total amount of DNA transfected constant. Increasing or decreasing the molar ratio of the dslacZ-expressing plasmid relative to the EGFP-expressing plasmid had little or no effect on EGFP mRNA steady-state levels (Fig. 3). As observed previously, a 1:1 molar ratio of dsEGFP to target plasmid resulted in an approximately sevenfold reduction in EGFP mRNA levels compared to those in dslacZ controls (Fig. 3), but little, if any, further reduction in EGFP mRNA level was observed with higher ratios of dsEGFP to target plasmid. However, decreasing the ratio of dsEGFP to target-expressing plasmid below 0.5:1.0 resulted in substantially higher EGFP mRNA levels, indicative of less silencing. Therefore, in all other studies described herein, a 1:1 molar ratio of hairpin to target plasmid was utilized.

FIG. 3.

FIG. 3.

Effect of hairpin:target plasmid ratio on silencing. Transfection mixtures were prepared using a constant amount of EGFP-expressing target plasmid and various amounts of plasmid that express the dsEGFP (▵) or dslacZ (○) hairpins. Total DNA in each transfection mixture was held constant by the addition of the hairpin vector backbone plasmid (Hu6-pUC19). Three replicate cultures of BHK cells were transfected with each mixture, and cells were harvested 52 h after transfection. The amount of EGFP mRNA was determined as described in the legend to Fig. 2. The plot shows the relative levels of EGFP mRNA (means with standard deviations) of each set of samples compared to that observed in samples that received the smallest ratio of hairpin:target plasmid (2−5 or 1:32), which was set to 1.0.

Effect of imperfect hairpins on EGFP mRNA degradation.

The design of the dsEGFP imperfect hairpin predicted that mature miRNA derived from the antisense portion would base-pair with EGFP mRNA with no mismatches and therefore target it for degradation. To confirm that the reduced steady-state EGFP mRNA level in silenced cells was associated with an increased rate of EGFP mRNA degradation, experiments were conducted to measure the half-life of EGFP mRNA in transiently silenced cells versus that in control cells. Cells were cotransfected with pEGFP-C2 target and the dsEGFP hairpin-expressing plasmid to induce silencing. Control cells were cotransfected with pEGFP-C2 target and the dslacZ hairpin-expressing plasmid. Further transcription was blocked by the addition of Act D (5 μg/ml) 42 h posttransfection. The levels of target EGFP mRNA and those of a control housekeeping gene (β-actin) mRNA following Act D treatment were determined by Northern blot analysis, normalized to 18S rRNA levels in each sample, and plotted as a function of time following the addition of Act D (Fig. 4). The levels of the control β-actin mRNA in both silenced and control cells decreased similarly as a function of time following Act D addition, with an estimated half-life of 22 h (Fig. 4A and Table 2). The stability of the EGFP target mRNA was considerably less than that of the control β-actin mRNA in both silenced and control cells (Fig. 4B). However, in control cells that received the EGFP target and dslacZ hairpin-expressing plasmid, the estimated half-life of EGFP mRNA was 5.5 h, nearly twice the half-life of EGFP mRNA (2.8 h) observed in cells that were silenced using the dsEGFP hairpin (Table 2). These results confirm that EGFP mRNA degradation was accelerated in cells that received the dsEGFP imperfect hairpin, consistent with the expected mechanism of silencing. Moreover, the reduced stability of EGFP mRNA in silenced cells was specific since no difference in β-actin mRNA stability was observed in silenced and control cells.

FIG. 4.

FIG. 4.

Effect of hairpins on stability of mRNA. BHK cell cultures were cotransfected with an equimolar ratio of EGFP-expressing plasmid and either dsEGFP (▵, silenced) or dslacZ (○, control) hairpin-expressing plasmid. Act D (5 μg/ml) was added 42 h later to block additional transcription, and cells were harvested at various times thereafter. Isolated RNA was separated by denaturing gel electrophoresis, blotted onto a nylon membrane, and hybridized sequentially to 32P-labeled EGFP and human β-actin probes. The mRNA amounts were determined as described in Materials and Methods. The amounts of the β-actin (A) and EGFP (B) mRNA, normalized to 18S rRNA levels, were calculated as a percentage of that observed in samples harvested immediately prior to the addition of Act D (set at 100%) and plotted as a function of time following the addition of Act D. The curves shown represent the data fit to an exponential decay function (equation 1), and the half-lives were estimated by using equation 2 as described in Materials and Methods. The mRNA half-lives are summarized in Table 2.

TABLE 2.

Effect of silencing and HSV-1 infection on mRNA half-life

Infection mRNA half-life (h) of:
EGFP
β-Actin
Silenceda Controlb Silenceda Controlb
Nonec 2.8* (2.6-3.1) 5.5 (5.2-5.7) 21.7 (19.9-23.4) 21.9 (20.1-23.1)
Mockd 2.7* (2.6-3.0) 5.4 (5.1-5.6) 20.4 (19.8-21.1) 21.2 (20.3-22.1)
Wild-type (KOS)d 4.5** (4.3-4.6) 4.1** (3.9-4.3) 15.5** (15.0-16.1) 15.4** (14.9-16.2)
Mocke 2.8* (2.5-3.0) 5.5 (5.3-5.8) 20.6 (19.3-22.1) 21.6 (20.1-22.8)
vhs-1e 5.6** (5.3-5.8) 5.4 (5.3-5.7) 21.1 (19.8-22.6) 20.5 (19.6-22.3)
27-LacZe 5.3** (5.2-5.6) 5.7 (5.4-5.9) 20.5 (18.9-22.1) 20.5 (19.1-21.9)
a

BHK cells were cotransfected with equimolar amounts of EGFP target-expressing and dsEGFP hairpin-expressing plasmids. The mRNA amounts (normalized to the 18S rRNA level) were determined from Northern blots probed first by hybridization with EGFP-specific sequences. Blots were stripped and subsequently hybridized to a β-actin-specific probe. Half-lives were estimated by fitting the data to an exponential decay function as described in Materials and Methods. Nonlinear regression analysis was performed, and the 95% confidence intervals for the estimated half-lives are shown in parentheses. A single asterisk indicates that the half-life estimates of silenced compared to control samples for each mRNA type were significantly different (P < 0.05). Double asterisks indicate that estimated half-lives of a particular mRNA type in infected samples were significantly different (P < 0.05) from those in mock-infected samples.

b

BHK cells were cotransfected with equimolar amounts of EGFP target-expressing and dslacZ hairpin-expressing plasmids. Half-lives were estimated and compared for differences as described in Materials and Methods and footnote a.

c

Cells were cotransfected with target- and hairpin-expressing plasmids as indicated, and Act D (5 μg/ml) was added 52 h later. RNA levels were determined at various times after the addition of Act D.

d

Cells were cotransfected with target- and hairpin-expressing plasmids as indicated, and 42 h later, cells were either mock infected or infected with wild-type (KOS) virus at an input MOI of 5 PFU/cell. Act D (5 μg/ml) was added 6 h after infection or mock infection, and mRNA levels were determined at various times thereafter.

e

Experiment was performed as described above except that cells were either mock infected or infected with the vhs-1 or 27-LacZ virus mutant (MOI of 5 PFU/cell).

Effect of HSV-1 on transient silencing.

The ability of HSV-1 (KOS) to suppress transient silencing of EGFP was tested. BHK cells were cotransfected with the target EGFP-expressing plasmid and either dsEGFP (silenced) or dslacZ (control) hairpin-expressing plasmids as described previously. Cells were either infected with HSV-1 (KOS) at an input multiplicity of infection (MOI) of 5 PFU/cell or were mock infected 42 h after transfection. The high MOI ensured that every cell in the culture was infected. RNA was extracted from cells harvested at 10 h postinfection (p.i.), allowing sufficient time for the expression of immediate-early, early, and late genes. The EGFP and β-actin mRNA levels were determined by Northern blot analysis and normalized to 18S rRNA levels in each sample (Fig. 5A). Due to the differences in the absolute amount of EGFP mRNA present in silenced versus control cells, the level of either β-actin (Fig. 5B) or EGFP (Fig. 5C) mRNA present in mock-infected silenced cells was set to 1.0 for ease of comparison. In both silenced and control cells, β-actin mRNA levels were reduced in HSV-1-infected compared to those in mock-infected cells (Fig. 5A and B), consistent with the previously reported ability of HSV-1 to globally increase the degradation rate of mRNA in infected cells (31, 32, 39, 59). Mock-infected silenced cells had markedly reduced levels of EGFP mRNA compared to mock-infected control cells, but HSV-1 infection of silenced cells resulted in a ∼5-fold higher level of EGFP mRNA than that in mock-infected silenced cells (Fig. 5A and C). RNase protection experiments revealed that the increase in EGFP mRNA following infection could not be explained by a reduction in the amount of dsEGFP silencing hairpin that accumulated in infected cells. Indeed, HSV-1 infection yielded slightly increased amounts of dsEGFP hairpin in infected cells compared to those in mock-infected cells (results not shown). Infection of control cells also caused a small but significant increase (∼25%) in the amount of EGFP mRNA present compared to that in mock-infected control cells (Fig. 5A and C).

FIG. 5.

FIG. 5.

Effect of HSV-1 infection on steady-state mRNA levels. BHK cells were transfected as described in the legend to Fig. 4. Forty-two hours after transfection, silenced and control cells were either mock infected or infected with wild-type HSV-1 (KOS) at a MOI of 5 PFU/cell, and RNA was isolated from cells harvested at 10 h p.i. (A) RNA from triplicate cultures was separated by electrophoresis through denaturing gels. The top two panels show Northern blots of RNA probed sequentially with EGFP and β-actin sequences as indicated. The bottom panel shows the 18S rRNA bands from the ethidium bromide-stained gel prior to RNA transfer. The EGFP and β-actin mRNA amounts, normalized to 18S rRNA levels, are shown below each blot as means (in arbitrary units ± standard deviations) for each sample set. (B) Comparison of relative β-actin mRNA levels in mock-infected (black bars) or HSV-1-infected (gray bars) cells. Silenced cells expressed EGFP and the dsEGFP hairpin, whereas control cells expressed EGFP and the dslacZ hairpin. The amount of β-actin mRNA in mock-infected silenced cells was set to 1.0. (C) Comparison of relative EGFP mRNA amounts in mock-infected or infected cells. The amount of EGFP mRNA in mock-infected silenced cells was set to 1.0.

It was also possible that all or some of the enhancement in EGFP mRNA levels following infection by HSV-1 was due to the fact that the primary EGFP transcript expressed from the pEGFP-C2 plasmid contained no known intron sequences. ICP27, a multifunctional immediate-early HSV-1 protein, contributes to host shutoff by interfering with the splicing and transport of intron-containing transcripts (52). Because most HSV-1 transcripts do not contain introns, this strategy contributes to the relative increase in viral mRNAs compared to cellular mRNAs available in the cytoplasm for translation. To determine the effect of intron sequences on the ability of HSV-1 to enhance EGFP expression, we introduced a short intron into the 5′ untranslated region of the EGFP gene of the pEGFP-C2 plasmid to produce the plasmid pintronEGFP. Silencing was established in cells with the dsEGFP hairpin-expressing plasmid, but the target EGFP-expressing plasmid encoded either an intron (pintronEGFP) or no intron (pEGFP-C2) sequence. Control cells were cotransfected with the indicated EGFP-expressing and dslacZ hairpin-expressing plasmids. Similarly transfected cells were either mock infected 42 h after transfection or infected with HSV-1 (5 PFU/cell), and total RNA was prepared from cells harvested 10 h after infection or mock infection. Figures 6A and B show the effect of HSV-1 infection on EGFP mRNA levels in cells in which the EGFP transcript was either intronless or possessed an intron, respectively. For purposes of comparison, all EGFP mRNA levels were normalized to 18S rRNA levels and the amount present in mock-infected silenced cells in which the EGFP target transcript possessed no intron was set to 1.0. Infection of silenced cells in which the EGFP target transcript possesses no introns resulted in 5.7-fold-higher EGFP mRNA levels than those present in mock-infected silenced cells (Fig. 6A). Infection of control cells in which the EGFP transcript was intronless increased EGFP amounts approximately 50% (Fig. 6A). Although the plasmid expressing an intron-containing EGFP transcript yielded somewhat smaller amounts of EGFP mRNA in all samples than that containing the intronless transcript, the relative effect of infection compared to mock infection on EGFP mRNA levels was very similar (Fig. 6B). In HSV-1-infected silenced cells expressing an intron-containing EGFP transcript, EGFP mRNA accumulated to 6.7 times the level observed in similarly transfected mock-infected silenced cells. In addition, the presence of the intron had little impact on the level of enhancement of EGFP mRNA levels (∼70%) observed in infected versus mock-infected control cells (Fig. 6B). Thus, neither the presence nor the absence of intron sequences in the target EGFP transcript has an impact on the observed enhancement of EGFP mRNA levels following infection by HSV-1.

FIG. 6.

FIG. 6.

Ability of HSV-1 to enhance EGFP mRNA levels is not dependent upon the presence of intron sequences in the EGFP transcript. Silenced and control cells were obtained by transfection of dsEGFP- or dslacZ-expressing plasmid, respectively, together with EGFP-expressing plasmid as described in the legend to Fig. 4. Cells were either mock infected or infected with HSV-1 42 h later. The EGFP mRNA levels were determined as described in the legend to Fig. 5. The amount of EGFP mRNA in sample sets was compared to that present in mock-infected silenced cells, which was set at 1.0. (A) The EGFP-expressing plasmid (pEGFP-C2) contained no intron sequences. (B) The EGFP target plasmid (pintronEGFP) expressed a transcript that contained an intron within the 5′ untranslated region.

Effect of HSV-1 infection on the stability of EGFP mRNA.

Increased EGFP mRNA levels following infection could have been due to increased mRNA synthesis, increased mRNA stability, or both. Because EGFP silencing in this transient system was due at least in part to an increase in the rate of EGFP mRNA degradation, true silencing suppression by HSV-1 would be expected to increase the stability of EGFP mRNA. To determine the effect of HSV-1 on EGFP mRNA stability, BHK cells were cotransfected with the target EGFP-expressing plasmid (pEGFP-C2) and either the silencing inducer dsEGFP hairpin-expressing plasmid (silenced cells) or control dslacZ hairpin-expressing plasmid (control cells). Cells were either mock infected or infected with wild-type HSV-1 (KOS) at an MOI of 5 PFU/cell 42 h after transfection, and viral gene expression was permitted for an additional 6 h prior to the addition of Act D. The relative amount of EGFP or β-actin mRNA at the time of Act D addition was set to 100%, the levels remaining were plotted as a function of time after Act D addition, and the data were fit to an exponential decay function to estimate half-life. The half-life of β-actin mRNA in HSV-1-infected silenced cells was not significantly different from that in HSV-1-infected control cells (15.5 and 15.4 h, respectively) (Fig. 7A and Table 2). However, these half-lives were significantly shorter than those estimated from mock-infected silenced or control cells (∼21 h) (Table 2), consistent with an increased degradation rate for cellular mRNAs following HSV-1 infection (58). Remarkably, HSV-1 infection of silenced cells increased the half-life of EGFP mRNA to 4.5 h (Fig. 7B and Table 2), compared to the half-life of EGFP mRNA observed in mock-infected silenced cells (2.7 h) (Table 2), confirming that transient silencing had been suppressed by HSV-1. In control cells transfected with EGFP target and dslacZ-expressing plasmids, HSV-1 reduced the half-life of EGFP mRNA compared to that in mock-infected control cells (4.1 h versus 5.4 h in infected versus mock-infected cells) (Table 2). Interestingly, similar stability of EGFP mRNA was observed in control versus silenced cells that were infected with HSV-1 (Fig. 7B and Table 2).

FIG. 7.

FIG. 7.

Effect of HSV-1 infection on mRNA stability. BHK cells were cotransfected with EGFP-expressing plasmid (pEGFP-C2) and plasmid that expressed dsEGFP hairpins (▵, silenced) or dslacZ hairpins (○, control) and infected with HSV-1 42 h following transfection as described in the legend to Fig. 5. Act D was applied to silenced and control cells at 6 h p.i., and the RNA was extracted at various times thereafter. The relative β-actin (A) or EGFP (B) mRNA levels were plotted as a function of time following Act D treatment as described for Fig. 4. The respective mRNA half-lives are reported in Table 2.

Effect of host shutoff functions on HSV-1 silencing suppression.

The increased half-life of EGFP mRNA in infected versus mock-infected silenced cells suggested that specific suppression of EGFP silencing occurred despite the general mRNA-destabilizing effects of virus infection. Two virus-encoded functions have been shown to account for most of the drop in host protein and mRNA levels in HSV-1-infected cells. One of these, the virion host shutoff (vhs) protein, is a virion-associated tegument protein that possesses RNase activity (reviewed in reference 58). vhs protein accounts for the early-shutoff phenotype by increasing the degradation of both cellular and viral mRNAs. ICP27 is an essential immediate-early protein that decreases splicing and transport of intron-containing transcripts and is responsible for the later shutoff (52, 58). To gain some insight into the effect of these host shutoff functions on silencing suppression by HSV-1, we tested a well-characterized vhs missense mutant (vhs-1) and an ICP27 null mutant (27-LacZ) virus for effects on transient EGFP gene silencing compared to the isogenic wild-type virus (KOS). Cells were cotransfected with target and either silencing inducer (dsEGFP)-expressing or control hairpin (dslacZ)-expressing plasmid. Forty-two hours later, cells were mock infected or infected with wild-type, vhs-1, or 27-LacZ virus (5 PFU/cell). The relative steady-state levels of β-actin and EGFP mRNA present 10 h p.i. are shown in Fig. 8A and B, respectively. For ease of comparison, all levels are displayed relative to those present in mock-infected cells (set to 1.0). Although the wild-type virus (KOS) decreased the β-actin mRNA levels in both silenced and control cells relative to those present in mock-infected cells, no such reduction was observed following infection with either of the host shutoff mutants (Fig. 8A). Indeed, β-actin mRNA levels in vhs-1 or 27-LacZ virus-infected silenced or control cells were equal to or greater than those observed in mock-infected cells. In silenced cells, EGFP mRNA levels were approximately 10-fold higher following infection with 27-LacZ mutant virus and 7-fold higher following infection with vhs-1 mutant virus than those for mock-infected silenced cells. In contrast, fivefold-higher levels of EGFP mRNA were detected in wild-type virus-infected silenced cells than in mock-infected silenced cells. As observed previously with wild-type HSV-1, levels of EGFP mRNA in control cells were enhanced moderately (∼70%) following infection with 27-LacZ virus but were enhanced 300% following infection of control cells with vhs-1 mutant virus. To ascertain whether the increased levels of β-actin and EGFP mRNAs in cells infected with the vhs-1 and 27-LacZ mutant viruses were due to increased mRNA stability, we determined the half-lives of EGFP and β-actin mRNAs following infection or mock infection. The results (Table 2) demonstrate that infection with host shutoff mutants had no significant effect on the stability of β-actin mRNA in either silenced or control cells compared to results for mock-infected cells. Likewise, there was no significant change in the half-life of EGFP mRNA in control cells infected with the vhs-1 or 27-LacZ mutant compared to that in mock-infected control cells. However, infection of silenced cells with either of the host shutoff mutants increased the half-life of EGFP mRNA compared to that present in mock-infected silenced cells (Table 2). In fact, the EGFP half-life in the mutant virus-infected silenced cells was virtually indistinguishable from that in mock-infected control cells. Taken together, these results confirm that HSV-1 infection specifically stabilizes EGFP mRNA in silenced cells even in the presence of virus-encoded functions that globally destabilize mRNAs. Moreover, the similarity in EGFP mRNA half-life in silenced cells infected with either host shutoff mutant compared to that in mock-infected control cells suggests that HSV-1 can completely suppress established gene-specific silencing.

FIG. 8.

FIG. 8.

Effect of mutations in viral host shutoff functions on mRNA levels. Silenced (black bars) and control (gray bars) BHK cells were obtained by cotransfection with EGFP- and either dsEGFP- or dslacZ-expressing plasmids, respectively, as described in the legend to Fig. 2. Forty-two hours after transfection, cells were either mock infected or infected (5 PFU/cell) with wild-type HSV-1 (KOS) or with the isogenic viral mutant vhs-1 or 27-LacZ, deficient in vhs or ICP27 function, respectively. RNA was extracted from cells harvested at 10 h p.i., and the β-actin (A) or EGFP (B) mRNA levels were determined and compared by setting the level observed in mock-infected silenced cells to 1.0. Each bar represents the average (± standard deviation) for three replicate samples.

Effects of host silencing response on virus replication.

The ability of HSV-1 to suppress gene-specific silencing despite its global effects on mRNA stability suggested the possibility that reducing silencing might enhance virus replication. To test this hypothesis, we knocked down the expression of a key effector of the silencing response in mammalian cells, Ago2. Ago2 is a component of RISC and is the only Argonaute protein in human cells that contains the slicer activity capable of cleaving target mRNA (24, 38). We used an siRNA that was previously shown to inhibit Ago2 expression and to interfere with RNA-directed cleavage and silencing of target mRNA in human cells (38). HEK 293T cells were transfected with the Ago2 siRNA or a control, RISC-free duplex RNA. qRT-PCR was used to measure the copy number of Ago2 mRNA compared to 18S rRNA levels present 24 and 48 h after the addition of the Ago2 or control siRNA. The results demonstrated >90% knockdown of Ago2 mRNA levels by 48 h after addition of Ago2 siRNA compared to results for controls (Fig. 9A). Cells were infected with HSV-1 (KOS) 48 h after transfection with Ago2-specific siRNA or control RISC-free duplex RNA at input multiplicities of 1 or 10 PFU/cell, and the yield of infectious progeny virus was determined after a single cycle of replication (18 h). The results are shown in Fig. 9B and C, which employed three replicate cultures per sample set. Nearly identical results were obtained in a second independent experiment which employed different lots of duplex RNAs (results not shown). These results demonstrate that the Ago2 siRNA increased the efficiency of replication of HSV-1 wild-type virus (KOS) approximately threefold at both input multiplicities. Though moderate, the enhanced yield of virus in cells in which the Ago2 silencing effector is knocked down was significant and is consistent with the hypothesis that silencing is an antiviral response in mammalian cells. Moreover, enhanced virus production was observed despite the demonstrated ability of this virus to suppress transient silencing.

FIG. 9.

FIG. 9.

Knockdown of Ago2 expression increases HSV-1 replication efficiency. HEK 293T cells were transfected with either an Ago2-specific siRNA duplex (light-gray bars) or a control, RISC-free RNA duplex (dark-gray hatched bars). The amounts of Ago2 and 18S RNA from triplicate samples were determined by quantitative real-time-PCR of cDNA prepared by reverse transcription of RNA from cells harvested 24 and 48 h after transfection as described in Materials and Methods. (A) The average relative copy number of Ago2 mRNA, normalized to the 18S rRNA level, is shown for samples harvested 24 and 48 h following transfection. The amount observed in cells transfected with the control RNA duplex at 24 h was set to 100%. The amount of Ago2 mRNA present following transfection of cells with the control duplex RNA at 24 and 48 h was 4.3 × 104 ± 0.6 × 104 and 4.4 × 104 ± 0.6 × 104 copies/μg RNA, respectively. The amount of Ago2 mRNA was 1.1 × 104 ± 0.1 × 104 and 4.1 × 103 ± 0.5 × 103 copies/μg RNA at 24 and 48 h, respectively, after transfection with the Ago2 siRNA. (B and C) Yields of infectious progeny virus following a single cycle of replication. At 48 h after transfection of 293T cells with the RISC-free RNA duplex (control, dark-gray hatched bars) or Ago2 siRNA (Ago2, light-gray bars), cells were infected with wild-type HSV-1 (strain KOS) at an input MOI of 1 PFU/cell (B) or 10 PFU/cell (C). The yields of infectious viral progeny were determined by plaque assay of triplicate cultures of cells harvested 18 h p.i. An asterisk indicates that the differences in virus yields from control and knockdown cells are significant (P < 0.01).

DISCUSSION

In both plants and animals, RNA silencing plays an important role in controlling developmental processes (1, 2, 27, 70). In plants, insects, and nematodes, silencing is also an innate defense against viruses and retrotransposons (9, 34). The importance of RNA silencing in limiting viral replication is suggested by the ability of viruses to encode RSSs important for pathogenicity in these organisms. However, the role of RNA silencing as an innate antiviral defense in mammals remains controversial despite the demonstration of RSSs encoded by a number of mammalian viruses, including human immunodeficiency virus 1, vaccinia virus, and influenza virus (3, 8, 35). The ability of HSV-1 to alternate between two different life cycles, one of which (i.e., latency) is characterized by silencing of most of the viral genome (29, 46, 65), suggested that silencing suppression could play an important role during the productive replication cycle of the virus. In this report, we have examined the ability of HSV-1 to suppress RNA silencing and the effect of RNA silencing on the efficiency of viral replication.

Differential effects of HSV-1 replication on transiently silenced mRNA versus host mRNA.

The establishment of a transient system to silence a foreign gene irrelevant to virus replication allowed us to examine virus-specific effects on silencing per se without altering host gene expression that could directly or indirectly impact virus replication. In our system, potential nonspecific effects caused by transient transfection of bacterium-derived DNA or by overexpression of an introduced gene or hairpin were controlled by comparisons between cells that received different (dsEGFP versus dslacZ) hairpin-expressing plasmids. In the absence of virus infection, no difference was observed in the steady-state level or half-life of mRNA from the β-actin housekeeping gene regardless of the hairpin expressed. However, the steady-state levels and half-life of the EGFP mRNA were decreased substantially in cells that expressed the dsEGFP compared to those in cells that expressed the dslacZ hairpins, demonstrating that silencing was specific to the targeted gene and was associated with decreased stability of that mRNA (Fig. 5 and 7 and Table 2). The latter result is consistent with the reported propensity for fully complementary miRNA or miRNA-like molecules derived from such hairpins to target perfectly matched mRNA for degradation (11, 75). Following HSV-1 infection of silenced cells, the EGFP mRNA levels and half-life increased over those observed in mock-infected silenced cells. Because the dsEGFP and dslacZ hairpins were expressed from a Pol III promoter, it was theoretically possible that reduced silencing would occur if HSV-1 inhibited Pol III-specific transcription, resulting in a smaller pool of silencing hairpins. However, we found that the amount of dsEGFP hairpin transcripts did not decrease in infected cells but actually increased slightly compared to that in mock-infected cells (results not shown). These results are consistent with those of others which demonstrated that HSV-1 stimulates Pol III-mediated transcription from endogenous Alu repeat-containing elements in cultured human cells (25, 41). Thus, our results demonstrate true silencing suppression by HSV-1. Surprisingly, HSV-1 infection of control cells—i.e., those cotransfected with the EGFP target and control dslacZ hairpin-expressing plasmid—also resulted in a small increase in EGFP mRNA levels over those in mock-infected controls (Fig. 5A and C). This small increase occurred despite the fact that EGFP mRNA was more rapidly degraded in infected control cells than in mock-infected control cells (Table 2). These results could indicate that a portion of the enhanced accumulation of EGFP mRNA is due to enhanced transcription. However, we favor the possibility that overexpression of EGFP in the control cells could induce a mild state of EGFP-specific silencing that is capable of being suppressed by HSV-1 infection. Indeed, overexpression of foreign genes in plants is known to induce weak silencing which can be overcome by the expression of a plant virus RSS (26). Regardless of the mechanism, these results point to the need to demonstrate that all or part of the virus-specific enhancement of target mRNA levels is posttranscriptional and accompanied by a change in mRNA stability.

The increased stability of EGFP mRNA following infection of silenced cells was in sharp contrast to the destabilizing effect of HSV-1 infection, compared to the effect of mock infection, on host β-actin mRNA in silenced cells. We examined the possibility that the differential effects of virus replication on the target EGFP mRNA compared to β-actin mRNA levels could be due to the absence of an intron in the EGFP transcript and the corresponding ability of the HSV-1 immediate-early protein, ICP27, to decrease the processing and transport of intron-containing host mRNA (21, 52) and/or to promote the binding and export of intronless transcripts (37, 51). This appears unlikely for two reasons. First, in silenced cells, wild-type HSV-1 infection enhanced the levels (compared to those in mock-infected cells) of EGFP mRNA by approximately the same extent regardless of whether or not the targeted transcript contained an intron (Fig. 6). Second, in silenced cells, null mutant viruses which failed to express ICP27 were also able to enhance EGFP mRNA accumulation (Fig. 8) and stability (Table 2), compared to those in mock-infected silenced cells, when the target transcript lacked intron sequences.

Effects of host shutoff functions on silencing suppression by HSV-1.

An increased degradation rate of most, though not all, host mRNAs has been previously reported in HSV-1-infected cells (31, 57, 58, 62, 63). The two virus-encoded genes that are responsible for most of the virus-induced host shutoff are those encoding vhs and ICP27 (reviewed in references 52 and 58). The vhs and ICP27 proteins decrease host mRNA levels by different mechanisms. The vhs protein is a component of the tegument of virions and possesses endoribonuclease activity in vitro that specifically targets mRNA (14-16, 64, 74). Due to its availability upon virus entry, vhs is largely responsible for the very early shutoff of cellular macromolecular synthesis (45, 57, 58). Although a loss of vhs function causes only moderate effects on replication efficiency in tissue culture, replication of vhs mutants in mice is highly attenuated (60). In contrast, ICP27 is an immediate-early protein that controls gene expression by multiple mechanisms (52). ICP27 contributes to a later host shutoff, associates with and interferes with splicing and transport of host mRNA, and is essential for productive replication (20, 21, 36, 49, 51, 53). Although EGFP mRNA stability was greater in silenced cells infected with wild-type virus than in mock-infected silenced cells, despite the presence of both the vhs and ICP27 host shutoff functions, the EGFP mRNA half-life in infected silenced (dsEGFP) cells was significantly (P < 0.05) less than that observed in uninfected or mock-infected control (dslacZ) cells (Table 2). It was possible that the lower EGFP mRNA stability in infected silenced cells than in mock-infected control cells could have reflected only a partial ability of the virus to reverse silencing. Alternatively, the lower stability could have been due to the contribution of vhs and/or ICP27 to RNA degradation rates. The increased EGFP mRNA half-life, and therefore silencing suppression, that was observed in cells infected by viruses defective in either vhs or ICP27 function compared to that observed in wild-type-virus-infected cells indicates that both host shutoff functions contribute significantly to the overall stability of the EGFP target mRNA in infected cells compared to results for mock-infected cells (Table 2). Our results also imply that the mechanisms involved in the virus-specific destabilization of mRNAs are distinct from those involved in RNAi-dependent RNA degradation. Moreover, the fact that the half-life of EGFP mRNA in silenced cells infected with either host shutoff mutant was virtually indistinguishable from that in mock-infected control cells suggests that HSV-1 infection can completely reverse established transient silencing.

Effect of silencing on efficiency of virus replication.

The potent ability of HSV-1 to suppress silencing suggests that this attribute could have evolved as a countermeasure to host silencing that is triggered in response to virus infection. Transcription of the HSV-1 genome during lytic replication emanates from both DNA strands and results in the production of an abundance of overlapping, convergent transcripts capable of forming partially duplex RNA (47). Thus, it is possible that host silencing could be triggered by these dsRNAs or processed forms thereof. If not ablated or suppressed, such silencing would be capable of abrogating or reducing the efficiency of virus replication. The impact of host RNA silencing during a single cycle of virus replication was investigated by examining the effect of knocking down expression of Ago2, an important effector of silencing, on the production of infectious progeny virus. Ago2 has been shown to possess the slicer activity responsible for the cleavage of mRNA by RISC programmed with miRNA or siRNA with perfect or near-perfect complementarity to the target mRNA (38). The siRNA selected to knock down Ago2 gene expression was previously validated to interfere with RNA-directed silencing of a target gene in cultured human cells (38). We confirmed knockdown of Ago2 mRNA levels in human 293T cells to less than 10% of that found in cells transfected with a control (RISC-free) duplex RNA, consistent with a significant reduction in silencing capability prior to infection with HSV-1. Infection of these Ago2 siRNA-treated cells with wild-type HSV-1 (strain KOS) resulted in a virus yield that was 2.8- to 3.0-fold higher than that achieved in cells treated with control duplex RNA. Although such an enhancement is modest, it was highly significant (P < 0.01). Moreover, we observed similar enhancement of virus burst size in other independent experiments (not shown) and at both high (10 PFU/cell) and relatively low (1 PFU/cell) multiplicities of infection. It should be pointed out that virus replication was enhanced in cells that are already highly permissive for lytic replication. It remains possible that an even greater enhancement of virus replication might be observed when silencing is knocked down in different cells in culture or in vivo, particularly in cells with a more efficient silencing response.

A modest level of enhancement in the yield of human immunodeficiency virus type 1 was observed in T cells in which two different functions required for RNA silencing activity, Drosher and Dicer, were knocked down independently (66). It is possible that the increased replication efficiency following Ago2 knockdown could be due at least in part to decreased activity of miRNAs encoded by the virus (6, 67). Some of these miRNAs have the capacity to knock down translation of specific immediate-early mRNAs (67), although a role for these miRNAs during the productive replication cycle of HSV-1 has not been demonstrated. More work will be needed to determine the extent to which virus miRNAs regulate replication efficiency before it is possible to distinguish between effects of Ago2 knockdown on host versus virus silencing activities. It should also be pointed out that the increase in efficiency of HSV-1 replication following Ago2 knockdown was observed for a virus capable of suppressing transient silencing. It will be important to identify the HSV-1 gene(s) responsible for silencing suppression and to construct viruses defective in such silencing suppression functions in order to more fully understand the impact of both host and virus silencing activities on virus replication.

Possible roles of silencing and silencing suppression in HSV-1 pathogenesis.

The results of the studies reported herein suggest the possibility for a dynamic equilibrium between the ability of the host or virus to silence virus gene expression and the ability of the virus to suppress silencing. Clearly, host silencing is not completely inhibited by Ago2 knockdown, since some functional RISC complexes are available to efficiently reduce the level of this integral component of the silencing machinery. It is also possible that the equilibrium between silencing and silencing suppression changes throughout the course of infection. In support of such a dynamic relationship, we have observed that in transiently silenced cells, maximum levels of EGFP mRNA were observed 8 to 10 h following HSV-1 infection but rapidly declined at late times postinfection (71a). The end point—virus burst size—used in the replication efficiency experiments shown in this report represents the cumulative effect of these changes on the yield of infectious virus. Temporal changes in the silencing-silencing suppression equilibrium could explain why a virus shown to possess its own encoded miRNAs (6, 67) would also possess potent silencing suppression activity. Thus, it is possible that suppression of host silencing may be important at the earliest stages of the virus replication cycle to allow the virus to maximize immediate-early and early gene expression. Indeed, some of these viral functions have been implicated in either maintaining a euchromatin-like, transcriptionally competent genome and/or preventing the deposition of heterochromatin on the genome (29, 46). At later times, once the virus has had the opportunity to express the multiplicity of genes required to hijack the host's defenses and macromolecular machinery, silencing suppression could be reduced, thus allowing virus-encoded miRNAs, such as those that target immediate-early gene expression (67), to function efficiently. Such downregulation may be important to maximize virus yields during productive replication. It is also possible that downregulation of these important regulatory proteins might not be as important in tissue culture as within an infected host. Indeed, downregulation of these proteins by miRNA could be important to limit immune recognition of infected cells within the host, as was observed for a simian virus 40-encoded miRNA specific for T antigen (61). Moreover, refined modulation of levels of HSV-1 ICP0, ICP4, or other viral proteins could be permitted by temporally specific or host cell-specific changes in the equilibrium between silencing and silencing suppression. This in turn could facilitate the ability of the virus not only to replicate productively but also to establish latency. Our findings, which clearly elucidate the ability of HSV-1 to suppress RNA silencing in mammalian cells, identify a novel mechanism by which this highly evolved and complex virus is capable of refining the cellular environment following infection.

Acknowledgments

We thank the past and present members of the Bisaro and Parris laboratories for their help and advice during the course of these studies. We also are grateful to Roz Sandri-Goldin and Sully Read for their gifts of mutant viruses and cell lines, to Bill Lafuse for providing the β-actin plasmid construct, to Yaoling Shu for assistance with qRT-PCR, and to Shuangling He for statistical analysis.

This work was supported in part by grant R21 AI062837 (to D.S.P. and D.M.B.) and grant R01 GM073832 (to D.S.P.) from the National Institutes of Health, by National Science Foundation grant MCB-0743261 (to D.M.B.), and by USDA National Research Initiative grant 2004-35301-14508 (to D.M.B.). Core services were provided by the Department of Molecular Virology, Immunology, and Medical Genetics and the Ohio State University Comprehensive Cancer Center.

Footnotes

▿

Published ahead of print on 15 April 2009.

REFERENCES

  • 1.Ambros, V. 2004. The functions of animal microRNAs. Nature 431350-355. [DOI] [PubMed] [Google Scholar]
  • 2.Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116281-297. [DOI] [PubMed] [Google Scholar]
  • 3.Bennasser, Y., S.-Y. Le, M. Benkirane, and K.-T. Jeang. 2005. Evidence that HIV-1 encodes an siRNA and a suppressor of RNA silencing. Immunity 22607-619. [DOI] [PubMed] [Google Scholar]
  • 4.Bisaro, D. M. 2006. Silencing suppression by geminivirus proteins. Virology 344158-168. [DOI] [PubMed] [Google Scholar]
  • 5.Bothwell, A. L., M. Paskind, M. Reth, T. Imanishi-Kari, K. Rajewsky, and D. Baltimore. 1981. Heavy chain variable region contribution to the NPb family of antibodies: somatic mutation evident in a gamma 2a variable region. Cell 24625-637. [DOI] [PubMed] [Google Scholar]
  • 6.Cui, C., A. Griffiths, G. Li, L. M. Silva, M. F. Kramer, T. Gaasterland, X.-J. Wang, and D. M. Coen. 2006. Prediction and identification of herpes simplex virus 1-encoded microRNAs. J. Virol. 805499-5508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cullen, B. R. 2006. Is RNA interference involved in intrinsic antiviral immunity in mammals? Nat. Immunol. 7563-567. [DOI] [PubMed] [Google Scholar]
  • 8.de Vries, W., and B. Berkhout. 2008. RNAi suppressors encoded by pathogenic human viruses. Int. J. Biochem. Cell Biol. 402007-2012. [DOI] [PubMed] [Google Scholar]
  • 9.Ding, S.-W., and O. Voinnet. 2007. Antiviral immunity directed by small RNAs. Cell 130413-426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Doench, J. G., C. P. Petersen, and P. A. Sharp. 2003. siRNAs can function as miRNAs. Genes Dev. 17438-442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dunoyer, P., C.-H. Lecellier, E. A. Parizotto, C. Himber, and O. Voinnet. 2004. Probing the microRNA and small interfering RNA pathways with virus-encoded suppressors of RNA silencing. Plant Cell 161235-1250. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 12.Dykxhoorn, D. M. 2007. MicroRNAs in viral replication and pathogenesis. DNA Cell Biol. 26239-249. [DOI] [PubMed] [Google Scholar]
  • 13.Elbashir, S. M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15188-200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Elgadi, M. M., C. E. Hayes, and J. R. Smiley. 1999. The herpes simplex virus vhs protein induces endoribonucleolytic cleavage of target RNAs in cell extracts. J. Virol. 737153-7164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Everly, D. N., Jr., P. Feng, I. S. Mian, and G. S. Read. 2002. mRNA degradation by the virion host shutoff (Vhs) protein of herpes simplex virus: genetic and biochemical evidence that Vhs is a nuclease. J. Virol. 768560-8571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Feng, P., D. N. Everly, Jr., and G. S. Read. 2001. mRNA decay during herpesvirus infections: interaction between a putative viral nuclease and a cellular translation factor. J. Virol. 7510272-10280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gitlin, L., and R. Andino. 2003. Nucleic acid-based immune system: the antiviral potential of mammalian RNA silencing. J. Virol. 777159-7165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gottwein, E., and B. R. Cullen. 2008. Viral and cellular microRNAs as determinants of viral pathogenesis and immunity. Cell Host Microbe 3375-387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Haasnoot, J., W. de Vries, E.-J. Geutjes, M. Prins, P. de Haan, and B. Berkhout. 2007. The Ebola virus VP35 protein is a suppressor of RNA silencing. PLoS Pathog. 3e86-e95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hardwicke, M. A., and R. M. Sandri-Goldin. 1994. The herpes simplex virus regulatory protein ICP27 contributes to the decrease in cellular mRNA levels during infection. J. Virol. 684797-4810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hardy, W. R., and R. M. Sandri-Goldin. 1994. Herpes simplex virus inhibits host cell splicing, and regulatory protein ICP27 is required for this effect. J. Virol. 687790-7799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Huang, M. T. F., and C. M. Gorman. 1990. Intervening sequences increase efficiency of RNA 3′ processing and accumulation of cytoplasmic RNA. Nucleic Acids Res. 18937-947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Huang, M. T. F., and C. M. Gorman. 1990. The simian virus 40 small-t intron, present in many common expression vectors, leads to aberrant splicing. Mol. Cell. Biol. 101805-1810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hutvagner, G., and M. J. Simard. 2008. Argonaute proteins: key players in RNA silencing. Nat. Rev. Mol. Cell Biol. 922-32. [DOI] [PubMed] [Google Scholar]
  • 25.Jang, K. L., and D. S. Latchman. 1992. The herpes simplex virus immediate-early protein ICP27 stimulates the transcription of cellular Alu repeated sequences by increasing the activity of transcription factor TFIIIC. Biochem. J. 284667-673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Johansen, L. K., and J. C. Carrington. 2001. Silencing on the spot: induction and suppression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant Physiol. 126930-938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jones-Rhoades, M. W., D. P. Bartel, and B. Bartel. 2006. MicroRNAS and their regulatory roles in plants. Annu. Rev. Plant Biol. 5719-53. [DOI] [PubMed] [Google Scholar]
  • 28.Kasschau, K. D., Z. Xie, E. Allen, C. Llave, E. J. Chapman, K. A. Krizan, and J. C. Carrington. 2003. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 4205-217. [DOI] [PubMed] [Google Scholar]
  • 29.Knipe, D. M., and A. Cliffe. 2008. Chromatin control of herpes simplex virus lytic and latent infection. Nat. Rev. Microbiol. 6211-221. [DOI] [PubMed] [Google Scholar]
  • 30.Kwak, Y. D., H. Koike, and K. Sugaya. 2003. RNA interference with small hairpin RNAs transcribed from a human U6 promoter-driven DNA vector. J. Pharmacol. Sci. 93214-217. [DOI] [PubMed] [Google Scholar]
  • 31.Kwong, A. D., and N. Frenkel. 1987. Herpes simplex virus-infected cells contain a functions(s) that destabilizes both host and viral mRNAs. Proc. Natl. Acad. Sci. USA 841926-1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kwong, A. D., J. A. Kruper, and N. Frenkel. 1988. Herpes simplex virus virion host shutoff function. J. Virol. 62912-921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lecellier, C.-H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A. Saïb, and O. Voinnet. 2005. A cellular microRNA mediates antiviral defense in human cells. Science 308557-560. [DOI] [PubMed] [Google Scholar]
  • 34.Li, F., and S.-W. Ding. 2006. Virus counterdefense: diverse strategies for evading the RNA-silencing immunity. Annu. Rev. Microbiol. 60503-531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li, W.-X., H. Li, R. Lu, F. Li, M. Dus, P. Atkinson, E. W. A. Brydon, K. L. Johnson, A. Garcia-Sastre, L. A. Ball, P. Palese, and S.-W. Ding. 2004. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proc. Natl. Acad. Sci. USA 1011350-1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.McLauchlan, J., A. Phelan, C. Loney, R. M. Sandri-Goldin, and J. B. Clements. 1992. Herpes simplex virus IE63 acts at the posttranscriptional level to stimulate viral mRNA 3′ processing. J. Virol. 666939-6945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mears, W. E., and S. A. Rice. 1996. The RGG box motif of the herpes simplex virus ICP27 protein mediates an RNA-binding activity and determines in vivo methylation. J. Virol. 707445-7453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Meister, G., M. Landthaler, A. Patkaniowska, Y. Dorsett, G. Teng, and T. Tuschl. 2004. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15185-197. [DOI] [PubMed] [Google Scholar]
  • 39.Oroskar, A. A., and G. S. Read. 1989. Control of mRNA stability by the virion host shutoff function of herpes simplex virus. J. Virol. 631897-1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Paddison, P. J., A. A. Caudy, E. Bernstein, G. J. Hannon, and D. S. Conklin. 2002. Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev. 16948-958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Panning, B., and J. R. Smiley. 1994. Activation of RNA polymerase III transcription of human Alu elements by herpes simplex virus. Virology 202408-417. [DOI] [PubMed] [Google Scholar]
  • 42.Parris, D. S., R. J. Courtney, and P. A. Schaffer. 1978. Temperature-sensitive mutants of herpes simplex virus type 1 defective in transcriptional and post-transcriptional functions required for viral DNA synthesis. Virology 90177-186. [DOI] [PubMed] [Google Scholar]
  • 43.Pedersen, I. M., G. Cheng, S. Wieland, S. Volinia, C. M. Croce, F. V. Chisari, and M. David. 2007. Interferon modulation of cellular microRNAs as an antiviral mechanism. Nature 449919-922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Randall, R. E., and S. Goodbourn. 2008. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 891-47. [DOI] [PubMed] [Google Scholar]
  • 45.Read, G. S., and N. Frenkel. 1983. Herpes simplex virus mutants defective in the virion-associated shutoff of host polypeptide synthesis and exhibiting abnormal synthesis of α (immediate early) viral polypeptides. J. Virol. 46498-512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Roizman, B., H. Gu, and G. Mandel. 2005. The first 30 minutes in the life of a virus: unREST in the nucleus. Cell Cycle 41019-1021. [DOI] [PubMed] [Google Scholar]
  • 47.Roizman, B., D. M. Knipe, and R. J. Whitley. 2007. Herpes simplex viruses, p. 2501-2602. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 5th ed. Lippincott Williams and Wilkins, Philadelphia, PA.
  • 48.Sachidanandam, R. 2005. RNAi as a bioinformatics consumer. Brief. Bioinform. 6146-162. [DOI] [PubMed] [Google Scholar]
  • 49.Sacks, W. R., C. C. Greene, D. P. Aschman, and P. A. Schaffer. 1985. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J. Virol. 55796-805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 51.Sandri-Goldin, R. M. 1998. ICP27 mediates HSV RNA export by shuttling through a leucine-rich nuclear export signal and binding viral intronless RNAs through an RGG motif. Genes Dev. 12868-879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sandri-Goldin, R. M. 2008. The many roles of regulatory protein ICP27 during herpes simplex virus infection. Front. Biosci. 135241-5256. [DOI] [PubMed] [Google Scholar]
  • 53.Sandri-Goldin, R. M., and G. E. Mendoza. 1992. A herpes virus regulatory protein appears to act post-transcriptionally by affecting mRNA processing. Genes Dev. 6848-863. [DOI] [PubMed] [Google Scholar]
  • 54.Saumet, A., and C.-H. Lecellier. 2006. Anti-viral RNA silencing: do we look like plants? Retrovirology 33-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Schütz, S., and P. Sarnow. 2006. Interaction of viruses with the mammalian RNA interference pathway. Virology 344151-157. [DOI] [PubMed] [Google Scholar]
  • 56.Senapathy, P., M. B. Shapiro, and N. L. Harris. 1990. Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project. Methods Enzymol. 183252-278. [DOI] [PubMed] [Google Scholar]
  • 57.Smibert, C. A., D. C. Johnson, and J. R. Smiley. 1992. Identification and characterization of the virion-induced host shutoff product of herpes simplex virus gene UL41. J. Gen. Virol. 73467-470. [DOI] [PubMed] [Google Scholar]
  • 58.Smiley, J. R. 2004. Herpes simplex virus virion host shutoff protein: immune evasion mediated by a viral RNase? J. Virol. 781063-1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Smith, I. L., M. A. Hardwicke, and R. M. Sandri-Goldin. 1992. Evidence that the herpes simplex virus immediate early protein ICP27 acts post-transcriptionally during infection to regulate gene expression. Virology 18674-86. [DOI] [PubMed] [Google Scholar]
  • 60.Strelow, L. I., and D. A. Leib. 1995. Role of the virion host shutoff (vhs) of herpes simplex virus type 1 in latency and pathogenesis. J. Virol. 696779-6786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Sullivan, C. S., and D. Ganem. 2005. MicroRNAs and viral infection. Mol. Cell 203-7. [DOI] [PubMed] [Google Scholar]
  • 62.Taddeo, B., A. Esclatine, and B. Roizman. 2002. The patterns of accumulation of cellular RNAs in cells infected with a wild-type and a mutant herpes simplex virus 1 lacking the virion host shutoff gene. Proc. Natl. Acad. Sci. USA 9917031-17036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Taddeo, B., A. Esclatine, W. Zhang, and B. Roizman. 2003. The stress-inducible immediate-early responsive gene IEX-1 is activated in cells infected with herpes simplex virus 1, but several viral mechanisms, including 3′ degradation of its RNA, preclude expression of the gene. J. Virol. 776178-6187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Taddeo, B., W. Zhang, and B. Roizman. 2006. The UL41 protein of herpes simplex virus 1 degrades RNA by endonucleolytic cleavage in absence of other cellular or viral proteins. Proc. Natl. Acad. Sci. USA 1032827-2832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Taylor, T. J., M. A. Brockman, E. E. McNamee, and D. M. Knipe. 2002. Herpes simplex virus. Front. Biosci. 7d752-d764. [DOI] [PubMed] [Google Scholar]
  • 66.Triboulet, R., B. Mari, Y.-L. Lin, C. Chable-Bessia, Y. Bennasser, K. Lebrigand, B. Cardinaud, T. Maurin, P. Barbry, V. Baillat, J. Reynes, P. Corbeau, K.-T. Jeang, and M. Benkirane. 2007. Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science 3151579-1582. [DOI] [PubMed] [Google Scholar]
  • 67.Umbach, J. L., M. F. Kramer, I. Jurak, H. W. Karnowski, D. M. Coen, and B. R. Cullen. 2008. MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454780-783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Vaucheret, H. 2006. Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev. 20759-771. [DOI] [PubMed] [Google Scholar]
  • 69.Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet. 6206-220. [DOI] [PubMed] [Google Scholar]
  • 70.Voinnet, O. 2002. RNA silencing: small RNAs as ubiquitous regulators of gene expression. Curr. Opin. Plant Biol. 5444-451. [DOI] [PubMed] [Google Scholar]
  • 71.Wang, Y., N. Kato, A. Jazag, N. Dharel, M. Otsuka, H. Taniguchi, T. Kawabe, and M. Omata. 2006. Hepatitis C virus core protein is a potent inhibitor of RNA silencing-based antiviral response. Gastroenterology 130883-892. [DOI] [PubMed] [Google Scholar]
  • 71a.Wu, Z. 2008. Ph.D. dissertation. Ohio State University, Columbus.
  • 72.Yang, D., H. Lu, and J. W. Erickson. 2000. Evidence that processed small dsRNAs may mediate sequence-specific mRNA degradation during RNAi in Drosophila embryos. Curr. Biol. 101191-1200. [DOI] [PubMed] [Google Scholar]
  • 73.Zamore, P. D., T. Tuschl, P. A. Sharp, and D. P. Bartel. 2000. RNAi: dsRNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 10125-33. [DOI] [PubMed] [Google Scholar]
  • 74.Zelus, B. D., R. S. Stewart, and J. Ross. 1996. The virion host shutoff protein of herpes simplex virus type 1: messenger ribonucleolytic activity in vitro. J. Virol. 702411-2419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Zeng, Y., R. Yi, and B. R. Cullen. 2003. MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc. Natl. Acad. Sci. USA 1009779-9784. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES