Identification of the pollen self-incompatibility determinant in Papaver rhoeas

Abstract

Higher plants produce seed through pollination, using specific interactions between pollen and pistil. Self-incompatibility (SI) is an important mechanism used in many species to prevent inbreeding, and is controlled by a multi-allelic S locus^1,2. “Self” (incompatible) pollen is discriminated from “non-self” (compatible) pollen, by interaction of pollen and pistil S locus components, and is subsequently inhibited. In Papaver rhoeas, the pistil S locus product is a small protein that interacts with incompatible pollen, triggering a Ca²⁺-dependent signalling network, resulting in pollen inhibition and programmed cell death^3-7. Here we have cloned three alleles of a highly polymorphic pollen-expressed gene, PrpS, from Papaver and provide evidence that this encodes the pollen S locus determinant. PrpS is a single copy gene linked to the pistil S gene, PrsS. Sequence analysis indicates that PrsS and PrpS are equally ancient and are likely to have co-evolved. PrpS encodes a novel ~20 kDa protein. Consistent with predictions that it is a transmembrane protein, PrpS is associated with the plasma membrane. We show that a predicted extracellular loop segment of PrpS interacts with PrsS and, using PrpS antisense oligonucleotides, we demonstrate that PrpS is involved in S-specific inhibition of incompatible pollen. Identification of PrpS represents a major advance in our understanding of the Papaver SI system. As a novel cell-cell recognition determinant it contributes to the available information concerning the origins and evolution of cell-cell recognition systems involved in discrimination between “self” and “non-self”, which also include histocompatibility systems in primitive chordates and vertebrates.

It has been established that self-incompatibility (SI) has evolved independently several times. Three SI systems have been well characterised at a molecular level^1,2. Both pollen and pistil S determinants are expected to have co-evolved and be physically linked to the S locus in order to maintain a functional SI system. Other characteristics expected of them are high levels of allelic polymorphism and tissue specific expression. Most importantly, they should function in mediating the SI response. To fully understand how different SI systems operate, identification of both the pistil and pollen S locus components, together with establishing mechanisms involved in pollen inhibition is crucial. Previously, we identified the pistil S determinant for Papaver rhoeas^8-10 and established several components involved in pollen inhibition^3-7,11. Although we identified a glycoprotein in pollen that bound to the pistil S protein, studies indicated that it was not the pollen S determinant, though it might modulate the SI response¹². Recent analysis of the S₁ locus enabled identification of the pollen component of the S locus on a cosmid clone comprising a 42 kb region at the S₁ locus.

Nucleotide sequencing and analysis identified a novel putative open reading frame (ORF) 457 bp from the S₁ pistil gene (Fig 1a). Expression analysis using RT-PCR revealed that the ORF was specifically transcribed in pollen (Fig 1b), appearing during anther development (Fig 1c). The temporal expression pattern is very similar to that of the pistil S gene⁸. These data suggested that this ORF was a candidate for the Papaver pollen S gene (designated PrpS: Papaver rhoeas pollen S). We propose renaming the gene that determines SI specificity in pistils (currently designated simply S) to provide a clearer nomenclature; we suggest PrsS (for Papaver rhoeas stigma S determinant).

Fig 1. Organization and expression of PrpS₁.

(a) Organization of the S₁ locus. Arrows indicate pistil PrsS₁ and pollen PrpS₁ coding sequences and their orientation; transcription start site (+1). An intron is located 84 bp from the 3′ end.

(b) RT-PCR shows PrpS₁ is expressed in pollen (P) but not in leaf (L), ovary (O) or stigma (S) (top panel). (c) RT-PCR showing PrpS₁ expression increases during anther development. Immature anthers (IA); anthers 3 (-3A), 2 (-2A), 1 (-1A) days pre-anthesis, and at anthesis (+1A). Glyceraldehyde-3-phosphate dehydrogenase (GAPD) shows equal loading (bottom panels).

(d) Alignment of PrpS₁, PrpS₃ and PrpS₈ deduced amino acid sequences. The predicted extracellular loop segment (TMHMM) is indicated for PrpS₁ (grey box).

(e) Linkage of PrpS and PrsS to the S locus. Full-sib families segregating for haplotypes (i) S₁S₃ and S₃S₈ and (ii) S₁S₈ and S₃S₈ were used for PCR. Pistil PrsS₁-, PrsS₃- and PrsS₈- and pollen PrpS₁, PrpS₃ and PrpS₈ sequences were amplified only if plants carried the corresponding PrpS allele. S haplotypes are indicated: S₁S₃ (1,3), S₃S₈ (3,8), S₁S₈ (1,8).

The cDNA of PrpS₁ comprises 1206 bp containing a coding region of 579 bp encoding a 192 amino acid polypeptide with a predicted M_r of 20.5 kDa, pI 7.55. We subsequently cloned PrpS₃ and PrpS₈ from S₃S₈ pollen RNA. The PrpS₃ and PrpS₈ coding sequences are 576 bp and 582 bp (191 and 193 amino acids) respectively (Fig 1d); PrpS₃ and PrpS₈ encode proteins of predicted Mr of 21.1 kDa (pI 6.57) and 20.9 kDa (pI 8.51) respectively. Southern blotting revealed that PrpS is single copy (Supplemental Fig 1), so the related sequences identified as PrpS₃ and PrpS₈ are clearly allelic to PrpS₁, rather than being related/paralogous genes.

Segregation analyses were conducted to obtain evidence of genetic linkage at the S locus between PrsS₃ and PrpS₃ and between PrsS₈ and PrpS₈. Specific primers were used to amplify regions of the pistil PrsS₁, PrsS₃ and PrsS₈ and pollen PrpS₁, PrpS₃ and PrpS₈ genes from genomic DNA from two full-sib families segregating for these haplotypes (45 and 25 individuals, a total of 140 PrpS/PrsS pairs). PrpS₁ was amplified only from plants carrying S₁; PrpS₃ was amplified only from plants carrying S₃ and PrpS₈ was amplified only from plants carrying the S₈ haplotype. The pistil PrsS₁, PrsS₃ and PrsS₈ sequences were also amplified only from plants carrying the respective S haplotypes (Fig 1e), as expected. This demonstrates co-segregation and linkage of PrpS₁, PrpS₃ and PrpS₈ and their cognate PrsS genes, as no recombination was detected (recombination frequency <0.021). Thus, at the 95% rejection level we can be confident that there is no recombination.

A strikingly high level of allelic sequence polymorphism is a well-documented feature of S locus proteins; S alleles have unusually high amino acid sequence divergence within species^13-15. Papaver is no exception; the pistil proteins PrsS₁ and PrsS₃ exhibit 46% sequence divergence; PrsS₁ and PrsS₈ have 40%, and PrsS₃ and PrsS₈ 46% divergence. PrpS proteins exhibit a similar level of polymorphism (Fig 1d); the PrpS₁ and PrpS₃ predicted amino acid sequences are 50% divergent; PrpS₁ and PrpS₈ exhibit 40% divergence; PrpS₃ and PrpS₈ are 47% divergent¹⁶.

The pollen and pistil S determinants should exhibit evidence of co-evolution. Examination of the PrpS sequences for non-synonymous to synonymous (Ka/Ks) substitutions reveal that the PrsS alleles have a mean Ka/Ks ratio of 0.234, and the PrpS alleles have a mean Ka/Ks ratio of 0.368 (Supplemental Table 1). A two-tailed t-test showed no significant difference between substitution rates in PrpS and PrsS genes. These data suggest that the pollen and pistil S alleles co-evolved and are likely to be similarly ancient.

PrpS has no significant sequence homology to any protein in existing databases. Sequence analysis, using a range of prediction programmes, indicated that PrpS has 3-5 predicted transmembrane helices and alignment of the three PrpS alleles indicates that they share a similar topology (Fig 1d; Supplemental Fig 2). In support of predictions that PrpS is a transmembrane protein, western analysis using antisera raised against PrpS₁, revealed that PrpS₁ was detected as a ~20 kDa protein specifically in S₁ pollen membrane-enriched extracts (Fig 2a-c). Moreover, immunolocalization studies revealed that PrpS₁ is associated with the pollen tube plasma membrane (Fig 2d). Although the PrpS sequences do not show any particular bias for the “positive inside rule”¹⁷, structural predictions suggest an extracellular loop segment, comprising amino acids ~60-100 (63-97 using TMHMM, Fig 1d; Supplemental Fig 2). We hypothesized that this region might be involved in the interaction with PrsS and show that a peptide corresponding to part of the predicted PrpS extracellular loop interacted with the PrsS protein, while the corresponding randomized peptide did not (Fig 2e).

Fig 2. PrpS is pollen membrane-associated.

(a) Western blotting detects PrpS₁ at ~20 kDa (arrow) in pollen (P), but not stigma (S), leaf (L) or root (R) membrane-enriched protein extracts (left-hand panel). Coomassie staining shows equal loading (right-hand panel).

(b) PrpS₁ is expressed in pollen samples carrying S₁, but not other alleles (left-hand panel). Coomassie shows equal loading (right-hand panel).

(c) Western blot of fractionated pollen extracts. PrpS is not present in cytosolic extracts, but is present in a Triton-X-100 enriched fraction.

(d) Immunolocalization shows PrpS₁ localization to the pollen tube plasma membrane. Scale bar, 10 μm.

(e) PrpS₁ binds PrsS₁. A 15-mer peptide corresponding to part of the PrpS₁ predicted 35 amino acid extracellular loop region (DQKWVVAFGTAAICD) binds recombinant PrsS₁ in a concentration-dependent manner (top panel). A corresponding randomized peptide (FTVDVKDCAAAWGQI) did not bind PrsS₁ (bottom panel). Concentrations are as indicated; see Methods for details; n=8.

To determine whether PrpS is functionally involved in the SI response, we investigated whether it mediates S specific pollen inhibition, using in vitro SI bioassays⁸. Peptides based on extracellular domains of receptors have been used to identify ligand-binding epitopes via their ability to block the receptor-ligand interaction¹⁸. Preliminary experiments with the peptide used in the binding assay tested if it could block SI-mediated inhibition. Pollen from plants with haplotypes S₁S₃, when challenged with incompatible recombinant PrsS, were rescued from inhibition by PrpS₁ peptides (n = 6; P < 0.001, ***), while randomized peptides based on the same amino acids had no effect (n=3; N.S.; Supplemental Fig 3). This is consistent with the hypothesis that this region is involved in recognition and indicated that PrpS might mediate pollen inhibition. To confirm this possibility, we used an antisense oligonucleotide approach^3,19. We hypothesized that if PrpS functions as the pollen S determinant, knockdown of its expression should result in alleviation of pollen tube inhibition in an S-specific manner. We induced SI in vitro in the presence of either antisense- (as-ODNs) or sense- (s-ODNs) oligonucleotides to test this hypothesis. As our plants are heterozygous for S haplotypes, the pollen phenotype of plants with S₁S₃ haplotypes should theoretically be 50% S₁ and 50% S₃. Thus, if the interaction is S-specific, as-ODNs specific for PrpS₁ should only affect the 50% of pollen (carrying S₁).

SI induced strong inhibition of pollen tube growth (a 79% reduction in length compared to the controls) and we observed a significant alleviation of this inhibition in an incompatible combination in the presence of as-ODNs and not with corresponding s-ODNs (Fig 3). With pollen from plants with S₁S₃ haplotypes, SI induced strong inhibition of pollen tube length (22.1%, P<0.001 ***, n=300) and addition of as-PrpS₁-ODNs gave a highly significant recovery of SI-treated tubes (58.3% increase in length compared to SI-treated; P<0.001, ***, n=150), and incompatible pollen responded in a bimodal manner, consistent with only S₁ pollen being affected (Supplemental Fig 4). When as-PrpS₈-ODNs were added to the same pollen from plants with S₁ and S₃ haplotypes, they did not alleviate SI-induced inhibition (P=0.604, N.S., n=150). This demonstrates that the PrpS₁ and PrpS₈ as-ODNs had an S-specific effect. As expected, s-PrpS₁-ODNs did not affect the SI response (P=0.591, N.S., n=150).

Fig 3. PrpS determines S-specific pollen inhibition.

PrpS₁ and PrpS₈ antisense oligonucleotides (as-ODNs: as-PrpS₁, as-PrpS₈) “rescue” pollen from plants with S₁S₃ or S₃S₈ haplotypes, from SI-induced inhibition in an S-specific manner, while PrpS₁ and PrpS₈ sense oligonucleotides (s-ODNs: s-PrpS₁, s-PrpS₈) do not. Controls: untreated pollen and as-ODNs without SI induction controls (white bars); SI-induced pollen (black bars); SI-induced in presence of as-ODN (crosshatched bars); SI-induced in presence of s-ODNs (dotted bars). 50 pollen tubes were measured in three independent experiments (150 in total); error bars indicate s.e.m.

To further confirm the S-specific effect of the as-ODNs, we also tested their effect on pollen from plants with haplotypes S₃S₈. SI resulted in inhibited pollen tubes (19.8% of the control, n=300), and addition of as-PrpS₈-ODNs alleviated the SI-induced inhibition, giving a highly significant 100.3% increase in pollen tube length (P=<0.001, ***, n=150), whereas there was no effect using as-PrpS₁-ODNs (P=0.336, N.S., n=150) or s-PrpS₈-ODNs (P=0.565, N.S., n=150) (Fig 3). Together these data demonstrate that PrpS plays a crucial role in SI-induced S haplotype-specific pollen tube inhibition.

In summary, we have cloned a polymorphic pollen-expressed gene, PrpS. Together our data are consistent with the hypothesis that PrpS is the Papaver pollen S determinant as it mediates S-specific recognition and inhibition. SI in Papaver is distinct from the other well characterized SI systems (i.e. from both the Brassica pollen S determinant SCR/SP11 and the pollen F-box protein SLF/SFB from the S-RNase based SI system)^1,20-23. As PrpS has no homologues, its nature is intriguing. Self-nonself discrimination and other recognition systems which are controlled by a highly polymorphic locus are not limited to SI; other systems include disease resistance in plants²⁴, and histocompatibility systems in animals^25-27. These parallels between non-analogous recognition systems were recognized, and their importance appreciated, long before the molecular basis of these systems were elucidated²⁵ and the nature of their polymorphism has intrigued population and evolutionary biologists for decades. The identification of PrpS as a novel cell-cell recognition determinant thus contributes to the available information regarding the evolution of self-nonself recognition systems.

METHODS SUMMARY

Cloning of PrpS₁, PrpS₃ and PrpS₈

A genomic clone of PrpS₁ was identified by nucleotide sequence analysis of a 42 kb clone carrying the S₁ locus, obtained by screening a Papaver rhoeas S₁S₃ cosmid genomic DNA library (SuperCos1, Stratagene) with PrsS₁ cDNA. The DNA upstream and downstream of the PrsS₁ gene was sequenced and analyzed using BLAST (http://ncbi.nlm.nih.gov/BLAST) and ORF Finder (http://searchlauncher.bcm.tmc.edu)²⁸. The organisation of PrpS₁ and PrsS₁ genes was confirmed using PCR on genomic DNA of S₁- and non-S₁- containing plants. PrpS₃ and PrpS₈ cDNAs were obtained using RT-PCR, 3′ and 5′-RACE PCR (see On-line Methods for primer details) on pollen cDNA from suitable S-haplotypes, using low annealing temperatures (48 °C).

Ka/Ks calculations

DNAsP²⁹ was used to estimate the Ka (the number of non-synonymous substitutions per non-synonymous site), and Ks (the number of synonymous substitutions per synonymous site) for pairs of PrsS and PrpS nucleotide sequences.

Peptide binding assay

A 15 aa peptide (DQKWVVAFGTAAICD) corresponding to part of the predicted extracellular loop segment of PrpS₁ (TMHMM; http://www.cbs.dtu.dk/services/TMHMM​³⁰) and a randomized version (FTVDVKDCAAAWGQI) were synthesized (Alta Bioscience, University of Birmingham). The peptides (10 μg, 1 μg, 0.1 μg) were bound to PVDF membrane. This was incubated with recombinant PrsS₁ and then probed for binding using α-PrsS₁ antisera and alkaline phosphatase detection.

Antisense oligo silencing of PrpS expression

Phosphorothioated gene-specific antisense oligodeoxynucleotides (as-ODN) and their sense controls (s-ODN) were designed (PrpS₁ as-ODN: gtccTCCCAGTATTAttga, PrpS₁ s-ODN: tcaaTAATACTGGGAggac, PrpS₈ as-ODN: ttccCACCAGCACAGCaatt, PrpS₈ s-ODN: aattGCTGTGCTGGTGggaa; lower case letters indicate bases linked by phosphorothioate bonds). Pollen was grown in vitro and pre-treated with as-ODNs and s-ODNs^3,19 for 1 h prior to induction of SI with recombinant PrsS₁, PrsS₃ and PrsS₈​⁸. After 2 hours, pollen tubes were fixed in 2% formaldehyde and 150 pollen tube lengths were measured in three independent experiments.

Methods

Sequence homology comparisons

Sequence identities were calculated for PrsS and PrpS, using pairwise comparisons of the amino acids comprising the mature peptide, using BLAST (BLOSUM62)³¹.

Southern blotting

Southern blots of Papaver genomic DNA from plants of different S-haplotypes (S₁S₈, S₁S₃, S₃S₈, S₂S₄, S₃S₄, S₇S_x) digested with EcoRV, BamHI, Pst1 or BglII, were probed with a PrpS₁ probe. Blots were hybridised at 60°C overnight and washed down to 0.5 × SSC at 50°C, and signals detected using autoradiography.

Structural predictions for PrpS and interpretation of the data

We analysed PrpS sequences using a number of protein prediction programmes: TMHMM2.0³², PredictProtein, SOSUI, HMMTOP, TMpred, TM-Finder, SPLIT 4, ConPredII, Phobius. TMHMM2.0 in particular, is regarded as a very robust transmembrane helix predictor, though predicting the number of membrane-spanning regions remains difficult³³. Although predictions differ, they all predict that PrpS has transmembrane helices. We have been advised that the predictions suggest anything between 3-5 transmembrane segments and the alignment of the PrpS sequences suggests that all three proteins share a similar topology. Although many predictions indicated 3 or 5 TM domains, it is more likely that PrpS has four transmembrane segments, as it is a good number to make a four helix bundle in the membrane, as 3 and 5 TM proteins are rare (Dr. A. Lovering, personal communication). All the predictions indicate an extracellular loop segment. SI Fig 2 shows a cartoon indicating a prediction for the regions; this is a tentative assignment of possible topology.

Linkage analysis

Segregation analysis was carried out on individual plants from several full-sib families which share three S haplotypes and segregate for haplotypes S₁S₃ or S₃S₈ and S₁S₈ or S₃S₈. These are well established families, in which S haplotypes were designated ~20 years ago, produced using controlled crosses between individuals which had their S-haplotypes verified using aniline blue microscopy; they have been analyzed for S allele segregation for at least seven generations in a pedigree going back to 1994.

The number of plants required to be analyzed, in order to statistically be confident at 95% rejection level³⁴ that there is recombination, is 25 plants (one cannot formally provide evidence that there is never recombination). We carried out analysis of a full-sib family, segregating for pollen PrpS₁ and PrpS₃ and pistil PrsS₁ and PrsS₃ alleles (25 plants, 50 alleles) and for the S₁ and S₈ loci, we analysed 45 full-sib plants (90 alleles) to show segregation of pollen PrpS₁ and PrpS₈ and pistil PrsS₁ and PrsS₈. Thus, we examined segregation of a total of 140 PrpS/PrsS pairs of alleles. Genomic DNA from leaf tissue was extracted (Extract-N-Amp™ Plant PCR kit, Sigma-Aldrich) and gene specific primers used to specifically amplify PrsS₁, PrsS₃, PrsS₈, and PrpS₁, PrpS₃ and PrpS₈ sequences. See SI Table 3 for primer details. No recombination was detected (RF <0.021). Thus, at the 95% rejection level, we can be confident that there is no recombination.

RT-PCR to show tissue and developmental specificity

Standard RT-PCR techniques were used for expression analysis. Total RNA was extracted from anthers from plants with the S₁ haplotype at different stages of development and from different tissues (RNAeasy plant mini kit, QIAGEN) and cDNA synthesised (Omniscript RT kit, QIAGEN). Gene-specific primers (see SI Table 3) were used to amplify PrpS₁ transcripts; primers for the P. rhoeas glyceraldehyde-3-phosphate dehydrogenase (GAPD) gene acted as controls.

Production of antisera

The predicted 60 amino acid C-terminus of PrpS₁ (designated PrpS1-60C) was expressed as a HIS-tagged recombinant protein using pET21b (Novagen). Recombinant protein was isolated from E. coli BL21 (DE3) using Ni-NTA resin following the manufacturer’s (QIAGEN) protocol. Antisera (PrpS1-60C) was raised in rats (ISL Immune Systems, Paignton, UK).

Protein extraction for SDS-PAGE and Western blotting

Extracts enriched for membrane proteins were made in 100 mM Tris-HCl pH 8, 200 mM NaCl, 2 mM EDTA, 1 M sucrose, 0.5% Triton X-100, Protease Inhibitor cocktail (Roche). Protein concentrations were determined³⁵ and proteins separated using SDS-PAGE and electroblotted (400 mA, 3 h) onto Hybond C membranes (GE Healthcare). These were incubated with the PrpS1-60C antibody (1:2000) for 2 h, followed by alkaline phosphatase-conjugated anti-rat secondary antibody (Sigma); detection used BCIP (5-bromo-4-chloro-3′-indolyphosphate p-toluidine salt) and NBT (Nitroblue tetrazolium chloride).

Immunolocalization

Papaver rhoeas pollen from plants with haplotypes S₁S₃ was grown in germination medium (GM)³⁶ for 1 h at 25°C and prepared according to³⁷, followed by incubation with the PrpS1-60C antibody (1:500 in TBS+ 1% BSA; 4°C overnight), then FITC-conjugated goat anti-rat antibody (1:50, 1.5 h). Cells were mounted on slides and examined by confocal microscopy (Bio-Rad Radiance 2000 MP) using single scans (100x plan-Apo 1.4 NA oil objective, Nikon). When pre-immune antiserum was used, no signal was obtained using identical additions and settings.

The in vitro bioassay for Papaver SI: use of this as an assay for function

We have used in vitro bioassays for demonstration of PrpS function instead of the alternative strategy of stable transformation with a PrpS allele because the latter is not possible in Papaver. These bioassays have been routinely used to demonstrate S-specific function. Because it has not been possible to generate plants that are homozygous for S haplotypes in Papaver, we use full-sib families that are segregating for plants that are heterozygous for S haplotypes. This makes the interpretation of the data slightly more complicated, as we always have a mixed population of pollen grains in our samples.

The Papaver SI in vitro bioassay was initially used for demonstrating that stigmatic extracts had S-specific biological activity; we showed the distribution of individual pollen tube lengths for control, fully compatible, incompatible, and half-compatible interactions, with bimodal distribution of inhibition in a half-compatible SI response, as expected³⁸. This SI bioassay was used to provide evidence for the pistil S gene (now named PrsS) being the S determinant³⁹; we demonstrated S-allele-specific inhibition of pollen by recombinant PrsS₁ protein. This half-compatible interaction gave 40-44% mean inhibition (compared to the theoretical maximum of 50%) with pollen from plants with haplotypes S₁S₃ or S₁S₆, but no inhibition with pollen from plants with haplotypes S₃S₆ or S₂S₄. As we now have several cloned pistil PrsS alleles, for any in vitro SI bioassay, we routinely add two recombinant PrsS proteins to obtain a full SI response where all pollen is inhibited (see e.g.40-42).

For the SI in vitro bioassays carried out here, we used two recombinant PrsS proteins (PrsS₁ and PrsS₃ to pollen from plants with haplotypes S₁S₃, and PrsS₃ and PrsS₈ proteins to pollen from plants with haplotypes S₃S₈) to achieve a full SI response (all pollen inhibited). With the peptide bioassay (see below), we added the PrpS₁ peptide to the SI bioassay, so the expectation was that a maximum of 50% of pollen would be rescued if we obtained S haplotype-specific alleviation of SI. For the antisense oligonucleotide experiments we used pollen from plants with S₁S₃ and S₃S₈ haplotypes in combination with antisense-PrpS₁ and/or antisense-PrpS₈. The expectation was that S-haplotype-specific alleviation of SI would be obtained using antisense-PrpS₁ with pollen from plants with S₁S₃ haplotypes, but this would only be 50% rescue (pollen carrying PrpS₁, but not pollen carrying PrpS₃); we would also expect no alleviation of SI with antisense-PrpS₁ with the pollen from S₃S₈ plants. We also carried out experiments with antisense-PrpS₈ in these combinations, with the prediction that antisense-PrpS₈ will alleviate the SI response by a maximum of 50% with pollen from plants with S₃S₈ haplotypes (rescue of pollen carrying PrpS₈, but not PrpS₃). SI Fig 3 shows data for populations of individual pollen tubes for an experiment using a PrpS₁ antisense oligonucleotide added to an SI assay using pollen from plants with S₁S₃ or S₃S₈ haplotypes. The expectation is that PrpS₁ antisense oligonucleotide should rescue pollen carrying the PrpS₁ allele and not the PrpS₃ or PrpS₈ alleles. The plot shows that the rescue is clearly bimodal, with some pollen tubes still strongly inhibited, whilst others have alleviated inhibition, which gives confidence to the mean data shown in Fig 3.

We designed these experiments to be reciprocal so that we could demonstrate allelic specificity of rescue and to rule out some non-specific effects, as if the antisense-PrpS₁ caused pollen tubes to grow longer for some other reason, we should see this effect with the pollen from plants with S₃S₈ haplotypes. Sense oligonucleotides were used as additional controls, in order to demonstrate that the antisense oligonucleotides specifically had this effect on pollen tube growth. These assays provide a robust test of whether PrpS₁ and PrpS₈ are allelic, as we show that they have the same biological function and they exhibit allelic specificity. If PrpS₈ was not allelic to PrpS₁, then it would not affect pollen tube growth as predicted. Statistical tests were carried out using MINITAB. Tests comprised two-way comparisons between pairs of data using a student’s t-test.

Peptide bioassay

A 15 amino acid peptide corresponding to part of the predicted 35 amino acid PrpS₁ external loop region was designed and two randomized versions of this peptide were synthesized (see Methods Summary-peptide binding assay for details). P. rhoeas pollen was grown in vitro and SI induced using recombinant PrsS₁, PrsS₃ and PrsS₈¹². SI-induced pollen inhibition was compared with SI in the presence of the PrpS₁ peptide or a randomized peptide at 200 μg ml^-1. Pollen grains and tubes were scored after 1h, using two categories: “inhibition” or “growth”; a minimum of 100 pollen grains/tubes was scored for each sample. Data were analysed using Fisher’s Exact Test for 2×2 contingency tables⁴³.

Primer details

Primers used for the isolation of PrpS alleles

Gene specific primers used to amplify full length PrpS₁

• PRPS1-5′-UTR1 GTAGCATTTACAATCTTCTTAGAAATGC

• PRPS1-3′-UTR1 GAGAACACGTCATTGGAATTATTGAG

5′ RACE primer to obtain another S allele (resulting in isolation of PrpS₈)

• NH3′-3 GCGACCGAAGTGGCATG

Gene specific primers used to amplify PrpS₈

• PRPS8 5′-1 GGCAGTTATGCCTCGACATGCAATTG

• PRPS8 3′-1 TTAAACCTCAACACTACGGTGG

5′ RACE primer used to obtain full length PrpS₈

• PRPS8 5′RACE-1 GCTGTGCAATCCTCTCTGATCAAG

Degenerate primers used to obtain PrpS₃

• PRPS 5′-1 ATGCCACGAMRTGSAAKTGTTG

• PRPS 5′-2 CCTATTKGGAKYCKCASTTGCC

• PRPS 5′-3 GTAGTMGCATTTGGGACYRCTGC

• PRPS 3′-1 GTGAACTTAGCAACAAYWGCRAGG

• PRPS 3′-2 TCAAGTWKACTAGTARRAGCTTGCC

• PRPS 3′-3 CCAAYYAAAAATCCYTCRGTCATGCC

3′ and 5′ RACE primers used to obtain full length PrpS₃

• BGPRPS3-3′R1 GCTTCTACTGATTAACTTGTTCTCCGG

• BGPRPS3-5′R1 CTGCAGTTGCATGCATATTGTGTGTCG

Gene-specific primers used for S-locus linkage analysis

Primers for pistil PrsS₁, PrsS₃ and PrsS₈

• SS1-5′ GCTATCGTTCTTCTTGTCCAAGTCAAGCGG

• SS1-3′ CATCCCTCTTTGCCTGATAGGAATAAAACCCG

• SS3-5′ GACTTTGGTTAGCATGTCCAATTCCATCGGC

• SS3-3′ GTCCCTCTTGCCCGAGTAAGCATCG

• SS8-5′ GTCCTTCTTGACCTTGGCCTCATCTCG

• SS8-3′ CCGTGATCATCTCGTTGTGCTCGATAGG

Primers for PrpS₁, PrpS₃ and PrpS₈

• PRPS1-5′ CAGTTTGTTGGAGGATTATGTACCCCGTTGG

• PRPS1-3′ GCGACCACACAGATCATTATGGAAGATAAGAAGG

• PRPS3-5′ GAGTAGCATTTCTCGTGAGAATTAAATCTCACCATGC

• PRPS3-3′ GGTCACGACCCCAACCAATTGCAACG

• PRPS8-5′ CGCACTTGCCATAAGAACTGTCATTTCTCACC

• PRPS8-3′ CACTACGATCACGGTCCCAACCAGC