Abstract
AIM: To determine whether midkine (MK) and its truncated form (tMK) contribute to gastric tumorigenesis using in vitro and in vivo models.
METHODS: Human MK and tMK plasmids were constructed and expressed in BGC823 (a gastric adenocarcinoma cell line) to investigate the effect of over-expressed MK or tMK on cell growth and turmorigenesis in nude mice.
RESULTS: The growth of MK-transfected or tMK-transfected cells was significantly increased compared with that of the control cells, and tMK-transfected cells grew more rapidly than MK-transfected cells. The number of colony formation of the cells transfected with MK or tMK gene was larger than the control cells. In nude mice injected with MK-transfected or tMK-transfected cells, visible tumor was observed earlier and the tumor tissues were larger in size and weight than in control animals that were injected with cells without the transfection of either genes.
CONCLUSION: Over-expressed MK or tMK can promote human gastric cancer cell growth in vitro and in vivo, and tMK has greater effect than MK. tMK may be a more promising gene therapeutic target compared with MK for treatment of malignant tumors.
Keywords: Midkine, Truncated midkine, Gastric cancer, BGC823, Tumorigenisis
INTRODUCTION
Midkine (MK), a heparin-binding growth factor, was discovered through screening for factors that mediate retinoic acid-induced cell differentiation by Kadomatsu in 1988[1]. MK is a cysteine- and basic amino acid-rich protein, which is composed of two domains, i.e., N- and C-terminal half domains. The two domains are linked by a flexible linker region. Although the precise relationship between structural features and biological activities remains to be elucidated, it is interesting that only the C-terminal half domain of MK retains biological activities[2,3]. MK gene maps to band 11p11.2[4] and consists of five exons. Exon 1 does not encode amino acid sequence. Exon 2 encodes the hydrophobic leader sequence, which constitutes the beginning of gene translation. The signal peptide cleavage site lies toward the 3’ end of exon 2[2]. A truncated form of MK (tMK), which lacks exon 3 encoding the N-terminal half, was found in pancreatic carcinoma cell lines by Kaname in 1996[5]. Recently two novel truncations of the MK, tMKB and tMKC, were found in a number of tumor cell lines, including A549 cells (lung adenocarcinoma), SGC-7901 cells (gastric cancer), 8910 cells (ovarian tumor) and MG-63 cells (osteosarcoma)[6].
Many evidences showed that MK is expressed at higher levels in various tumors, such as digestive, lung, liver and breast cancers, neuroblastoma and Wilms’ tumor[7–10]. tMK was found in pancreatic, gastric, Wilms’, colorectal, bile duct and breast tumors, but not in non-cancerous and normal tissues[5,11–14]. MK can promote Wilms’ tumor cell proliferation and tumor angiogenesis[7,10,15], inhibit tumor cell apoptosis, induce transformation of NIH3T3 cells, and protect patocellular carcinoma (HCC) cells against TRAIL-mediated apoptosis[16–19]. MK and tMK are correlated positively with metastasis of HCC, prostate carcinomas, Lewis lung carcinoma, gastric cancer[20–23] and gastrointestinal carcinomas[24]. They can induce the transformation of SW-13 cells and shorten the latency of tumor formation in nude mice[25].
Our previous study also showed that MK highly expressed in gastric cancer tissues of Chinese patients, and the expressions of MK mRNA and protein were both associated with the clinical stage and distant metastasis of gastric cancer[26]. Therefore, it is necessary to determine the roles of MK and tMK in both tumorigenesis and tumor development in gastric cancer. BGC823 cell is a poorly differentiated gastric adenocarcinoma cell line and is an idea in vitro model for studying the tumorigenic activity. In the present study, we obtained human MK and tMK cDNA from gastric carcinoma tissues, constructed MK or tMK over expression plasmids (Figure 1), and then transfected the plasmids into BGC823 cell to study the effect of MK and tMK on tumorous characteristics in vitro and in vivo.
MATERIALS AND METHODS
Plasmids construction
Plasmids with MK and tMK eukaryotic expression were constructed[2,5,13] (Figure 1). In our previous work, we designed pMD18-T-MK and pMD18-T-tMK vector[27,28], and prepared the human MK and tMK DNA fragments by PCR using MK-1 and tMK primers, (Table 1). The products of PCR digested with HindIII and EcoRI were inserted into the eukaryotic expression plasmid vector pcDNA3.1 (+) (Invitrogen, Carlsbad, CA, USA), which resulted in the formation of pcDNA3.1/MK and pcDNA3.1/tMK. The resultant recombinant plasmids were characterized by detailed restriction digestion (Figure 2).
Table 1.
Primers | Sequence 5’-3’ | Reference | Excepted size (bp) | Cycles of PCR |
MK-1 sense | AAAAAAGCTTATGAAAAAGAAAGATAAGGTGAAGAAG | 389 | 28 | |
MK-1 antisense | AAAAGAATTCCTAGTCCTTTCCCTTCCCT | 389 | 28 | |
tMK sense | AAAAAAGCTTATGAAAAAGAAAGCCGACTG | Paul et al, 2001[13] | 221 | 28 |
tMK antisense | AAAAGAATTCCTAGTCCTTTCCCTTCCCT | 221 | 28 | |
MK-2 sense | ATGCAGCACCGAGGCTTCCT | Kaname et al, 1996[5] | 447 | 30 |
MK-2 antisense | ATCCAGGCTTGGCGTCTAGT | 279 | 30 | |
β-actin sense | CCACGAAACTACCTTCAACTC | 270 | 28 | |
β-actin antisense | TCATACTCCTGCTGCTTGCTGATCC | 270 | 28 |
Cell culture and transfection
BGC823, a poorly differentiated gastric adenocarcinoma cell line, was cultured in RPMI medium 1640 (Gibco/BRL) supplemented with 10% fetal calf serum (Si Ji Qing, China) at 37°C under 5% humidified CO2 and 100 μg/mL each of streptomycin and penicillin G (Amresco, USA). The plasmid was transfected using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Briefly, approximately 0.8 × 105 cells/well were grown overnight in 24-well plates. When the cells reached 90%-95% confluence, they were transfected with 0.8 μg of pcDNA3.1/MK or pcDNA3.1/tMK or pcDNA3.1 in serum-free medium using Lipofectamine 2000. After 4 h incubation at 37°C, 400 μL RPMI 1640 with 10% FBS was added. Stable transfectants were selected in the presence of 400 mg/L G418 (Amersco) during 2 wk of culture.
RNA extraction and RT-PCR
Total RNA was extracted using the TaKaRa RNAiso Reagent (TaKaRa, Japan) according to the manufacturer’s instructions. RNA concentrations were quantified by spectrophotometer at 260 nm. One μg total RNA was reverse-transcribed using Revert AidTM First Strand cDNA Synthesis Kit (Fermentas, USA). Subsequently, 2 μL of the incubation mixture was used as the template for the following PCR using 2 × Taq enzyme mix kit (Tian Gen, China). Primers were synthesized by Bioasia (Shanghai, China) and are listed in Table 1. PCR was carried out for 28 or 30 cycles of denaturation (30 s at 94°C), annealing (40 s at 55°C), and extension (30 s at 72°C). The PCR products were then detected on 1% agarose gel containing 0.5 mg/L ethidium bromide. The gel was put on an UV-transilluminator and photographed. The MK signal was measured by a densitometer and standardized against the β-actin signal using a digital imaging and analysis system (SmartSpecTM Plus, BIO-RAD, USA).
Western blot analysis
Cells (1 × 107) were lysed in a buffer containing 50 mmol/L Tris-Cl, pH8.0, 150 mmol/L NaCl, 0.02% NaN3, 0.1% SDS, 100 mg/L phenylmethylsulfonyl fluoride (PMSF) and 1 mg/L Aprotinin, 1% Triton. After centrifugation, cell lysates (75 μg/lane) were subjected to 15% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, USA). The membranes were blocked for 1 h in PBST (10 mmol/L Tris-HCl, pH 7.4, 150 mmol/L NaCl, 0.05% Tween-20) containing 2% nonfat dried milk. Antibodies specific for MK (1:400, BA1263, Boster, China), β-actin (1:400, BA0410, Boster) and HRP-conjugated goat anti-rabbit secondary antibody (1:2000, BA1054, Boster) were used. Protein bands were detected by the enhanced chemiluminescence (ECL) reaction (Kibbutz Beit Haemek, Israel).
Proliferation analysis
Cell viability was assessed with a Cell Counting Kit (Dojin Laboratories, Kumamoto, Japan). Briefly, BGC823 cells transfected with pcDNA3.1/MK, pcDNA3.1/tMK, or pcDNA3.1 and parental BGC823 cells were plated onto 96-well plates in RPMI 1640 supplemented with 10% FBS at a density of 3 × 103 cells/well. After 4 h, the medium was changed to serum-free medium, and the cells were cultured ≤ 2 d. Ten microliter of a solution containing 4-[3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl) - 2H-5-tetrazolio]-1, 3-benzene disulfonate sodium salt (WST-8) was added to each well. Following incubation of an additional 4 h, the absorbance was measured at 450 nm with a multi-detection microplate reader (HynergyTM HT, BIO-TEK, USA).
Colony formation in soft agar
To perform the soft agar assay, a base layer of 0.5% (w/v) agar was prepared by adding autoclaved 1% (w/v) agar solution to 2x RPMI-1640 supplemented with 20% fetal calf serum at a 1:1 ratio. Stable transfectants or parental cell suspension containing 2 × 103 cells were prepared in a 1:1 mixture of 0.7% (w/v) agar solution and 2x RPMI -1640 supplemented with 20% FCS. Cell suspension was added to the top of the base layer, allowed to solidify, and the plate was incubated at 37°C in a humidified 5% CO2. The plates were incubated for 10-15 d. The number of colonies was determined by direct counting under microscopy. Counts were expressed as number of colonies per plate on average from three independent experiments.
Wound healing assay
The transfected BGC823 cells with pcDNA3.1/MK, pcDNA3.1/MK or pcDNA3.1 and parental cells were plated onto 6-well plates in RPMI 1640 supplemented with 10% FBS at a density of 2 × 105 cells/well. After 4 h, the medium was changed to serum-free medium. After 24 h, a plastic cell scraper was used to make an approximate 0.6 mm gap on the cell monolayer. Migration was quantitated by determining the distance between the cell edges at 0, 24 h and 48 h at the four marked locations on each well, using an inverted microscope with a scale in the eyepiece[29]. The results of the four readings from each well were averaged. Experiments were repeated three times.
Tumorigenicity study in vivo
Female BALB/c nude mice (5-6 wk old) were obtained from Vital River Lab Animal Co, Ltd, Beijing Laboratory Animal Research Center (Beijing, China). Cultured cells were harvested by trypsinization, washed and suspended in PBS at 107 cells/mL. One hundred μL cell suspensions were injected subcutaneously into the flank of female nude mice (seven mice per cell line). Tumor diameters were measured on d 14, 21 and 28, and tumor volume in mm3 was calculated by the formula: Volume = (width)2 × length/2. Tumor growth rates were calculated by the formula: TGR = (V28th-V21th)/7 d. Data were presented as mean ± SE. Twenty-eight days after injection, nude mice were sacrificed, and the tumors were removed, photographed and weighed.
Immunohistochemistry
Immunostaining was performed on 6-μm tissue sections using strept-avidin-biotin staining kit (Boster). For antigen retrieval, slides were heated by microwave in 0.01 mol/L Tri-sodium citrate buffer. Nonspecific binding sites were blocked with 5% BSA for 30 min and endogenous peroxidase activity was suppressed by treatment with 3% H2O2 in methanol for 30 min. Sections were exposed to rabbit polyclonal anti-MK antibody (1:250, Boster) overnight at 4°C. 3,3-diamino-enzidine was used as chromogen (Boster). Counterstaining was done with hematoxylin. Negative control sections were incubated with PBS instead of anti-MK antibodies. In each step, samples were washed with PBS.
Statistical analysis
Results were presented as mean ± SE. Statistical significance between groups was analyzed by one-way ANOVA followed with the Student-Newman-Keuls multiple comparison tests. A P value of < 0.05 was considered significant. Frequency of tumorigenesis in nude mice was calculated by Fisher’s exact test.
RESULTS
Expression of MK and tMK
To evaluate the roles of MK and tMK in gastric tumorigenesis, we used transfection assay to obtain a MK or tMK over-expressed gastric cell line. RT-PCR and Western blotting were performed to determine MK or tMK expression level in the transfected gastric carcinoma cells. Compared with the parental cells and pcDNA3.1 transfected cells, transfection of BGC823 cells with pcDNA3.1/MK or pcDNA3.1/tMK resulted in significant enhancement of MK or tMK expression in BGC823 cells. These results indicated that transfection of pcDNA3.1/MK and pcDNA3.1/tMK was successful (Figure 3B and C).
Effect of over-expression of MK or tMK on BGC823 cells
To determine whether over-expression of MK and tMK could affect the BGC823 cell growth, cell proliferation activity was detected using Cell Counting Kit. The transfection of pcDNA3.1/MK or pcDNA3.1/tMK to BGC823 significantly increased the proliferation of BGC823 cells compared with the control. This showed that over-expressed MK or tMK could accelerate the cellular proliferation at 12 h, 24 h, 36 h and 48 h. Moreover, tMK exhibited stronger stimulatory effect than MK (Figure 4A). No difference between BGC823/vector and BGC823 was detected (Figure 4A). Furthermore, colony-forming assay was conducted in BGC823, BGC823/vector, BGC823/MK and BGC823/tMK (Figure 4B and C). The results showed that the colony number of BGC823/MK and BGC823/tMK cells was increased by 2- to 3-fold compared with BGC823 and BGC823/vector (Figure 4C). In addition, the wound healing assay also showed that over-expressed MK or tMK could induce significant migration of the cell at 24 h and 48 h, about 1.5-fold over BGC823 and BGC823/vector cells, and tMK showed stronger effect than MK (Figure 4D). These results demonstrated that over-expression of MK and tMK significantly enhanced the malignant state and invasive ability of BGC823 cells.
Tumor growth promoted by MK or tMK in vivo
As the over-expression of MK or tMK significantly changed the behavior of BGC823 cells in vitro, it is necessary to analyze the tumorigenicity of the stable transfectant in vivo. The time and frequency of visible tumor in nude mice treated with BGC823, BGC823/vector, BGC823/MK and BGC823/tMK, respectively, are presented in Table 2. Tumor was clearly observed in most BGC823/MK- and all BGC823/tMK-injected mice at d 7, whereas visible tumor formed in about half of BGC823/vector and BGC823 injected mice until d 14. Furthermore, tumor diameters and volume were subsequently measured at d 14, 21 and 28. The results showed that tumor volumes of mice injected with BGC823/MK or BGC823/tMK cells were significantly larger than the control at d 21 and 28 (Figure 5C). Tumor growth rate (TGR) from d 21 to 28 showed that the TGR of nude mice injected with BGC823/MK or BGC823/tMK was significantly higher than the control mice (Figure 5D). At d 28 after inoculation, the tumors were removed, photographed and weighed. The tumor in mice injected with BGC823/MK and BGC823/tMK cells was 2-fold of that of the control (Figure 5B), and tumors in two mice injected with BGC823/tMK cells had erosive appearance (Figure 5A). Apparently, BGC823/MK or BGC823/tMK transfected cells could multiply and grow earlier and more rapidly than the BGC823 and BGC823/vector control cells in nude mice.
Table 2.
Injected cells | No. of mice |
No. of days to tumor detection (percent of tumorigenesis) |
|||
7 | 14 | 21 | 28 | ||
BGC823 | 7 | 0 (0.00) | 3 (42.86) | 6 (85.71) | 7 (100) |
BGC823/vector | 7 | 0 (0.00) | 4 (57.14) | 7 (100) | |
BGC823/MK | 7 | 5 (71.43)a | 6 (85.71)a | 7 (100) | |
BGC823/tMK | 7 | 7 (100)b |
P value was calculated by Fisher’s exact test. 7 d: BGC823/MK vs BGC823 or BGC823/vector, P = 0.0105; BGC823/tMK vs BGC823 or BGC823/vector, P = 0.0003. 14 d: BGC823/MK vs BGC823, P = 0.0174; BGC823/MK vs BGC823/vector, P = 0.0489.
P < 0.05;
P < 0.01.
Immunohistochemical analysis
To detect whether BGC823/MK- or BGC823/tMK- transfected cells can stably express MK or tMK in nude mice for an extended period and the association between tumor growth and MK or tMK protein levels, immunohistochemical staining was conducted. MK was detected in cytoplasm and nucleus of tumor cells from different treatment groups of mice. The number and density of the positive points in tumor tissues induced with BGC823/MK and BGC823/tMK cells were evidently higher than the cells treated with BGC823 and BGC823/vector (Figure 6).
DISCUSSION
To determine whether MK and tMK contribute to gastric tumorigenesis and tumor development, BGC823 cells that over-expressed MK and tMK genes, and nude mice inoculated with the BGC823 cells over-expressing either MK or tMK were used as model systems in vitro and in vivio, respectively. To show that the upregulated MK and tMK were exogenous in the transfected cells, we designed another pair of primers for MK-2 sequence (Table 1)[5]. The forward primer of MK-2 was complemented with the start section of exon 2, and the reverse primer was complemented with exon 5 and several base pairs of 3’- untranslated regions. tMK lacks exon 3, so MK (448 bp) and tMK (296 bp) DNA were obtained at the same time by RT-PCR using primers for MK-2. There was no significant difference in the expression of MK and tMK between transfected cells and parental cells. The state in those cells transfected with or without MK and tMK genes can imitate MK and tMK expression from initial to metastatic stages of tumor formation.
Previous studies showed that the over-expression of MK in S462 cell (malignant peripheral nerve sheath tumor cell line) could increase the cell viability and protect the cells from apoptosis under serum deprivation, but did not induce the proliferation of S462 cells to promote xenograft tumor growth in nude mice[16]. MK and tMK can induce the transformation of SW-13 cells (adrenal carcinoma cell line) and shorten the latency of tumor formation in nude mice, but SW-13/MK and SW-13/tMK showed no difference in tumor growth rate from the control[25]. However in our study, the growth of BGC823 cells which over-expressed MK and tMK, was increased significantly compared with the control cells. The tumor formation time was shortened in nude mice injected with BGC823/tMK or BGC823/MK cells. Tumor growth rate of was significantly higher than the control, and tumor volume and weight were higher than the control, indicating that the idiographic effect of MK and tMK on tumorigenesis and tumor development may be related to types of tumors.
MK and tMK are heparin-binding growth factors. They play fundamental roles in the regulation of cell differentiation and development. Their aberrant expressions are usually associated with tumorigenesis[30–33]. In our study, tMK, which was only found in cancer tissues, had stronger effects than MK on tumor cell proliferation, and tumors from two mice injected with BGC823/tMK cells had erosive appearance. This result was in agreement with the previous studies. The differential activities of MK and tMK in promoting tumor proliferation may be attributed to the difference of the tertiary structure between these two proteins[34].
In conclusion, over-expressed MK or tMK could promote tumor development of human gastric cancer and tumorigenesis in vitro and in vivo. tMK had greater effect than MK in promoting the tumor formation. tMK might become a more promising gene therapeutic target compared with MK for treatment of tumors.
COMMENTS
Background
Midkine (MK), a heparin-binding growth factor, and its truncated form (tMK), were found expressing at higher levels in various tumors, and involve the growth and metastasis of some carcinomas. The expressions of MK mRNA and the protein are both associated with the clinical stage and distant metastasis of gastric cancer in the Chinese patients. But few studies were conducted on the roles of MK and tMK in both tumorigenesis and tumor development in gastric cancer. In this article, the effect of MK and tMK on the growth and metastasis of BGC823 (a poorly differentiated gastric adenocarcinoma cell line), and tumorigenesis in nude mice was investigated.
Research frontiers
Many studies of MK and tMK expression in various tumors including gastric cancer, have been reported. It has been found that MK can promote Wilms’ tumor cell proliferation and tumor angiogenesis, inhibit tumor cell apoptosis, induce transformation of NIH3T3 cells, and protect hepatocellular carcinoma cells against TRAIL-mediated apoptosis. However, there has been no investigation about the effect of MK and tMK on the characteristics of gastric carcinoma.
Innovations and breakthroughs
This article suggests that over-expressed MK and tMK can promote BGC823 cell growth, colony formation, wound healing and tumorigenesis in nude mice. tMK had greater effect than MK, and it might become a promising gene therapeutic target for treatment of malignant tumors.
Applications
This observation might be of potential value in gene therapy for gastric cancer.
Peer review
The manuscript describes that over-expressed MK and tMK can promote BGC823 cell growth, colony formation, wound healing and tumorigenesis in nude mice. The results were found important for MK and tMK as gene therapeutic target in gastric cancer.
Supported by The Scientific Research Fund of Graduate School of Nanjing University, the Fund for Key Program of Ministry of Education, No. 02111 and the 985-II Program of Nanjing University
Peer reviewers: Dusan M Jovanovic, Professor, Institute of Oncology, Institutski Put 4, Sremska Kamenica 21204, Serbia; Da-Jun Deng, Professor, Department of Cancer Etiology, Peking University School of Oncology, 1 Da-Hong-Luo-Chang Street, Western District, Beijing 100034, China
S- Editor Zhong XY L- Editor Ma JY E- Editor Lu W
References
- 1.Kadomatsu K, Tomomura M, Muramatsu T. cDNA cloning and sequencing of a new gene intensely expressed in early differentiation stages of embryonal carcinoma cells and in mid-gestation period of mouse embryogenesis. Biochem Biophys Res Commun. 1988;151:1312–1318. doi: 10.1016/s0006-291x(88)80505-9. [DOI] [PubMed] [Google Scholar]
- 2.Milner PG, Shah D, Veile R, Donis-Keller H, Kumar BV. Cloning, nucleotide sequence, and chromosome localization of the human pleiotrophin gene. Biochemistry. 1992;31:12023–12028. doi: 10.1021/bi00163a009. [DOI] [PubMed] [Google Scholar]
- 3.Muramatsu H, Inui T, Kimura T, Sakakibara S, Song XJ, Maruta H, Muramatsu T. Localization of heparin-binding, neurite outgrowth and antigenic regions in midkine molecule. Biochem Biophys Res Commun. 1994;203:1131–1139. doi: 10.1006/bbrc.1994.2300. [DOI] [PubMed] [Google Scholar]
- 4.Kaname T, Kuwano A, Murano I, Uehara K, Muramatsu T, Kajii T. Midkine gene (MDK), a gene for prenatal differentiation and neuroregulation, maps to band 11p11.2 by fluorescence in situ hybridization. Genomics. 1993;17:514–515. doi: 10.1006/geno.1993.1359. [DOI] [PubMed] [Google Scholar]
- 5.Kaname T, Kadomatsu K, Aridome K, Yamashita S, Sakamoto K, Ogawa M, Muramatsu T, Yamamura K. The expression of truncated MK in human tumors. Biochem Biophys Res Commun. 1996;219:256–260. doi: 10.1006/bbrc.1996.0214. [DOI] [PubMed] [Google Scholar]
- 6.Tao P, Xu D, Lin S, Ouyang GL, Chang Y, Chen Q, Yuan Y, Zhuo X, Luo Q, Li J, et al. Abnormal expression, highly efficient detection and novel truncations of midkine in human tumors, cancers and cell lines. Cancer Lett. 2007;253:60–67. doi: 10.1016/j.canlet.2007.01.019. [DOI] [PubMed] [Google Scholar]
- 7.Kadomatsu K, Muramatsu T. Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 2004;204:127–143. doi: 10.1016/S0304-3835(03)00450-6. [DOI] [PubMed] [Google Scholar]
- 8.Kaifi JT, Fiegel HC, Rafnsdottir SL, Aridome K, Schurr PG, Reichelt U, Wachowiak R, Kleinhans H, Yekebas EF, Mann O, et al. Midkine as a prognostic marker for gastrointestinal stromal tumors. J Cancer Res Clin Oncol. 2007;133:431–435. doi: 10.1007/s00432-006-0180-y. [DOI] [PubMed] [Google Scholar]
- 9.Obata Y, Kikuchi S, Lin Y, Yagyu K, Muramatsu T, Kumai H. Serum midkine concentrations and gastric cancer. Cancer Sci. 2005;96:54–56. doi: 10.1111/j.1349-7006.2005.00001.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ruan M, Ji T, Wu Z, Zhou J, Zhang C. Evaluation of expression of midkine in oral squamous cell carcinoma and its correlation with tumour angiogenesis. Int J Oral Maxillofac Surg. 2007;36:159–164. doi: 10.1016/j.ijom.2006.09.004. [DOI] [PubMed] [Google Scholar]
- 11.Miyashiro I, Kaname T, Nakayama T, Nakamori S, Yagyu T, Monden T, Kikkawa N, Nishisho I, Muramatsu T, Monden M, et al. Expression of truncated midkine in human colorectal cancers. Cancer Lett. 1996;106:287–291. doi: 10.1016/0304-3835(96)04333-9. [DOI] [PubMed] [Google Scholar]
- 12.Miyashiro I, Kaname T, Shin E, Wakasugi E, Monden T, Takatsuka Y, Kikkawa N, Muramatsu T, Monden M, Akiyama T. Midkine expression in human breast cancers: expression of truncated form. Breast Cancer Res Treat. 1997;43:1–6. doi: 10.1023/a:1005748728351. [DOI] [PubMed] [Google Scholar]
- 13.Paul S, Mitsumoto T, Asano Y, Kato S, Kato M, Shinozawa T. Detection of truncated midkine in Wilms' tumor by a monoclonal antibody against human recombinant truncated midkine. Cancer Lett. 2001;163:245–251. doi: 10.1016/s0304-3835(00)00696-0. [DOI] [PubMed] [Google Scholar]
- 14.Kato M, Shinozawa T, Kato S, Terada T. Immunohistochemical localization of truncated midkine in developing human bile ducts. Histol Histopathol. 2003;18:129–134. doi: 10.14670/HH-18.129. [DOI] [PubMed] [Google Scholar]
- 15.Ratovitski EA, Burrow CR. Midkine stimulates Wilms' tumor cell proliferation via its signaling receptor. Cell Mol Biol (Noisy-le-grand) 1997;43:425–431. [PubMed] [Google Scholar]
- 16.Friedrich C, Holtkamp N, Cinatl J Jr, Sakuma S, Mautner VF, Wellman S, Michaelis M, Henze G, Kurtz A, Driever PH. Overexpression of Midkine in malignant peripheral nerve sheath tumor cells inhibits apoptosis and increases angiogenic potency. Int J Oncol. 2005;27:1433–1440. [PubMed] [Google Scholar]
- 17.Tong Y, Mentlein R, Buhl R, Hugo HH, Krause J, Mehdorn HM, Held-Feindt J. Overexpression of midkine contributes to anti-apoptotic effects in human meningiomas. J Neurochem. 2007;100:1097–1107. doi: 10.1111/j.1471-4159.2006.04276.x. [DOI] [PubMed] [Google Scholar]
- 18.Kadomatsu K, Hagihara M, Akhter S, Fan QW, Muramatsu H, Muramatsu T. Midkine induces the transformation of NIH3T3 cells. Br J Cancer. 1997;75:354–359. doi: 10.1038/bjc.1997.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ohuchida T, Okamoto K, Akahane K, Higure A, Todoroki H, Abe Y, Kikuchi M, Ikematsu S, Muramatsu T, Itoh H. Midkine protects hepatocellular carcinoma cells against TRAIL-mediated apoptosis through down-regulation of caspase-3 activity. Cancer. 2004;100:2430–2436. doi: 10.1002/cncr.20266. [DOI] [PubMed] [Google Scholar]
- 20.Rha SY, Noh SH, Kim TS, Yoo NC, Roh JK, Min JS, Kim BS. Modulation of biological phenotypes for tumor growth and metastasis by target-specific biological inhibitors in gastric cancer. Int J Mol Med. 1999;4:203–212. doi: 10.3892/ijmm.4.2.203. [DOI] [PubMed] [Google Scholar]
- 21.Yin Z, Luo X, Kang X, Wu Z, Qian H, Wu M. Correlation between midkine protein overexpression and intrahepatic metastasis in hepatocellular carcinoma. Zhonghua Zhongliu Zazhi. 2002;24:27–29. [PubMed] [Google Scholar]
- 22.Trojan L, Schaaf A, Steidler A, Haak M, Thalmann G, Knoll T, Gretz N, Alken P, Michel MS. Identification of metastasis-associated genes in prostate cancer by genetic profiling of human prostate cancer cell lines. Anticancer Res. 2005;25:183–191. [PubMed] [Google Scholar]
- 23.Salama RH, Muramatsu H, Zou P, Okayama M, Muramatsu T. Midkine, a heparin-binding growth factor, produced by the host enhances metastasis of Lewis lung carcinoma cells. Cancer Lett. 2006;233:16–20. doi: 10.1016/j.canlet.2005.02.047. [DOI] [PubMed] [Google Scholar]
- 24.Aridome K, Takao S, Kaname T, Kadomatsu K, Natsugoe S, Kijima F, Aikou T, Muramatsu T. Truncated midkine as a marker of diagnosis and detection of nodal metastases in gastrointestinal carcinomas. Br J Cancer. 1998;78:472–477. doi: 10.1038/bjc.1998.517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Nobata S, Shinozawa T, Sakanishi A. Truncated midkine induces transformation of cultured cells and short latency of tumorigenesis in nude mice. Cancer Lett. 2005;219:83–89. doi: 10.1016/j.canlet.2004.07.003. [DOI] [PubMed] [Google Scholar]
- 26.Huang Y, Cao G, Wang H, Wang Q, Hou Y. The expression and location of midkine in gastric carcinomas of Chinese patients. Cell Mol Immunol. 2007;4:135–140. [PubMed] [Google Scholar]
- 27.Huang YH, Wang QL, Wang H, Hou YY. Cloning and Expression of Midkine Cytokine from Carcinogenesis Tissue in E.coli. Xiandai Mianyixue. 2005;25:145–148. [PubMed] [Google Scholar]
- 28.Wang QL, Huang YH, Xie H, Wang H. Cloning and expression of truncated Midkine cytokine from gastric carcinogenesis tissue in E. coli. Weisheng Yanjiu. 2005;34:664–666. [PubMed] [Google Scholar]
- 29.Pukac L, Huangpu J, Karnovsky MJ. Platelet-derived growth factor-BB, insulin-like growth factor-I, and phorbol ester activate different signaling pathways for stimulation of vascular smooth muscle cell migration. Exp Cell Res. 1998;242:548–560. doi: 10.1006/excr.1998.4138. [DOI] [PubMed] [Google Scholar]
- 30.Westermark B, Heldin CH. Growth factors and their receptors. Curr Opin Cell Biol. 1989;1:279–285. doi: 10.1016/0955-0674(89)90101-4. [DOI] [PubMed] [Google Scholar]
- 31.Aaronson SA. Growth factors and cancer. Science. 1991;254:1146–1153. doi: 10.1126/science.1659742. [DOI] [PubMed] [Google Scholar]
- 32.Cross M, Dexter TM. Growth factors in development, transformation, and tumorigenesis. Cell. 1991;64:271–280. doi: 10.1016/0092-8674(91)90638-f. [DOI] [PubMed] [Google Scholar]
- 33.Chen Q, Yuan Y, Lin S, Chang Y, Zhuo X, Wei W, Tao P, Ruan L, Li Q, Li Z. Transiently truncated and differentially regulated expression of midkine during mouse embryogenesis. Biochem Biophys Res Commun. 2005;330(4):1230–1236. doi: 10.1016/j.bbrc.2005.02.190. [DOI] [PubMed] [Google Scholar]
- 34.Matsuda Y, Talukder AH, Ishihara M, Hara S, Yoshida K, Muramatsu T, Kaneda N. Limited proteolysis by chymotrypsin of midkine and inhibition by heparin binding. Biochem Biophys Res Commun. 1996;228:176–181. doi: 10.1006/bbrc.1996.1635. [DOI] [PubMed] [Google Scholar]