Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Feb 15.
Published in final edited form as: J Immunol. 2009 Feb 15;182(4):2185–2193. doi: 10.4049/jimmunol.0802700

Single Nucleotide Changes in the Human Iγ1 and Iγ4 Promoters Underlie Different Transcriptional Responses to CD40

Frank L Sinquett 1,#, Rebecca L Dryer 1,#, Valentina Marcelli 1, Ameesha Batheja 1, Lori R Covey 1,*
PMCID: PMC2701896  NIHMSID: NIHMS97821  PMID: 19201872

Abstract

Analysis of subclass-specific germline transcription (GLT) in activated peripheral B cells revealed a highly biased expression pattern of the four Iγ transcripts to signals through CD40 and IL-4. This difference was most pronounced when comparing the profile of Iγ1 and Iγ4 transcripts and not expected given the very high degree of sequence conservation between promoters. In this report, the influence of sequence differences on the regulation of the Iγ1 and Iγ4 promoters has been investigated given the highly muted transcriptional activity of the Iγ4 promoter. Two regions were analyzed where single nucleotide differences corresponded to major changes in transcriptional activity. These regions were the previously defined CD40RR containing three putative NF-κB binding sites and the downstream 36 bp region containing CREB/ATF and κB6 sites. Mutation of a single nucleotide at position 6 within the Iγ4 κB6 site increased promoter activity to approximately 50% the activity of the Iγ1 promoter. Furthermore, elevated promoter strength corresponded with increased binding of p50, p65, c-Rel, RelB and p300 proteins to a level comparable to that of Iγ1. Importantly, minor nucleotide changes to both the Iγ4 CD40RR and the 36 bp element resulted in a response undistinguishable from an Iγ1 response suggesting cooperation between the two regulatory regions for optimal transcriptional activity. Collectively, these mutational analyses suggest that minor sequence differences contribute to the composition and affinity of transcriptional protein complexes regulating subclass-specific GLT, which in part impacts the overall level of class switch recombination to targeted CH regions.

Keywords: CD40, B cells, NF-kappaB, CREB, class switch recombination

Introduction

A fundamental process of B cells is the expression of different classes of antibodies to neutralize specific pathogens. The most abundant isotype, IgG, is comprised of four distinct subclasses (IgG1-4), which provide comprehensive systemic immune protection by being equally present in both the blood and the extravascular fluids. Each IgG subclass is present in human serum at variable levels and displays a unique profile of effector activities that results in a distinct isotype/subclass profile to a given antigen within a defined local environment (1-5). Protein antigens characteristically invoke IgG1 and IgG3 responses whereas IgG2 often predominates in humoral responses to carbohydrate antigens (6-8). IgG4, the least abundant subclass at ∼3-6% total IgG, interacts poorly with both complement and Fc receptors and this lack of reactivity makes it a preferred choice for therapeutic applications where antibody is required for binding target without triggering effector activities (9-13).

Isotype diversification of the antibody response occurs in IgM+ B cells following BCR recognition of antigen. The mechanism underlying this process is an intramolecular recombination event, termed class switch recombination (CSR) that juxtaposes the V(D)J exon to a downstream constant region heavy chain (CH) gene segment to generate a heavy chain polypeptide that maintains antigen-specificity in the context of different effector functions (reviewed in (14)). CSR occurs in vivo by T-cell-dependent (TD) mechanisms that involve the interaction of CD40 on B cells with CD154 on T cells, in addition to non-T-cell dependent routes, which occur through the recognition of T-cell-independent (TI) antigens via toll-like receptors (TLRs) (15, 16). TD responses can be mimicked in vitro, by stimulating B cells through CD40 in the presence or absence of particular cytokines, and specific CSR events occur in response to in vitro exposure of B cells to particular combinations of activators and cytokines that transcriptionally activate the CH locus (15, 16). This type of germ-line transcription (GLT) is strongly associated with CSR where CH-specific intragenic transcripts initiate from TATA-less promoters located upstream of the individual CH elements (except Cδ) and are processed to include a small non-coding “I” exon spliced to the associated downstream CH exon (16, 17). Numerous gene disruption experiments have strongly supported an essential role for GLT in CSR by showing that the targeted loss of I region transcription abrogates CSR to the associated CH region (18-21).

I region promoters constitute the natural targets of signal transduction pathways that modulate the isotypic profile of an Ab response with cytokine-responsive transcriptional activators. Accordingly, they encode an evolutionarily conserved CD40 response region (CD40RR) containing three NF-κB binding sites (reviewed in (22)) and the CD40 signaling pathway can synergize with IL-4-mediated activation of I region promoters through interactions between NF-κB and STAT6 (23-27). However, more recent data using transgenes with mutations in the three CD40RR NF-κB binding sites demonstrated relatively wild type levels of GLT when activated with CD154 and IL-4 supporting the idea that sequence elements outside of the CD40RR can influence the GLT response (28). Further support for this comes from our own work on the human Iγ1 promoter where we identified a 36 bp region downstream of the Iγ1 start site that enhances GLT and contains binding motifs for CREB/ATF-1/ATF-2 and NF-κB. Sequence differences in the Iγ3 36 bp element accounted for weaker GLT upon CD154 activation in an in vitro system (29) and p300 activity associated with the 36 bp element was found to be required for optimal Iγ1 transcription (30). The entire proximal promoter region including the 36 bp element is highly conserved between the Iγ promoters, which is unexpected given the unique in vivo expression pattern in response to CD40 signals observed for the individual promoters (31-35). Specifically, Iγ4 expression, though inducible with IL-4 and CD154, has a much lower level of expression compared to other γ subclasses including γ2 which lies upstream in the same gene duplication unit (31, 34-36). This observation of high sequence conservation with distinct expression patterns suggested that either small changes in sequence and/or chromatin-linked modifications underlie differences in Iγ1 and Iγ4 promoter function. The focus of this study was to analyze single nucleotide variations in the 36 bp region and determine their effect on Iγ1 and Iγ4 GLT. Not only do these findings add insight to the regulation of the different Iγ subclasses, but they also have broader implications with respect to the control of NF-κB-mediated transcription in both immune and non-immune cells.

Materials and Methods

Cell Culture

Ramos 2G6.4CN3F10 (Ramos 2G6) cells (an IgM+, non-EBV transformed Burkitt's lymphoma line (37)) were maintained in RPMI 1640 media supplemented with 10% heat inactivated fetal bovine serum (FBS), 50U/mL penicillin, 50 mg/mL streptomycin and 1mM L-glutamine at 37°C and 5% CO2. The 293/CD154 line was constructed by stable transfection as previously described (38). 293 and 293/CD154 cells were cultured in DMEM/F12 50/50 media supplemented with 10% FBS, 50U/mL penicillin, 50 mg/mL streptomycin and 1mM L-glutamine at 37°C and 5% CO2.

Isolation of Primary B cells

Blood products were prepared by the NBAH Blood Center at Robert Wood Johnson University Medical Center (New Brunswick, NJ) or the New York Blood Center (Long Island City, NY) from peripheral blood samples from healthy donors. CD19+/IgG- B cells were isolated from total mononuclear cells (PBMCs) as previously described (30).

GLT Assays

Iγ transcripts were analyzed by RT-PCR and probed with subclass-specific hinge region probes as previously described (31, 33, 35).

Antibodies and Plasmids

Super-shifting antibodies against p50, p65, c-Rel, Rel-B, CREB, and p300 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), or provided as a generous gift from Dr. Nancy Rice (anti-p50). Super-shifting anti-p52 antibodies were purchased from Cell Signaling Technologies (Danvers, MA). Antibodies against p50, p65, c-Rel, CREB, acetylated H3 (acetyl. K9, 14), and acetylated H4 (acetyl. K5, 8, 12, 16) that were used in ChIP experiments were purchased from Millipore Corp. (Billerica, MA). Rabbit control antibodies used in both gel shift and ChIP experiments were obtained from either Santa Cruz Biotechnology, or Millipore Corp. The pRLSV40 and pGL2E vectors were purchased from Promega Corp (Madison, WI).

Generation of Wildtype and Mutant Promoter Constructs

The γ1-512 and γ4-500 constructs as well as the 1P1 and 4P1 constructs were cloned into the pGL2E vector from a partial genomic library from Ramos 2G6 cells as previously described (29). Site-specific Iγ mutations were made with the Quikchange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) using the γ1-512 and γ4-500 plasmids as templates. Primer sets used in generating site-specific mutant promoters are listed in Table 1 and PCR cycling parameters were 95°C 30s, 65°C 1 min, and 68°C 12 min for 20 cycles.

Table I. Primers used in site-directed mutagenesis.

Sequences used as primer sets for site-directed mutagenesis of the Iγ1 and Iγ4 promoters are shown to the right of their respective construct name. Primers are listed 5′-3′ with specific mutations shown in bold.

Primer Set (Iγ4 36bp site-mutations) Sequence (5′ → 3′)
γ4mutCREB(T) F: GAAGACAAATATCGGCTGACGGCGGGGGCGGGGCCGCCCACAT
R: ATGTGGGCGGCCCCGCCCCCGCCGTCAGCCGATATTTGTCTTC
γ4mutCREB(A) F: GAAGACAAATAGCGGCTGACGGCAGGGGCGGGGCCGCCCACAT
R: ATGTGGGCGGCCCCGCCCCTGCCGTCAGCCGCTATTTGTCTTC
γ4mutκB6 F: GAAGACAAATAGCGGCTGACGGCGGGGGCGGGGCTGCCCACAT
R: ATGTGGGCAGCCCCGCCCCCGCCGTCAGCCGCTATTTGTCTTC
γ4mutCREB(A)/κB6 F: GAAGACAAATAGCGGCTGACGGCAGGGGCGGGGCTGCCCACAT
R: ATGTGGGCAGCCCCGCCCCTGCCGTCAGCCGCTATTTGTCTTC
Primer Set (Iγ1 36bp site-mutations) Sequence (5′ → 3′)
γ1mutCREB(G) F: GAAGACAAATATCGGCTGACGGCGGGGGCGGGGCTGCCCACAT
R: ATGTGGGCAGCCCCGCCCCCGCCGTCAGCCGATATTTGTCTTC
γ1mutκB6 F: GAAGACAAATATCGGCTGACGGCAGGGGCGGGGCCGCCCACAT
R: ATGTGGGCGGCCCCGCCCCTGCCGTCAGCCGATATTTGTCTTC
γ1mutCREB(G)/κB6 F: GAAGACAAATATCGGCTGACGGCGGGGGCGGGGCCGCCCACAT
R: ATGTGGGCGGCCCCGCCCCCGCCGTCAGCCGATATTTGTCTTC
Primer Set (Iγ4 CD40RR site-mutations) Sequence (5′ → 3′)
γ4 Δ -180/A-C F: GCCCTCTGACCCAGAAACCACCAGAAGAAAAG
R: CTTTTCTTCTGGTGGTTTCTGGGTCAGAGGGC
γ4 Δ -140/G-T F: CAGGAAGTAAGTGGTGCCGCTGGTTTCAATCCTG
R: CAGGATTGAAACCAGCGGCACCACTTACTTCCTG
γ4 Δ -131/T-C F: CAGGAAGTAAGGGGTGCCGCCGGTTTCAATCCTG
R: CAGGATTGAAACCGGCGGCACCCCTTACTTCCTG
γ4 Δ -140/-131/G-T/T-C F: CAGGAAGTAAGTGGTGCCGCCGGTTTCAATCCTG
R: CAGGATTGAAACCGGCGGCACCACTTACTTCCTG
Open in a new tab

Transient transfections and co-culture conditions

Transfection and stimulation of Ramos 2G6 B cells (5 × 106 per condition) was carried out exactly as previously described (29).

Electromobility Shift Assays

Ramos 2G6 B cells were incubated for 24 hrs with 10-fold cell equivalents of either 293 or 293/CD154 membranes in the presence or absence of IL-4 (200U/ml) (Peprotech, Rocky Hill, NJ). Preparation of nuclear extracts and electromobility shift assays (EMSA) were performed as previously detailed (30). The following double stranded oligos containing wildtype and mutated sequences (base changes are denoted in bold capital letters) were used as probes: γ4-36bp wt: 5′gaagacaaatagcggctgacggcgggggcggggccgcccacat3′; γ4-mutCREB(A): 5′gaagacaaatagcggctgacggcAggggcggggccgcccaat 3′; γ4-mutκB6: 5′gaagacaaatagcggctgacggcgggggcggggcTgcccacat 3′; γ1-36bp wt: 5′aaatatcggctgacggcaggggcggggctgcccaca 3′; γ1-CD40RR: 5′gtggactccccctcgccctctgacccagaaaccaccagaagaaaagggaacttcaggaagtaagtggtgccgcc 3′; γ4-CD40RR: 5′gtggactccccctcgccctctgacacagaaaccaccagaagaaaagggaacttcaggaagtaaggg gtgccgct 3′ and double-stranded competitor NF-κB consensus oligo (Promega): 5′agttgaggggactttcccaggc 3′.

Chromatin Immunoprecipitation Assay

5×107 Ramos 2G6 or 3×107 CD19+/IgG- B cells were cultured for 24 hrs in RPMI in the presence of 3×10ˆ8 cell equivalents of either 293 or 293/CD154 membranes. In the case of Native Chromatin Immunoprecipitation (nChIP), chromatin was treated with 20U of Micrococcal Nuclease (USB, Cleveland, OH) for 7-9 min at 37°C and then used for immunoprecipitation with minor modifications of an established protocol (39). In experiments incorporating xChIP, cells were subjected to 8 min of cross-linking in 1% formaldehyde at room temperature and chromatin was subsequently sonicated and immunoprecipitated with minor modifications as previously described (40).

PCR Amplification of Iγ1 and Iγ4 Promoter Sequences

The following primers were used to specifically amplify the Iγ1 or Iγ4 promoters: Common Iγ forward primer 5′tcgccctctgacccagaaacc 3′; Iγ1 reverse primer 5′ tccatgtagtgccggactcgaccccatgtc 3′; and Iγ4 reverse primer 5′atgtggtgctggcatcgcgcccgcg 3′. The specificity of these primers was tested using either 0.2 ng purified Hind III-Bam HI Iγ subclass promoter sequence, 1 μL of 1:200 dilution of input chromatin, 3 μL of undiluted or 10-fold serial diluted immunoprecipitate as previously described (41). The following negative control primers for the myogenin promoter were used: forward 5′tcatagaagcgggggttcctggtag 3′; reverse 5′gaatcacatctaatccactgtaaacg 3′.

PCR reactions (20-25 μl) contained 1×FastStart PCR Buffer + MgCl2 (Roche Applied Science, Indianapolis, IN), 1U FastStart Taq Polymerase (Roche), a mix of dNTPs containing 0.3X dCTP, and 3 μCi of 32P α-dCTP. PCR amplification was carried out with the following cycling parameters: 94°C for 3 min, followed by 28 cycles of 30 s at 94°C, 30 s at 59°C, and 30 s at 72°C, with a final extension of 6 min at 72°C.

Statistical Analysis

For comparison of samples a two-tailed Student's T-test was used where significance was set at P< 0.05. Data in figures is shown as mean +/- SEM unless otherwise indicated.

Results

Iγ1 and Iγ4 GLT is differentially regulated in peripheral B cells

The profile of Iγ1 and Iγ4 transcripts was determined in primary CD19+/IgG- B cells by culturing them with IL-4 and/or CD154 over a 6 d time course. At each time point there was a clear difference in regulation and magnitude of the two transcripts in response to activating signals. Iγ1 transcripts were induced at 36 h post-stimulation in response to all conditions of activation and this pattern was maintained over the duration of the time course (Fig. 1A). In contrast, Iγ4 transcripts were apparent only in response to CD154 and IL-4 signals and at a very low level compared to Iγ1 transcripts. The four Cγ genes reside in two distinct duplication units that become transcriptionally active at different time points of B cell stimulation (the first preceding the second) (36). To establish if the low level of Iγ4 transcription was due to a general unresponsiveness of the second duplication unit, transcription activity from the Iγ2 promoter was analyzed over the same time course. We found the Iγ2 promoter to be highly responsive to both IL-4 and CD40 signals suggesting that the Iγ4 transcription is low even compared to the Iγ2 transcription in the same duplication unit.

FIGURE 1. Differential regulation of Iγ1 and Iγ4 transcription is not explained by differences in histone acetylation status.

FIGURE 1

Open in a new tab

(A). CD19+IgG- B cells were cultured in media alone (lanes 1, 5, 9 and 13) or with IL-4 alone (2, 6, 10 and 14), 293/CD154 cells alone (lanes 3, 7, 11 and 15) or with IL-4 + 293/CD154 cells (lanes 4, 8, 12 and 16). RNA was isolated at the indicated times and RT-PCR was performed. Shown are Iγ-Cγ transcripts identified with probes for specific Iγ hinge regions. (B). nChIP analysis of acetylated histones H3 and H4 at the Iγ1 (top panel) and Iγ4 (middle panel) loci in CD19+ IgG- primary B cells incubated with 293 membranes (lanes 1-5) or 293/CD154 membranes (lanes 6-10) for 24 h. Amplification of the myogenin locus was used as a negative control (bottom panel).

To test whether histone acetylation was a possible factor underlying specific transcriptional regulation, chromatin was harvested from CD19+/IgG- B cells cultured for 24 h with either 293 or 293/CD154 membranes and acetylation of H3 and H4 histones analyzed by nChIP using primers specific for the proximal promoter regions (Fig. 1B). We observed that acetylation of H3 and H4 histones occurred at both the Iγ1 and Iγ4 promoters prior to and after stimulation with CD154. This result was surprising in light of recent reports showing hyperacetylation of histones in the mouse Iγ promoters in response to LPS plus IL-4 or CD154 alone (42, 43). The fact that our studies only used CD154 as a stimulus and analyzed only one region of the promoter prevents us from ruling out the possibility that epigenetic changes to regions outside the proximal promoter may play an important role in overall transcriptional activation. However, these data suggested that sequence differences within the promoters might account for the different levels of expression of the two promoters.

Single nucleotide changes increase the functional responsiveness of the Iγ4 promoter

To further evaluate Iγ1 and Iγ4 promoter function we utilized a human IgM+ B cell line (Ramos 2G6) that maintains a pattern of biased GLT similar to that of primary B cells (33). Sequence comparison of the Iγ1 and Iγ4 proximal promoter regions identified 15 nucleotide differences (Fig. 2A, lower case, bold letters). These changes were significant relative to promoter strength as confirmed by subcloning the regions (termed γ1-512 and γ4-500) into the pGL2E reporter plasmid and assaying for luciferase activity. Transfections with the γ1-512 displayed a statistically significant 3-4-fold higher response than the γ4-500 to either CD154 alone or CD154 and IL-4 (Fig. 2B). Similar patterns of were observed with constructs containing approximately 1kb of additional upstream sequence (Iγ1p1 and Iγ4p1) signifying that the differences in promoter strength could be localized to the proximal 500 bp promoter sequence. However, the observed responses of the promoter constructs to different stimuli was slightly different than those observed with the endogenous promoters (compare Fig. 1A with Fig. 2B). These differences may reflect epigenetic factors controlling promoter accessibility in the chromatin. What is clear is that the promoter constructs maintain the strength difference that is observed in the endogenous promoter and therefore presented an opportunity to study this phenomenon. Our analysis focused on sequence differences within two proximal regulatory regions, namely the CD40RR and the downstream 36 bp element. We initially analyzed three nucleotide changes in the CREB/ATF-1/2 and κB6 sites located within the 36 bp element since the nucleotide differences within the CD40RR were positioned outside the three conserved NF-κB sites.

FIGURE 2. Differences in intrinsic Iγ1 and Iγ4 promoter strength are influenced by single nucleotide differences.

FIGURE 2

Open in a new tab

(A). Schematic representation of aligned Iγ1 and Iγ4 promoter sequences where NF-κB, STAT6, and CREB/ATF binding sites are boxed, single nucleotide variations are shown in bold, and major transcription start sites are noted with arrows. The CD40RR and the 36 bp elements are indicated by dashed boxes. (B). Ramos 2G6 cells were transiently transfected with the γ1p1, γ1-512, γ4p1, or the γ4-500 reporter constructs. Asterisks denote statistically significant differences in proximal Iγ4 promoter inducibility compared to the Iγ1 activity where P<0.05. (C). Schematic representation of site directed mutations used to make reporter constructs with single nucleotide exchanges between the Iγ1 and Iγ4 promoters. Transient transfections of Ramos 2G6 B cells were assayed for luciferase activity with the indicated reporter constructs 48 h post transfection. The results are represented as the average and SEM of a minimum of three independent experiments. Astericks denote statistically significant differences (P<0.05) in promoter inducibility between the Iγ4 (left panel) or Iγ1 (right panel) mutant constructs and the corresponding wild type constructs.

To characterize individual sequence differences in the 36 bp element, mutant Iγ4 promoter regions were created with single nucleotide changes at -20 and -8 in the CREB/ATF-1 site and nucleotide +4 in the κB6 site that matched the corresponding nucleotides in the Iγ1 promoter (T, A and T, respectively). Transient reporter assays revealed that the change at position -20 (γ4mutCREB(T)) had no effect on γ4 activity (Fig. 2C). In contrast, the other two single site changes (γ4mutCREB(A), and γ4mutκB6) yielded an approximate 1.5-fold increase in IL-4 and a 2.5-3.5-fold increase in CD40 responsiveness, respectively. Surprisingly, we observed no further increase in luciferase activity with the double mutant (γ4mutCREB(A)/κB6, lanes 17-20).

Reciprocal constructs were engineered by creating single site mutations in the Iγ1 promoter at position +83 in the CREB/ATF-1 site (γ1mutCREB(G)), at position +94 in the NF-κB6 site (γ1mutκB6), and a double mutant incorporating both changes (γ1mutCREB(G)/κB6). Transfections with either the γ1mutκB6 or the γ1mutCREB(G)/κB6 construct displayed a mirrored decrease in expression that matched the increase in expression demonstrated by their reciprocal constructs in response to CD40 signals (Fig. 2C, right side of graph). Unexpectedly, the γ1mutCREB(G) construct failed to show a significant decrease in activity, whereas its counterpart, the γ4mutCREB(A) construct, showed a 3.5-fold increase in activity suggesting that the Iγ1 κB6 element can compensate for a potentially compromised adjacent CREB element. Although exchanging the single nucleotide between the κB6 sites (and the single CREB nucleotide, but only for Iγ4 promoter) was capable of altering the transcriptional responsiveness of the two promoters, these mutations did not entirely recapitulate wild type levels of transcription from either promoter. Therefore, sequences within the 36 bp element contributed to the overall magnitude of Iγ1 and Iγ4 transcription however, sequences outside this region are required for optimal activity.

NF-κB binds weakly to the Iγ4 κB6 site

EMSA was carried out using the γ4-36bp wt probe or mutated versions containing either the single nucleotide mutation in the CREB site (γ4 mutCREB(A)) or the single nucleotide change in the κB6 site (γ4mutκB6) to formally demonstrate that the difference in promoter strength directly arose from preferential binding of NF-κB subunits to the Iγ1 promoter (Fig. 3A). Antibodies against p50, CREB and p300 were added to specific reactions to identify factor-specific complexes. Two complexes bound weakly to the γ4-36bp wt probe which contained p50 (complex II, lane 3), and CREB (complex I lane 4). Addition of anti-p300 antibodies to the binding reaction resulted in a subshifting of complex II, indicating the presence of both p50 and p300 in this complex (lane 5). Binding reactions carried out with the single base pair change in the CREB consensus site resulted in the appearance of a second CREB containing complex (complex III, lane 8 and 10) as well as a slight increase in NF-κB (lane 9) and p300 binding (lane 11). However, the difference in binding patterns with the γ4mutκB6 probe demonstrated a marked increase in complexes II and III, in particular those containing p50 (lanes 14-17). These results are consistent with a model whereby increased factor binding results in the enhanced strength of the Iγ1 promoter and that increased binding of either NF-κB or CREB resulted in enhanced complex binding to the adjacent site. This is especially evident when the κB6 site is altered and we observe enhanced binding of complex III as well as increased p300 association.

FIGURE 3. CREB, NF-κB, and p300 associate weakly with Iγ4 elements in the 36 bp region.

FIGURE 3

Open in a new tab

(A). Nuclear extracts from Ramos 2G6 cells stimulated for 24 h with 293/CD154 membranes were incubated in binding reactions with probes γ4-36bp wt (lanes 2-6), γ4mutCREB(A) (lanes 8-12), or γ4mutκB6 sequence (lanes 14-18) without (lanes 2, 8 and 14) or with supershifting p50 (lanes 3, 9 and 15), CREB (lanes 4, 10 and 16), p300 (lanes 5, 11 and 17) antibodies. Control rabbit serum was included in lanes 6, 12 and 18. Mobility shifts are indicated by asterisks and complexes of interest are designated I-CREB, II-NF-κB and III-CREB. (B). Binding assays were carried out using nuclear extract from Ramos 2G6 cells cultured for 24 h with 293/CD154 cells (lanes 3-19) and a uniformly labeled probe containing the Iγ4 36 bp element containing the mutated κB6 site (γ4mutκB6). Cold competitor oligos of self (lanes 4-7), γ4-36 bp (lanes 8-11), γ1-36 bp (lanes 12-15) or NF-κB consensus site (lanes 16-19) were added in titrating molar increments of 10-, 50-, 100- and 200-fold over probe concentration. CREB and NF-κB complexes are noted to the left with arrows and competed complex is indicated with an asterisk. Lane 1 shows probe alone and lane 2 shows probe plus unstimulated extract.

To test if the binding affinity for NF-κB family members is increased by changing a single nucleotide in the consensus site, competition assays were carried out using CD154-stimulated nuclear extract, and the γ4mutκB6 probe containing the Iγ4 CREB site and the Iγ1 κB6 site, in the presence of increasing molar amounts of unlabeled competitor double-stranded oligos (Fig. 3B). The addition of either the γ4mutkB6 (self) oligo (lanes 3-7) or γ1-36bp oligo (lanes 12-15), both harboring the same NF-κB site as the labeled probe, competed complex binding considerably better than the γ4-36bp wt oligo (compare lanes 4 and 12 with lane 8). In fact, the NF-κB complex was not fully competed with the γ4-36bp wt oligo at even the highest concentration (lane 11). This difference in binding affinity conferred by the single base pair change was approximately 5-fold based on the extent of complex bound to the labeled probe at 10X and 50X molar ratios of cold oligo (compare asterisks at lanes 4 and 9).

NF-κB subunits preferentially bind to the Iγ1 κB6 consensus site

Reduced NF-κB binding to the Iγ4 promoter may be a result of specific NF-κB/rel dimers failing to bind to the altered consensus sequence. To test this possibility, EMSA was carried out with the γ4-36bp and γ4mutκB6 probes in the presence of antibodies. As shown in Fig. 4A, there was a marked decrease in p50, p65, c-Rel and RelB binding to the γ4-36 bp site relative to the γ4mutκB6 site (as noted by asterisks in lanes 3-5 with lanes 11-13). No p52 binding was seen with either probe (lanes 7 and 15). Therefore, our in vitro results indicated that all NF-κB binding was reduced at the γ4κB6 site. Unexpectedly, CREB binding was consistently increased when the Iγ1-κB6 site was present. This was observed in both the presence and absence of NF-κB binding to this site (see Fig. 3B, lanes 16-19 and Fig. 4A, compare lanes 1 and 2 to lanes 9 and 10).

FIGURE 4. Specific canonical sequences promote preferential NF-κB subunit and CREB/ATF binding.

FIGURE 4

Open in a new tab

(A). The γ4-36 bp wt (lanes 1-8) and γ4mutκB6 (lanes 9-16) sequences were used in EMSA with nuclear extracts from Ramos 2G6 cells stimulated with 293/CD154 membranes + 200U/ml IL-4 for 24 h. Supershifting antibodies to p50 (lanes 3 and 11), p65 (lanes 4 and 12), c-Rel (lanes 5 and 13), RelB (lanes 6 and 14), p52 (lanes 7 and 15) antibodies and control rIgG serum (lanes 8 and 16) were included and supershifted bands noted with asterisks. CREB and NF-κB complexes are shown with arrows to the left. (B). Schematic representation of factor binding sites included within the PCR primer boundaries. Chromatin from Ramos 2G6 B cells (lanes 1-7) and CD19+IgG- B cells (lanes 8-14) incubated with 293/CD154 membranes were immunoprecipitated with p50 (lanes 3 and 10), p65 (lanes 4 and 11), c-Rel (lanes 5 and 12), CREB (lanes 6 and 13) antibodies and control rabbit IgG (lanes 2 and 9). Lanes 1 and 8 are PCR amplification in the absence of chromatin. Input DNA represented 0.45% of the precipitated sample (Lanes 7 and 14).

To confirm that a difference in recruitment of NF-κB/rel subunits to the individual promoters occurred in vivo we carried out xChIP on Ramos 2G6 B cells and CD19+/IgG- B cells stimulated for 24 h with CD154 (Fig. 4B). Using primers that selectively distinguished between Iγ1 and Iγ4 sequences we observed a lower level of p50, p65, c-Rel and CREB binding to the Iγ4 promoter in both Ramos B cells and primary B cells. Notably, the Iγ4 amplification was relatively more efficient (compare “Input” samples for Iγ1 and Iγ4), which makes the differential binding between the promoters even more dramatic. Also, primary cells displayed a dominant c-Rel subunit binding profile at the Iγ1 promoter as compared to a diverse array of binding in the Ramos B cells. This difference may reflect the immortalized nature of the Ramos 2G6 cell line and does not take away from the fact that there is a distinct difference in NF-κB/rel binding between the Iγ1 and Iγ4 promoters in both primary and Ramos B cells. Importantly these results support our in vitro binding data showing that the Iγ4 promoter is less efficient at recruiting NF-κB and CREB in response to CD40 signals.

Sequences outside the 36 bp region also contribute to promoter activity

The fact that only 50% of the Iγ1 promoter activity was reconstituted with the corresponding CREB and κB6 substitutions suggested that a second region was involved in promoter activity (Fig. 2C). Since the CD40RR has been previously implicated in promoter function we analyzed binding at this region and found stronger binding of complex with the Iγ4 versus the Iγ1 sequence (Fig. 5A). To establish the consequence of mutating the Iγ4 CD40RR to an Iγ1 signature two constructs were made that contained either the A->C change at -180 or the G->T and T->C changes at nucleotides -140 and -131. Neither of these constructs showed an increase in transcriptional activity that was statistically significant compared to the wild type Iγ4 construct (Fig. 5B, left panel).

FIGURE 5. Sequence elements within the CD40RR function cooperatively with cis-elements in the 36 bp region.

FIGURE 5

Open in a new tab

(A). EMSA using the CD40RR from the Iγ1 (lanes 1 and 2) and the Iγ4 (lanes 3 and 4) promoters showing reactions with probe alone (lanes 1 and 3) or probe plus CD154-stimulated extract (lanes 2 and 4). (B). Shown is the schematic of the CD40RR and flanking sequence with arrows designating nucleotide exchanges in mutant promoter constructs. Constructs containing either the single A→C mutation at -180 or the double change at -140 and -131 in the Iγ4-500 promoter sequence were tested in reporter assays (shown in left of Figure). Additional transfections were carried out using constructs containing the mutation at -180 and the CREB/κB6 mutations in the Iγ4-500 backbone (data presented in graph on right). Luciferase data is presented as fold induction over unstimulated cells and represents the mean and SEM of a minimum of three independent experiments. A comparison of γ4 CD40RR mutations and the γ4 wild type (left panel) and combined CD40RR and 36 bp mutations compared to the γ1 promoter (right panel) were carried out using a two-tailed unpaired T test analysis with a 95% confidence interval. No statistically significant differences were found among each group of constructs.

Since substitutions to either the CD40RR or the 36 bp element could not reconstitute maximal Iγ1 promoter activity, we investigated whether changes in both regions would produce a characteristic Iγ1 response. To this end, Iγ4 promoter constructs were engineered to contain the indicated changes in the CD40RR and 36 bp element (Iγ4Δ-180/A-C+mutCREB(A)/κB6 and the Iγ4Δ-140-131/G-T/T-C/mutCREB(A)/κB6). Testing these constructs in reporter assays revealed that nucleotide changes in both regions cooperatively increased the overall response of the Iγ4 promoter to a level that was statistically equivalent to that of the Iγ1 promoter (Fig. 5C, right panel). These findings confirmed the presence of two distinct regions for GLT regulation and highlighted the impact that a small number of sequence differences have on the overall transcriptional response to CD40.

Discussion

GLT is an obligate step in CSR that underlies the isotype differentiation necessary for specific expansion of the humoral immune response. Our present findings demonstrate a distinct difference in the NF-κB-mediated regulation of two highly homologous Iγ promoters that results in unique expression patterns to CD40 signaling. Our data clearly suggests that a limited number of nucleotide changes in critical binding sites markedly alter the response of the Iγ1 and Iγ4 promoters to CD40 signals. Although our data does not provide an exhaustive screen of the epigenetic control of CD154-induced transcription, these findings can begin to establish a molecular framework with which to understand preferential recombination to specific Cγ loci and the associated disparity of IgG subclass concentrations in human blood. Based on previous work showing that GLT is linearly correlated with CSR efficiency (44), we would predict that the low level of Iγ4 transcription directly corresponds to the observed level of recombination to Cγ4 and the markedly reduced levels of circulating IgG4 (1-3).

Our current data clearly demonstrates that the κB6 site in the Iγ4 promoter is less active because of the single nucleotide change in the binding site. Replacing this base pair to create an Iγ1 κB6 site increases the binding of both NF-κB/rel and CREB to the adjoining site. Notably, the strength of CREB binding was enhanced in a manner that was shown by our competition studies to be independent of NF-κB binding. This suggested that the actual sequence of the NF-κB consensus site was influencing CREB binding. Although this result was surprising, the impact of flanking sequences adjacent to the conserved consensus element on transcription factor binding is not unprecedented (45, 46). For example, mutations at positions outside the binding site for the yeast Mcm1 protein, a member of the MADS box protein family of transcription factors, significantly reduced Mcm1-dependent DNA bending and transcriptional activation (45). In contrast, the increase in p300 binding in response to the single κB6 substitution confirms the known association between NF-κB and p300 (47-50).

Although the canonical NF-κB binding site 5′-G-5G-4G-3R-2N-1N0Y+1Y+2C+3C+4-3′ predicts that a change at position 6 (N0) will be highly tolerated and not affect function, a comprehensive in vitro study aimed at identifying optimal NF-κB binding sites concluded that the preferred base for p50, p65 and c-Rel binding at this position is T, T and A/T, respectively (51). Interestingly, the identification of preferred NF-κB binding sites has been challenged by structural studies showing base-specific contacts within the homodimers involving primarily 5′-G-5G-4G-3 (p50) and 5′-G-4G-3 (p65) (52-54) and that identical residues within c-Rel and p65 residues contact the NF-κB consensus sequence (55, 56). Also, x-ray structures of the p50:p65 heterodimers revealed a high degree of permissiveness in NF-κB-DNA interactions (54, 57-59). Finally, others have identified functional κB sites that contain a C in the N0 position (for example, the distal κB site of the MCP-1 promoter) (60, 61). Nevertheless, our results strongly support a level of specificity for NF-κB/rel subunit binding that is dictated by the local DNA environment, a finding similar to that of the weak NF-κB site in the I-CAM promoter (62). Thus, within the context of the Iγ4 promoter, the NF-κB/rel subunits bind poorly to a consensus site when a C is in position 6.

In published studies, a high level of functional redundancy was revealed for NF-κB/rel subunits with respect to the activation of transiently transfected promoters but not for the in vivo expression of the same endogenous promoters (63). Our data extends these findings by demonstrating a binding preference for c-Rel to the Iγ1 promoter in primary B cells and equal binding of both p50 and c-Rel in EMSA. Similar to the findings of Saccani et al. these results suggest that chromatin configuration may play a role in promoter accessibility to different NF-κB subunits (40). ChIP results using primary cells and Ramos B cells support our in vitro findings by indicating a strong difference in NF-κB binding to the Iγ1 and Iγ4 promoters. The question remains as to why such a limited number of changes can have such a dramatic effect on Iγ4 transcription. One possibility is that bound transcription factors within the Iγ4 promoter fail to or weakly recruit co-activator (p300) molecules into a higher order complex. This type of multi-factorial regulation has been proposed for many genes including mcp-1 (60) and the ifn-β, which are activated by a complex enhancesome (50, 64). Recently, a single nucleotide change at the N0 position was shown to change the dependence of the promoter for a specific co-activator without affecting NF-κB binding (65). It is possible that weak NF-κB binding at the Iγ4 site engages a co-activator, other than p300 resulting in a less efficient activation complex. Our findings are also consistent with a promoter “competition” model proposed to explain differences in subclass-specific GLT and CSR (66, 67). In this model, GLT occurs through direct interactions between the promoter and 3′α enhancer and promoter strength may be but one factor influencing preferred interaction with a particular promoter.

In summary, this study provides evidence that differences in the transcription of two highly homologous genes are accounted for, in part, by a very limited number of base pair differences in two distinct promoter regions. That different degrees of transcription are directly linked to recombination efficacy are inferred from other studies but not rigorously proven. Ongoing detailed elucidation of Iγ4 promoter activity, and as an extension the expression of IgG4 antibodies, will shed light on dysregulated IgG4 expression during pathological conditions such as chronic helminth infection where the IgG4 subclass represents a major component of the IgG response (9, 68-71).

Acknowledgments

We are grateful to past and present members of the Covey lab for valuable input, assistance and discussion. Dr. Nancy Rice is sincerely thanked for the generous gift of anti-p50 antibodies. This study was initiated as part of the PhD thesis work of RLD.

These studies were supported by The National Institutes of Health grant (RO1-AI37081) to L. R. C. and a National Institutes of Health Training Fellowship (T32AI07403, PI, Dr. Sidney Pestka, Dept. of MMG at Robert Wood Johnson Medical School, UMDNJ) to R. L. D.

Footnotes

The authors have no conflicting financial interests.

References

  • 1.Dray S. Three gamma-globulins in normal human serum revealed by monkey precipitins. Science. 1960;132:1313–1314. doi: 10.1126/science.132.3436.1313. [DOI] [PubMed] [Google Scholar]
  • 2.Grey HM, Kunkel HG. H Chain Subgroups of Myeloma Proteins and Normal 7s Gamma-Globulin. J Exp Med. 1964;120:253–266. doi: 10.1084/jem.120.2.253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Terry WD, Fahey JL. Subclasses of Human Gamma-2-Globulin Based on Differences in the Heavy Polypeptide Chains. Science. 1964;146:400–401. doi: 10.1126/science.146.3642.400. [DOI] [PubMed] [Google Scholar]
  • 4.French MA, Harrison G. Serum IgG subclass concentrations in healthy adults: a study using monoclonal antisera. Clin Exp Immunol. 1984;56:473–475. [PMC free article] [PubMed] [Google Scholar]
  • 5.Jefferis R, Kumararatne DS. Selective IgG subclass deficiency: quantification and clinical relevance. Clin Exp Immunol. 1990;81:357–367. doi: 10.1111/j.1365-2249.1990.tb05339.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ravetch JV, Bolland S. IgG Fc receptors. Annu Rev Immunol. 2001;19:275–290. doi: 10.1146/annurev.immunol.19.1.275. [DOI] [PubMed] [Google Scholar]
  • 7.van de Winkel JG, Capel PJ. Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications. Immunol Today. 1993;14:215–221. doi: 10.1016/0167-5699(93)90166-I. [DOI] [PubMed] [Google Scholar]
  • 8.Woof JM, Burton DR. Human antibody-Fc receptor interactions illuminated by crystal structures. Nat Rev Immunol. 2004;4:89–99. doi: 10.1038/nri1266. [DOI] [PubMed] [Google Scholar]
  • 9.Aalberse RC, Dieges PH, Knul-Bretlova V, Vooren P, Aalbers M, van Leeuwen J. IgG4 as a blocking antibody. Clin Rev Allergy. 1983;1:289–302. doi: 10.1007/BF02991163. [DOI] [PubMed] [Google Scholar]
  • 10.Aalberse RC, Schuurman J. IgG4 breaking the rules. Immunol. 2002;105:9–19. doi: 10.1046/j.0019-2805.2001.01341.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Devey ME, Bleasdale KM, French MA, Harrison G. The IgG4 subclass is associated with a low affinity antibody response to tetanus toxoid in man. Immunol. 1985;55:565–567. [PMC free article] [PubMed] [Google Scholar]
  • 12.van der Zee JS, van Swieten P, Aalberse RC. Serologic aspects of IgG4 antibodies. II. IgG4 antibodies form small, nonprecipitating immune complexes due to functional monovalency. J Immunol. 1986;137:3566–3571. [PubMed] [Google Scholar]
  • 13.van der Zee JS, van Swieten P, Aalberse RC. Inhibition of complement activation by IgG4 antibodies. Clin Exp Immunol. 1986;64:415–422. [PMC free article] [PubMed] [Google Scholar]
  • 14.Manis JP, Tian M, Alt FW. Mechanism and control of class-switch recombination. Trends Immunol. 2002;23:31–39. doi: 10.1016/s1471-4906(01)02111-1. [DOI] [PubMed] [Google Scholar]
  • 15.Snapper CM, Marcu KB, Zelazowdski P. The immunoglobulin class switch: Beyond “accessibility”. Immunity. 1997;6:217–223. doi: 10.1016/s1074-7613(00)80324-6. [DOI] [PubMed] [Google Scholar]
  • 16.Stavnezer J. Antibody class switching. Adv Immunol. 1996;61:79–146. doi: 10.1016/s0065-2776(08)60866-4. [DOI] [PubMed] [Google Scholar]
  • 17.Chaudhuri J, Alt FW. Class-switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat Rev Immunol. 2004;4:541–552. doi: 10.1038/nri1395. [DOI] [PubMed] [Google Scholar]
  • 18.Zhang J, Bottaro A, Li S, Stewart V, Alt FW. A selective defect in IgG2b switching as a result of targeted mutation of theIγ2b promoter and exon. Embo J. 1993;12:3529–3537. doi: 10.1002/j.1460-2075.1993.tb06027.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bottaro A, Lansford R, Xu l, Zhang J, Rothman P, Alt FW. S region transcription per se promotes basal IgE class switch recombination but additional factors regulate the efficiency of the process. Embo J. 1994;13:665. doi: 10.1002/j.1460-2075.1994.tb06305.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lorenz M, Jung S, Radbruch A. Switch transcripts in immunoglobulin class switching. Science. 1995;267:1825–1828. doi: 10.1126/science.7892607. [DOI] [PubMed] [Google Scholar]
  • 21.Hein K, Lorenz MG, Siebenkotten G, Petry K, Christine R, Radbruch A. Processing of switch transcripts is required for targeting of antibody class switch recombination. J Exp Med. 1998;188:2369–2374. doi: 10.1084/jem.188.12.2369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Stavnezer J, Guikema JE, Schrader CE. Mechanism and regulation of class switch recombination. Annu Rev Immunol. 2008;26:261–292. doi: 10.1146/annurev.immunol.26.021607.090248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iciek LA, Delphin SA, Stavnezer J. CD40 cross-linking induces Igε germline transcripts in B cells via activation of NF-κB. J Immunol. 1997;158:4769–4779. [PubMed] [Google Scholar]
  • 24.Messner B, Stutz AM, Albrecht B, Peiritsch S, Woisetschlager M. Cooperation of binding sites for STAT6 and NF kappa B/rel in the IL-4-induced up-regulation of the human IgE germline promoter. J Immunol. 1997;159:3330–3337. [PubMed] [Google Scholar]
  • 25.Linehan LA, Warren WD, Thompson PA, Grusby MJ, Berton MT. STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination. J Immunol. 1998;161:302–310. [PubMed] [Google Scholar]
  • 26.Shen CH, Stavnezer J. Interaction of Stat6 and NF-kB: Direct association and synergistic activation of interleukin-4-induced transcription. Mol Cell Biol. 1998;18:3395–3404. doi: 10.1128/mcb.18.6.3395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Stutz AM, Woisetschlager M. Functional synergism of STAT6 with either NF-kB or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 1999;163:4383–4391. [PubMed] [Google Scholar]
  • 28.Berton MT, Linehan LA, Wick KR, Dunnick WA. NF-kappaB elements associated with the Stat6 site in the germline gamma1 immunoglobulin promoter are not necessary for the transcriptional response to CD40 ligand. Int Immunol. 2004;16:1741–1749. doi: 10.1093/intimm/dxh175. [DOI] [PubMed] [Google Scholar]
  • 29.Bhushan A, Covey LR. CREB/ATF proteins enhance the basal and CD154- and IL-4-induced transcriptional activity of the human Igamma1 proximal promoter. Eur J Immunol. 2001;31:653–664. doi: 10.1002/1521-4141(200102)31:2<653::aid-immu653>3.0.co;2-d. [DOI] [PubMed] [Google Scholar]
  • 30.Dryer RL, Covey LR. A Novel NF-{kappa}B-Regulated Site within the Human I{gamma}1 Promoter Requires p300 for Optimal Transcriptional Activity. J Immunol. 2005;175:4499–4507. doi: 10.4049/jimmunol.175.7.4499. [DOI] [PubMed] [Google Scholar]
  • 31.Jumper MD, Splawski JB, Lipsky PE, Meek K. Ligation of CD40 induces sterile transcripts of multiple Ig H chain isotypes in human B cells. J Immunol. 1994;152:438–445. [PubMed] [Google Scholar]
  • 32.Fujieda S, Zhang K, Saxon A. IL-4 plus CD40 monoclonal antibody induces human B cells γ subclass-specific isotype switch: Switching to γ1, γ3, and γ4, but not γ2. J Immunol. 1995;155:2318–2328. [PubMed] [Google Scholar]
  • 33.Ford GS, Yin CH, Barnhart B, Sztam K, Covey LR. CD40 ligand exerts differential effects on the expression of Iγ transcripts in subclones of an IgM+ human B cell lymphoma line. J Immunol. 1998;160:595–605. [PubMed] [Google Scholar]
  • 34.Cerutti A, Zan H, Schaffer A, Bergsagel L, Harindranath N, Max EE, Casali P. CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+IgD+ B cell line. J Immunol. 1998;160:2145–2157. [PMC free article] [PubMed] [Google Scholar]
  • 35.Bhushan A, Barnhart B, Shone S, Song C, Covey LR. A transcriptional defect underlies B lymphocyte dysfunction in a patient diagnosed with non-X-linked hyper-IgM syndrome. J Immunol. 2000;164:2871–2880. doi: 10.4049/jimmunol.164.6.2871. [DOI] [PubMed] [Google Scholar]
  • 36.Sideras P, Nilsson L, Islam KB, Quintana IZ, Freihof L, Rosen A, Juliusson G, Hammarstrom L, Smith CI. Transcription of unrearranged Ig H chain genes in human B cell malignancies. Biased expression of genes encoded within the first duplication unit of the Ig H chain locus. J Immunol. 1992;149:244–252. [PubMed] [Google Scholar]
  • 37.Siegel JP, Mostowski HS. A bioassay for the measurement of human interleukin-4. J Immunol Meth. 1990;132:287–295. doi: 10.1016/0022-1759(90)90040-3. [DOI] [PubMed] [Google Scholar]
  • 38.Covey LR, Cleary AM, Yellin MJ, Ware R, Sullivan G, Belko J, Parker M, Rothman J, Chess L, Lederman S. Isolation of cDNAS encoding T-BAM, a surface glycoprotein on CD4+ T cells mediating identity with the CD40-ligand. Mol Immunol. 1994;31:471–484. doi: 10.1016/0161-5890(94)90066-3. [DOI] [PubMed] [Google Scholar]
  • 39.Umlauf D, Goto Y, Feil R. Site-specific analysis of histone methylation and acetylation. Methods Mol Biol. 2004;287:99–120. doi: 10.1385/1-59259-828-5:099. [DOI] [PubMed] [Google Scholar]
  • 40.Saccani S, Pantano S, Natoli G. Two waves of nuclear factor kappaB recruitment to target promoters. J Exp Med. 2001;193:1351–1359. doi: 10.1084/jem.193.12.1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Dryer RL, Covey LR. Use of chromatin immunoprecipitation (ChIP) to detect transcription factor binding to highly homologous promoters in chromatin isolated from unstimulated and activated primary human B cells. Biol Proced Online. 2006;8:44–54. doi: 10.1251/bpo117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nambu Y, Sugai M, Gonda H, Lee CG, Katakai T, Agata Y, Yokota Y, Shimizu A. Transcription-coupled events associating with immunoglobulin switch region chromatin. Science. 2003;302:2137–2140. doi: 10.1126/science.1092481. [DOI] [PubMed] [Google Scholar]
  • 43.Wang L, Whang N, Wuerffel R, Kenter AL. AID-dependent histone acetylation is detected in immunoglobulin S regions. J Exp Med. 2006;203:215–226. doi: 10.1084/jem.20051774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Lee CG, Kinoshita K, Arudchandran A, Cerritelli SM, Crouch RJ, Honjo T. Quantitative regulation of class switch recombination by switch region transcription. J Exp Med. 2001;194:365–374. doi: 10.1084/jem.194.3.365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Acton TB, Zhong H, Vershon AK. DNA-binding specificity of Mcm1: operator mutations that alter DNA-bending and transcriptional activities by a MADS box protein. Mol Cell Biol. 1997;17:1881–1889. doi: 10.1128/mcb.17.4.1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Roemer SC, Donham DC, Sherman L, Pon VH, Edwards DP, Churchill ME. Structure of the progesterone receptor-deoxyribonucleic acid complex: novel interactions required for binding to half-site response elements. Mol Endocrinol. 2006;20:3042–3052. doi: 10.1210/me.2005-0511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Perkins ND. Achieving transcriptional specificity with NF-kappa B. Int J Biochem Cell Biol. 1997;29:1433–1448. doi: 10.1016/s1357-2725(97)00088-5. [DOI] [PubMed] [Google Scholar]
  • 48.Perkins ND, Felzien LK, Betts JC, Leung K, Beach DH, Nabel GJ. Regulation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science. 1997;275:523–527. doi: 10.1126/science.275.5299.523. [DOI] [PubMed] [Google Scholar]
  • 49.Sheppard KA, Rose DW, Haque ZK, Kurokawa R, McInerney E, Westin S, Thanos D, Rosenfeld MG, Glass CK, Collins T. Transcriptional activation by NF-kappaB requires multiple coactivators. Mol Cell Biol. 1999;19:6367–6378. doi: 10.1128/mcb.19.9.6367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Merika M, Williams AJ, Chen G, Collins T, Thanos D. Recruitment of CBP/p300 by the IFN beta enhanceosome is required for synergistic activation of transcription. Mol Cell. 1998;1:277–287. doi: 10.1016/s1097-2765(00)80028-3. [DOI] [PubMed] [Google Scholar]
  • 51.Kunsch C, Ruben SM, Rosen CA. Selection of optimal kappa B/Rel DNA-binding motifs: interaction of both subunits of NF-kappa B with DNA is required for transcriptional activation. Mol Cell Biol. 1992;12:4412–4421. doi: 10.1128/mcb.12.10.4412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ghosh G, van Duyne G, Ghosh S, Sigler PB. Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature. 1995;373:303–310. doi: 10.1038/373303a0. [DOI] [PubMed] [Google Scholar]
  • 53.Muller CW, Rey FA, Sodeoka M, Verdine GL, Harrison SC. Structure of the NF-kappa B p50 homodimer bound to DNA. Nature. 1995;373:311–317. doi: 10.1038/373311a0. [DOI] [PubMed] [Google Scholar]
  • 54.Chen YQ, Ghosh S, Ghosh G. A novel DNA recognition mode by the NF-kappa B p65 homodimer. Nat Struct Biol. 1998;5:67–73. doi: 10.1038/nsb0198-67. [DOI] [PubMed] [Google Scholar]
  • 55.Wilson GM, Sutphen K, Moutafis M, Sinha S, Brewer G. Structural remodeling of an A + U-rich RNA element by cation or AUF1 binding. J Biol Chem. 2001;276:38400–38409. doi: 10.1074/jbc.M106509200. [DOI] [PubMed] [Google Scholar]
  • 56.Chen FE, Ghosh G. Regulation of DNA binding by Rel/NF-kappaB transcription factors: structural views. Oncogene. 1999;18:6845–6852. doi: 10.1038/sj.onc.1203224. [DOI] [PubMed] [Google Scholar]
  • 57.Berkowitz B, Huang DB, Chen-Park FE, Sigler PB, Ghosh G. The x-ray crystal structure of the NF-kappa B p50.p65 heterodimer bound to the interferon beta -kappa B site. J Biol Chem. 2002;277:24694–24700. doi: 10.1074/jbc.M200006200. [DOI] [PubMed] [Google Scholar]
  • 58.Escalante CR, Shen L, Thanos D, Aggarwal AK. Structure of NF-kappaB p50/p65 heterodimer bound to the PRDII DNA element from the interferon-beta promoter. Structure. 2002;10:383–391. doi: 10.1016/s0969-2126(02)00723-2. [DOI] [PubMed] [Google Scholar]
  • 59.Chen-Park FE, Huang DB, Noro B, Thanos D, Ghosh G. The kappa B DNA sequence from the HIV long terminal repeat functions as an allosteric regulator of HIV transcription. J Biol Chem. 2002;277:24701–24708. doi: 10.1074/jbc.M200007200. [DOI] [PubMed] [Google Scholar]
  • 60.Ping D, Jones PL, Boss JM. TNF regulates the in vivo occupancy of both distal and proximal regulatory regions of the MCP-1/JE gene. Immunity. 1996;4:455–469. doi: 10.1016/s1074-7613(00)80412-4. [DOI] [PubMed] [Google Scholar]
  • 61.Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, Fukushima J, Kawamoto S, Ishigatsubo Y, Okubo T. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol. 1994;153:2052–2063. [PubMed] [Google Scholar]
  • 62.Paxton LL, Li LJ, Secor V, Duff JL, Naik SM, Shibagaki N, Caughman SW. Flanking sequences for the human intercellular adhesion molecule-1 NF-kappaB response element are necessary for tumor necrosis factor alpha-induced gene expression. J Biol Chem. 1997;272:15928–15935. doi: 10.1074/jbc.272.25.15928. [DOI] [PubMed] [Google Scholar]
  • 63.Hoffmann A, Leung TH, Baltimore D. Genetic analysis of NF-kappaB/Rel transcription factors defines functional specificities. Embo J. 2003;22:5530–5539. doi: 10.1093/emboj/cdg534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Thanos D, Maniatis T. Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell. 1995;83:1091–1100. doi: 10.1016/0092-8674(95)90136-1. [DOI] [PubMed] [Google Scholar]
  • 65.Leung TH, Hoffmann A, Baltimore D. One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell. 2004;118:453–464. doi: 10.1016/j.cell.2004.08.007. [DOI] [PubMed] [Google Scholar]
  • 66.Cogne M, Lansford R, Bottaro A, Zhang J, Gorman J, Young F, Cheng HL, Alt FW. A class switch control region at the 3′ end of the immunoglobulin heavy chain locus. Cell. 1994;77:737–747. doi: 10.1016/0092-8674(94)90057-4. [DOI] [PubMed] [Google Scholar]
  • 67.Manis JP, van der Stoep N, Tian M, Ferrini R, Davidson L, Bottaro A, Alt FW. Class switching in B cells lacking 3′ immunoglobulin heavy chain enhancers. J Exp Med. 1998;188:1421–1431. doi: 10.1084/jem.188.8.1421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Aalberse RC, van der Gaag R, van Leeuwen J. Serologic aspects of IgG4 antibodies. I. Prolonged immunization results in an IgG4-restricted response. J Immunol. 1983;130:722–726. [PubMed] [Google Scholar]
  • 69.Hussain R, Ottesen EA. IgE responses in human filariasis. III. Specificities of IgE and IgG antibodies compared by immunoblot analysis. J Immunol. 1985;135:1415–1420. [PubMed] [Google Scholar]
  • 70.Ottesen EA, Skvaril F, Tripathy SP, Poindexter RW, Hussain R. Prominence of IgG4 in the IgG antibody response to human filariasis. J Immunol. 1985;134:2707–2712. [PubMed] [Google Scholar]
  • 71.Kurniawan A, Yazdanbakhsh M, van Ree R, Aalberse R, Selkirk ME, Partono F, Maizels RM. Differential expression of IgE and IgG4 specific antibody responses in asymptomatic and chronic human filariasis. J Immunol. 1993;150:3941–3950. [PubMed] [Google Scholar]

RESOURCES