Increased Production of 11β-hydroxysteroid Dehydrogenase Type 2 in the Kidney Microsomes of Squirrel Monkeys (Saimiri spp.)

Abstract

In squirrel monkeys (Saimiri spp.), cortisol circulates at levels much higher than those seen in man and other Old World primates, but squirrel monkeys exhibit no physiologic signs of the mineralocorticoid effects of cortisol. These observations suggest that squirrel monkeys have mechanisms for protection of the mineralocorticoid receptor (MR) from these high levels of cortisol. We previously showed that the serum cortisol to cortisone ratio in these animals is low relative to that in human serum, suggesting that production of the MR protective enzyme, 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2), is increased in squirrel monkeys. Here, we directly evaluate whether increased production of 11β-HSD2, which inactivates cortisol to cortisone, is a mechanism for protection of MR. In vitro assays showed that 11β-HSD2 activity in squirrel monkey kidney microsomes was 3 to 7 times higher than that seen in kidney microsomes from pig or rabbit. 11β-HSD2 protein detected by Western blot analysis was 4 to 9 times greater in squirrel monkey microsomes than in pig or rabbit microsomes. Comparison of the effect of expression of either human or squirrel monkey 11β-HSD2 on MR transactivation activity showed similar inhibition of MR response to cortisol by both enzymes, indicating that the intrinsic activities of the human and squirrel monkey enzymes are similar. These findings suggest that one mechanism by which squirrel monkeys protect the MR from activation by high cortisol levels in the kidney is by upregulation of 11β-HSD2 activity through increased production of the enzyme.

The mineralocorticoid receptor (MR) is a member of the nuclear receptor superfamily of ligand-dependent transcription factors. The MR plays a critical role in the regulation of electrolyte homeostasis and blood pressure.^14,27 The primary organ system in which the MR participates in regulation of electrolyte balance is the kidney, where MR is expressed in the distal nephron. Under normal conditions, renal MR is activated by the steroid hormone aldosterone, which is secreted from the adrenal cortex in response to low blood pressure or high serum potassium concentration. Activation of MR in the distal nephron of the kidney results in increased sodium reabsorption from and potassium secretion into the tubular lumen of the nephron, resulting in increased blood volume and decreased plasma potassium.

Two steroid hormones, the mineralocorticoid aldosterone and the glucocorticoid cortisol, can bind and activate the MR, which exhibits similar affinity for both hormones in vitro.⁵ However, in vivo, renal MR selectively binds aldosterone in the presence of normal circulating cortisol levels (3.3 to 24.6 μg/dl) that are approximately 1000-fold greater than those of aldosterone (4 to 31 ng/dl). The aldosterone selectivity of MR in kidney and other aldosterone target tissues is conferred by coexpression of the enzyme 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2), which converts cortisol to the inactive metabolite, cortisone.^10,36 Pharmacologic inhibition of 11β-HSD2, inactivating mutations in 11β-HSD2, or saturation of the enzyme by high cortisol concentrations results in inappropriate activation of MR by cortisol and leads to development of hypertension and electrolyte imbalance.^{12,26,34,36,38,39}

Some New World primates, including squirrel monkeys (Saimiri spp.), have free circulating cortisol concentrations that are approximately 100 times higher than those seen in humans and other mammals.^8,17-20,24 If MR in these animals is equally sensitive to activation by cortisol as in humans, in the face of such high plasma cortisol concentrations, squirrel monkeys would be expected to be hypertensive and hypokalemic. Yet, they are normotensive and have plasma electrolyte levels in range with those in man.^7,9,29,30 In addition, the aldosterone levels are in range with the normal values for humans, indicating that there is not simply a compensatory upregulation of aldosterone secretion in squirrel monkeys.^7,29 These observations suggest that squirrel monkeys possess mechanisms for protection of the MR from much higher levels of cortisol.

We previously have shown that the squirrel monkey and human MRs exhibit similar transactivation activity in response to cortisol.²⁹ Thus, the squirrel monkey MR is not intrinsically less responsive to cortisol than the human receptor. Another potential mechanism whereby squirrel monkeys might avoid the mineralocorticoid effects of high cortisol levels is upregulation of the MR protective enzyme, 11β-HSD2. Previously reported data from our laboratory showed that squirrel monkey serum cortisone levels are substantially elevated relative to human values,^20,29 suggesting that cortisol-to-cortisone conversion is increased in these animals. However, no direct comparison of 11β-HSD2 activity in tissues from squirrel monkey and other mammals has been conducted.

The objective of the current study was to determine whether 11β-HSD2 is upregulated in squirrel monkeys relative to other mammals. To test the hypothesis that squirrel monkeys exhibit increased conversion of cortisol to cortisone through upregulation of 11β-HSD2, we have: (1) determined the activity of 11β-HSD2 in kidney from squirrel monkey relative to that from other mammals; (2) compared the protein levels of 11β-HSD2 in kidney from squirrel monkey and other mammals; (3) compared the relative activities of squirrel monkey and human 11β-HSD2. The results of these studies suggest that one mechanism whereby squirrel monkeys avoid the mineralocorticoid effects of high serum cortisol concentrations is through upregulation of 11β-HSD2 in kidney.

Materials and Methods

Materials.

Radiolabeled steroid, [1,2,6,7-³H]-cortisol, was from GE Healthcare UK Limited (Buckinghamshire, UK). Carbenoxolone (CBX), NAD, protease inhibitor cocktail (P8340), and unlabeled cortisol were from Sigma (St Louis, MO). Silica gel GF thin-layer chromatography plates were obtained from Analtech (Newark, NJ). The antibody to human 11β-HSD2 was a gift from Dr WB Reeves (Pennsylvania State University, Hershey, PA).²¹ The antibody to rat MR (6G1) was provided by Dr Celso Gomez-Sanchez (University of Mississippi Medical Center, Jackson, MS).¹⁶ The antibody to Hsp90 (SPA-835) was purchased from Stressgen Biotechnologies (Victoria, BC, Canada). Alkaline-phosphatase–conjugated goat antirabbit IgG and goat antimouse IgG antibodies and the Immun-Star Chemiluminescent Protein Detection System were from Bio-Rad Laboratories (Hercules, CA). Alkaline-phosphatase–conjugated goat antirat IgG antibody was from American Qualex (San Clemente, CA). RNA Stat-60 was obtained from Tel-Test B (Friendswood, TX). African green monkey COS7 cells were purchased from American Type Culture Collection (Manassas, VA). Expression vector for human 11β-HSD2 was a gift Dr Celso Gomez-Sanchez (University of Mississippi Medical Center, Jackson, MS). The mouse mammary tumor virus promoter–luciferase reporter vector and human MR expression vector (hMR–pRSV) were provided by Dr RM Evans (Salk Institute, La Jolla, CA). The Luciferase Reporter Assay kit was purchased from BD Biosciences Clontech (Palo Alto, CA). The Superfect Transfection Reagent and One-Step RT-PCR kit were from Qiagen (Valencia, CA).

Preparation of microsomal protein.

Kidneys were obtained at necropsy from squirrel monkeys of both sexes through the Tissue and Biological Fluids Resource of the Center for Neotropical Primate Research and Resources (Mobile, AL): 2 adult, female Bolivian squirrel monkeys (Saimiri boliviensis boliviensis, animals 2371 and 2376); an adult, female Guyanese squirrel monkey (Saimiri sciureus, number 665); and a juvenile, male Peruvian squirrel monkey (Saimiri boliviensis peruviensis, number 4112). None of the animals had evidence of renal disease. We obtained similar results with microsomal fractions prepared from kidneys from each of these monkeys. Pig kidneys were from juvenile Yorkshire pigs sedated with ketamine (8 mg/kg body weight) and xylazine (0.4 mg/kg body weight) and euthanized with intravenous overdose of sodium pentobarbital (60 mg/kg body weight). Rabbit kidneys were from adult New Zealand White rabbits that were euthanized by exsanguination under deep anesthesia (30 mg/kg body weight sodium pentobarbital). All experiments were approved by the Institutional Animal Care and Use Committee of the University of South Alabama. Kidneys were homogenized on ice in 100 mM Tris-HCl (pH 7.8), 250 mM sucrose, 1 mM EDTA by using a Potter–Elvehjem Teflon pestle homogenizer. Crude homogenates were centrifuged at 1000 × g at 4 °C for 10 min. Supernatants were collected and centrifuged at 10,000 × g at 4 °C for 20 min. Microsomal proteins were pelleted by centrifugation of supernatants at 100,000 × g at 4 °C for 60 min. Pellets were resuspended in the same buffer and homogenized by hand in a Dounce B glass homogenizer. Homogenate was centrifuged once more at 100,000 × g at 4 °C for 60 min. Resulting washed pellets were resuspended in the same buffer containing 50 μl/ml protease inhibitor cocktail and protein concentration determined.

Assessment of 11β-HSD2 activity in kidney microsomes.

Determination of 11β-HSD2 activity was performed by using a thin-layer chromatography-based enzyme assay.^23,28,33,35 Kidney microsomal protein was prepared from each species as described. Reactions were carried out by incubating for 15 min at 37 °C equal amounts of microsomal protein with 90 nM cortisol (containing 0.25 μCi [1,2,6,7-³H]-cortisol, GE Healthcare UK Limited) and 1 mM NAD in the presence or absence of 100 μM of the 11β-HSD inhibitor CBX, which was included to account for nonspecific substrate conversion. Reactions were stopped by addition of 4 volumes of dichloromethane, and steroids were extracted twice. Unlabeled cortisol and cortisone markers were added to samples. Samples were evaporated to dryness, resuspended in chloroform, and fractionated by thin-layer chromatography on silica-GF plates. Spots containing cortisol or cortisone were visualized on dried plates under UV light and were scraped into vials containing scintillation cocktail, and the radioactivity in each sample was determined. For each reaction, percentage substrate conversion to cortisone was calculated by dividing counts per minute in the cortisone (product) fraction by total counts per minute.^15.23.28 In some experiments, conversion that occurred in the presence of the 11β-HSD2 inhibitor CBX was subtracted to account for non-11β-HSD2-catalyzed substrate conversion. Each reaction was performed in duplicate, and assays were repeated with microsomes prepared from kidneys from at least 3 different animals of each genus.

Western blot analysis.

For Western blot analysis, samples were diluted in 6 × concentrated Laemmli sample buffer²² and separated by SDS-PAGE, and fractionated proteins transferred to a nitrocellulose membrane. The membranes were incubated in Tris-buffered saline (pH 7.4), containing 0.4% nonfat milk (blocking buffer), for 1 h at room temperature, washed in Tris-buffered saline, and incubated overnight at 4 °C in Tris-buffered saline containing 0.1% Tween 20 and primary antibody. Membranes were washed in Tris-buffered saline containing 0.1% Tween 20, incubated 1 h at room temperature with alkaline-phosphatase–conjugated secondary antibody, and developed by using the Immun-Star Chemiluminescent Protein Detection System (Bio-Rad) according to the manufacturer's instructions.

Cloning of squirrel monkey 11β-HSD2 cDNA.

Total RNA was isolated with RNA Stat-60 (Tel-Test B) from a kidney obtained at necropsy from an adult, female Guyanese squirrel monkey (Saimiri sciureus, number 454). This animal had no evidence of renal disease. Two cDNA fragments of the squirrel monkey 11β-HSD2 were generated by RT-PCR by using primers AGC CCG CTG GGC CGC CAT G (sense, corresponding to nucleotides 101 through 119) and CGT AGG CCT GCA GCA GCT CT (antisense, corresponding to nucleotides 1002 through 983) and primers TTG GCA AGG AGA CGG CCA AGA (sense, corresponding to nucleotides 809 through 929) and GCC ATA GGT GCA CAT GGC TCA (antisense, corresponding to nucleotides 1352 through 1332) in the human 11β-HSD2 cDNA (GenBank accession number NM_000196.3). RT-PCR was performed by using the OneStep RT-PCR kit (Qiagen). The products of the first 2 reactions were then used as templates to generate the full-length squirrel monkey 11β-HSD2 cDNA by PCR using primers TCATGGAG CACTGGCTTTGGC (sense) and AGATCACTGAGCCACTGCTGG (antisense; start and stop codons, respectively, are underlined). The full-length PCR product was cloned into pCR2.1 TA cloning vector (Invitrogen Corp., Carlsbad, CA). The cDNA was subcloned into pCIneo mammalian expression vector (Promega Corp, Madison, WI) by using EcoRI sites, and correct clone (sm11β-HSD2-pCIneo) selected by restriction digest screening and sequencing of full-length insert. The full-length cDNA sequence of squirrel monkey 11β-HSD2 has been entered into GenBank (accession number, DQ784114.1).

Cell culture.

African green monkey COS-7 cells were grown as monolayers in DMEM, supplemented with 10% FBS, 50 U/ml penicillin G, and 0.05 mg/ml streptomycin. All cells were cultured at 37 °C in a humidified atmosphere of 5% CO₂/95% air.

Comparison of human and squirrel monkey 11-β-HSD2 activities.

The effect of expression of either human or squirrel monkey 11β-HSD2 on the cortisol-induced transcriptional activation of MR was compared by luciferase reporter assay.^3,6,31 COS7 cells were plated in 35-mm, 6-well tissue culture dishes at a density of 6 × 10⁵ cells/well in DMEM supplemented with 10% charcoal-dextran-treated fetal bovine serum (Hyclone Laboratories, Logan, UT) and antibiotics and incubated overnight. Cells were transiently transfected with MMTV-luciferase reporter plasmid (2.0 μg/well) and a plasmid encoding MR (1.5 μg/well), in addition to 0.5 μg/well of pCIneo (vector control), human 11β-HSD2-pCIneo, or squirrel monkey 11β-HSD2-pCIneo using Superfect reagent. After 24 h, cells were incubated 4 h with medium containing either 100 μM CBX or vehicle control. Medium then was replaced with medium containing CBX or vehicle control plus 0 to 100 nM cortisol. After an additional 24 h, cells were lysed and assayed for luciferase activity. Similar protein levels of 11β-HSD2 from each genus were confirmed by Western blot analysis.

Statistical Analysis.

Data were analyzed using 1-way analysis of variance followed by Tukey–Kramer posthoc tests. Data analysis was conducted by using GraphPad Prism (GraphPad Software, San Diego, CA). Differences between groups were considered significant if the P value was less than 0.05.

Results

11β-HSD2 activity in squirrel monkey kidney.

We previously have shown that the serum cortisol-to-cortisone ratio in squirrel monkeys is lower than that in humans,²⁹ suggesting that 11β-HSD2 is upregulated in squirrel monkeys. We recently confirmed these data in a new cohort of squirrel monkeys in serum collected in January by using the previously described method.²⁹ Serum cortisol and cortisone levels in unanesthetized adult male squirrel monkeys were 144.5 ± 7.4 μg/dl and 88.8 ± 7.9 μg/dl, respectively, to yield a cortisol:cortisone ratio of 1.7 ± 0.1 (mean ± SEM, n=6, human serum cortisol:cortisone ratio, 3 to 7).²⁰ To provide additional support for the hypothesis that squirrel monkeys exhibit an increased capacity for cortisol-to-cortisone conversion, relative activity levels of 11β-HSD2 from the squirrel monkey kidney microsomal fraction were compared with those in other mammals. First, squirrel monkey kidney microsomal proteins were assayed for detection of 11β-HSD2 activity (Figure 1 A). [³H]-cortisol was incubated with either no protein or 25 μg/ml microsomal protein in the presence or absence of NAD. Negligible product (cortisone) formation was detected in the absence of microsomal protein or in the presence of microsomal protein but without cofactor. When NAD was included in reactions containing microsomal protein, greater than 30% substrate conversion occurred. Addition of the 11β-HSD inhibitor CBX completely blocked this activity. Altogether, these data show that squirrel monkey kidney microsomes contain NAD-dependent, CBX-inhibitable enzymatic activity that converts cortisol to cortisone, indicative of 11β-HSD2 activity.

Figure 1.

11β-HSD2 activity in squirrel monkey kidney microsomes. (A) Squirrel monkey kidney microsomal protein (SM, 25 μg/ml) was incubated with 90 nM cortisol (containing 0.25 μCi [³H]-cortisol) in the presence or absence of 1 mM NAD⁺ and 100 μM CBX. Data are expressed as percent substrate conversion (mean ± SEM). SM indicates that squirrel monkey microsomal protein was included in the reaction. (B) Equal amounts (25 μg/ml) of microsomal protein from rabbit, pig, and squirrel monkey kidney were assayed as in (A). Data are graphed as percentage conversion. Each reaction was performed in duplicate, and assays were repeated with microsomes prepared from kidney from at least 3 animals from each species. *, P < 0.05 compared with values for pig and rabbit.

The next objective was to determine whether squirrel monkey kidney microsomal proteins contain more 11β-HSD2 activity than that in kidney microsomes from other mammals. 11β-HSD2 activity in kidney microsomes from squirrel monkey was compared with that in microsomes prepared from pig and rabbit kidney (Figure 1 B). Pig and rabbit were selected as mammalian controls because (1) 11β-HSD2 K_m values for cortisol or corticosterone are in range with that reported for human 11β-HSD2^1,23,25,33 and (2) serum cortisol and cortisone levels similar to human values.^17,19,20,24 If kidney 11β-HSD2 in squirrel monkey has a greater capacity for inactivation of cortisol than do the enzymes in other mammalian species, a higher percentage of cortisol would be converted to cortisone by squirrel monkey kidney microsomes than by those from other species when equal amounts of microsomal protein are assayed. Equal amounts of kidney microsomal protein were incubated with [³H]-cortisol and NAD in the presence or absence of CBX. Percentage substrate conversion was calculated, and nonspecific conversion that occurred in the presence of CBX was subtracted to generate NAD-dependent, CBX-inhibitable percentage conversion. The results of these experiments show that NAD-dependent conversion of cortisol to cortisone by squirrel monkey kidney microsomal protein (32.2%) is approximately 3 to 7 times greater than conversion by the same amount of microsomal protein from the other species. These data indicate that squirrel monkey kidney microsomes have a greater capacity for conversion of cortisol to cortisone than do those from rabbit or pig.

Level of 11β-HSD2 protein in squirrel monkey kidney.

Increased capacity for inactivation of cortisol could be due to increased 11β-HSD2 protein levels, increased inherent activity of the squirrel monkey enzyme, or a combination of both. We sought to determine whether the increased capacity for inactivation of cortisol is due to increased levels of the enzyme. The relative levels of 11β-HSD2 protein in equal amounts of kidney microsomal protein from pig, rabbit, and squirrel monkey were compared by Western blot analysis. In these experiments, noticeably more 11β-HSD2 protein was detected in squirrel monkey microsomes than those from pig or rabbit (Figure 2 A). This observation was confirmed by using a second polyclonal antibody to 11β-HSD2 obtained commercially (data not shown) and was consistent for comparison of microsomes prepared from at least 3 animals of each genus. Densitometric analysis was performed to compare 11β-HSD2 levels detected in 3 representative blots (Figure 2 B). For each species, intensity of 11β-HSD2 band was normalized to that of the loading control. Comparison of band intensities by this method reveals that 11β-HSD2 protein is present in squirrel monkey kidney microsomes at levels approximately 4 to 9 fold times that in rabbit or pig kidney microsomes, suggesting the higher level of 11β-HSD2 activity in squirrel monkey kidney microsomes is at least partly due to increased production of 11β-HSD2 protein.

Figure 2.

Western blot analysis of 11β-HSD2 protein in microsomes from pig, rabbit, or squirrel monkey kidney. (A) Microsomes were prepared from pig (lane 1), rabbit (lane 2), or squirrel monkey (lane 3) kidney, and protein concentration assessed by Bradford analysis. Then 25 μg of microsomal protein from each species was fractionated by SDS-PAGE, and relative levels of 11β-HSD2 protein in each species were assessed by Western blot. Heat shock protein 90 (Hsp90) was used as a loading control. (B) Densitometric analysis of 11β-HSD2 protein detected in 3 Western blot analyses (mean ± SEM). Intensity of 11β-HSD2 band is normalized to that of the Hsp90 loading control for each species. *, P < 0.05, compared with values for pig and rabbit.

Comparison of activities of squirrel monkey and human 11β-HSD2.

Having shown increased 11β-HSD2 production, we also were interested in whether the squirrel monkey protein exhibits intrinsic differences from 11β-HSD2 from other mammals, particularly human. First, we cloned the squirrel monkey enzyme from kidney RNA and compared the deduced amino acid sequence with the known sequence for human 11β-HSD2 (Figure 3). Overall, squirrel monkey 11β-HSD2 exhibits 94% amino acid sequence similarity and 90% identity with the human enzyme. However, 54% of the amino acid differences between the human and squirrel monkey proteins result in a change in charge or polarity, potentially significantly altering the structure or activity of the enzyme.

Figure 3.

Comparison of the amino acid sequence of 11β-HSD2 from squirrel monkey, human, rabbit, and pig. Squirrel monkey 11β-HSD2 sequence was deduced from the nucleotide sequence (GenBank accession number, DQ784114.1). Human (AAA91969), rabbit (P51976), and pig (NP_999078.1) 11β-HSD2 sequences were obtained from GenBank. Domains corresponding to the transmembrane domain (TMD), cofactor-binding domain (CBD), and the active site (_*) of human 11β-HSD2 are indicated by boxes. Identical amino acids are indicated with a hyphen; asterisks within the sequence indicate gaps.

To compare the relative activities of 11β-HSD2 from each genus, the inhibitory effects of human and squirrel monkey 11β-HSD2 on cortisol-induced MR transcriptional activity were measured. Similar assays have been used previously to investigate the effect of changes in 11β-HSD2 activity on MR activation by corticosteroids.^6,31 In this assay, cells that have no endogenous 11β-HSD2 are cotransfected with a luciferase reporter plasmid and a plasmid encoding MR. Treatment of cells with cortisol induces MR transcriptional activity, detected as increased production of the reporter gene product (luciferase). When 11β-HSD2 is coexpressed in these cells, the MR transcriptional response to a given dose of cortisol is decreased due to inactivation of cortisol within the cell by 11β-HSD2.

COS7 cells transiently cotransfected with a luciferase reporter plasmid, a plasmid encoding MR, and either pCIneo (vector control), human 11β-HSD2-pCIneo, or squirrel monkey 11β-HSD2-pCIneo were treated with cortisol. Luciferase activity in cell lysates from each treatment group was analyzed (Figure 4 A). Similar expression of 11β-HSD2 from each genus was confirmed by Western blot (Figure 4 B). MR exhibited a dose-dependent increase in transcriptional activity in response to cortisol (Figure 4 A). Treatment with CBX had no effect on the MR transcriptional response to cortisol, indicating that COS7 cells have no endogenous 11β-HSD activity. Expression of human 11β-HSD2 decreased the cortisol-induced MR activation at each concentration of cortisol assayed. Squirrel monkey 11β-HSD2 results in a similar reduction in cortisol efficacy as does human 11β-HSD2. These data suggest that the intrinsic activity of squirrel monkey 11β-HSD2 is similar to that of the human enzyme in regard to inactivation of cortisol.

Figure 4.

Inhibition of MR transactivation response to cortisol by overexpression of human or squirrel monkey 11β-HSD2. (A) COS7 cells transiently cotransfected with a luciferase reporter plasmid, a plasmid encoding MR, and pCIneo vector control (control), human 11β-HSD2-pCIneo (hHSD2), or squirrel monkey 11β-HSD2-pCIneo (smHSD2). Transfected cells were treated overnight with the indicated concentration of cortisol in the absence or presence of 100 μM CBX and collected for assay of luciferase activity. Data are graphed as relative luciferase units (RLU). (B) Cell lysates from each transfected set were pooled and Western blot analysis performed for MR and 11β-HSD2. Hsp90 was used as a loading control. Lysates are from COS7 cells transfected with MR and pCIneo (lane 1), human 11β-HSD2-pCIneo (lane 2), or squirrel monkey 11β-HSD2-pCIneo (lane 3).

Discussion

The goal of this study was to determine whether upregulation of 11β-HSD2 in squirrel monkeys could provide a mechanism for protection of MR from activation by the extremely high serum cortisol levels seen in these animals. Our results suggest that squirrel monkeys have an increased capacity for inactivation of cortisol to cortisone relative to that of other mammals and that this increase likely is mediated through increased 11β-HSD2 protein levels in the kidney. This conclusion is supported by (1) in vivo data confirming that the serum cortisol to cortisone ratio in squirrel monkeys is maintained below the normal range for humans despite high cortisol levels; (2) in vitro data showing that squirrel monkey kidney microsomes exhibit 3 to 7 times more NAD-dependent cortisol-to-cortisone conversion than do those of other mammalian genera; and (3) Western blot analysis showing that 4 to 9 times more 11β-HSD2 protein is present in kidney microsomes from squirrel monkey than in those from pig and rabbit.

We also compared the amino acid sequences and activities of the squirrel monkey and human 11β-HSD2 proteins. Although amino acid differences were present throughout the 2 proteins, none occurred in functionally important domains—no amino acid changes occur in the cofactor binding domain or in the active site.³² In addition, charged residues within and proximal to the cofactor binding domain that have been identified as determinants of cofactor selectivity for human 11β-HSD2 were not different in the squirrel monkey protein.⁴ Comparison of the ability of 11β-HSD2 from human or squirrel monkey to decrease the MR response to cortisol showed that squirrel monkey 11β-HSD2 does not have greater intrinsic activity for inactivation of cortisol than the human enzyme. Altogether, these data support the hypothesis that a mechanism whereby squirrel monkeys avoid the mineralocorticoid effects of cortisol in the kidney is through increased cortisol to cortisone conversion by increasing 11β-HSD2 production without a change in the intrinsic activity of the enzyme.

The mechanisms by which 11β-HSD2 levels are increased in squirrel monkeys were not investigated here. However, several candidates that increase 11β-HSD2 production in humans and other mammals have been identified and could be important in squirrel monkeys. For example, activation of MR induces 11β-HSD2 expression.^2,13 Therefore, cortisol signaling through the MR could be a mechanism for increasing 11β-HSD2 protein in the presence of the high cortisol concentrations in squirrel monkeys. Another mechanism for regulation of HSD11B2 expression is through regulation of the methylation status of the HSD11B2 promoter. The promoter of HSD11B2 is highly methylated in cells or tissues in which the gene expression is low (for example, liver or renal proximal tubules), but the HSD11B2 promotor is largely unmethylated in tissues with high expression levels (for example, placenta or distal tubules).³ Therefore, decreased methylation of the squirrel monkey promoter relative to the promoter of the human gene could provide the mechanism for tissue-specific increased expression of the enzyme in squirrel monkeys.

Despite the observations that 11β-HSD2 protein level and activity are increased in squirrel monkey kidney microsomes relative to those in other mammals, the 3- to 7-fold difference in activity is not large enough to account for the approximately 100-fold greater serum cortisone levels seen in squirrel monkey compared with humans (serum cortisone, 0.8 to 2.7 μg/dl).²⁰ There are multiple potential explanations for this discrepancy. First, the kidney might not be the major source of cortisone in squirrel monkeys as it is in humans.⁴⁰ Increased production of 11β-HSD2 in squirrel monkeys in a highly perfused tissue that in other organisms does not express the enzyme could significantly increase the total serum cortisone levels. For example, 11β-HSD2 expression in classic glucocorticoid target tissues, such as the liver, could increase serum cortisone levels while contributing to the natural glucocorticoid resistance in these animals. A second potential explanation is that the reaction direction of 11β-HSD1 is reversed in certain tissues and thus contributes to cortisone production rather than cortisone metabolism. 11β-HSD1 is produced at high levels in the liver of other mammals, where it primarily converts cortisone to cortisol. However, this enzyme is intrinsically bidirectional, with cofactor availability regulating directionality, and the activity can be ‘switched’ during development by changes in expression or activity of NADPH-generating enzymes that drive the generation of cortisol by this enzyme.³⁷ Therefore, reduced levels or activities of NADPH-generating enzymes, such as hexose-6-phosphate dehydrogenase, in squirrel monkeys could provide an 11β-HSD1-independent source of cortisone in vivo.

In light of the results of this study, increased production of 11β-HSD2 is a mechanism by which the MR in squirrel monkeys is protected from activation in the presence of naturally high cortisol levels. However, other mechanisms also could contribute protections of the MR in these animals. First, in animals with such high circulating cortisol concentrations, additional metabolic pathways for inactivation of cortisol also may be upregulated. Indeed, our previously reported data show that 6β-hydroxycortisol is a major urinary metabolite in squirrel monkeys, suggesting that 6β-hydroxylase activity is upregulated.²⁹ Currently, whether this or other pathways of cortisol metabolism are upregulated in aldosterone target cells of the kidney, where they might contribute additional protection to MR from activation by cortisol in these animals, is unknown. Second, although the squirrel monkey MR exhibits similar cortisol responsiveness to that of the human MR when expressed in a heterologous cell system,²⁹ the cortisol response of the squirrel monkey MR may be diminished by other factors within the endogenous cellular environment. For example, heterodimerization of the MR with the glucocorticoid receptor results in altered transcriptional activity in response to cortisol relative to MR homodimers.¹¹ Further studies are needed to determine whether additional protection of the MR from activation by cortisol is conferred by these or other mechanisms in squirrel monkeys.

Altogether, these data indicate that squirrel monkeys avoid the mineralcorticoid effects of cortisol through increased capacity for the conversion of cortisol to cortisone. In addition, this effect apparently is mediated by increased protein levels of 11β-HSD2. Also, these data suggest that intrinsic differences in the squirrel monkey 11β-HSD2 protein do not contribute to enhanced protection of the MR from the high levels of cortisol in these animals.