Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2009 Mar 19;150(7):3376–3382. doi: 10.1210/en.2009-0071

Hypermethylation of Homeobox A10 by in Utero Diethylstilbestrol Exposure: An Epigenetic Mechanism for Altered Developmental Programming

Jason G Bromer 1,a, Jie Wu 1,a, Yuping Zhou 1, Hugh S Taylor 1
PMCID: PMC2703508  PMID: 19299448

Abstract

Diethylstilbestrol (DES) is a nonsteroidal estrogen that induces developmental anomalies of the female reproductive tract. The homeobox gene HOXA10 controls uterine organogenesis, and its expression is altered after in utero DES exposure. We hypothesized that an epigenetic mechanism underlies DES-mediated alterations in HOXA10 expression. We analyzed the expression pattern and methylation profile of HOXA10 after DES exposure. Expression of HOXA10 is increased in human endometrial cells after DES exposure, whereas Hoxa10 expression is repressed and shifted caudally from its normal location in mice exposed in utero. Cytosine guanine dinucleotide methylation frequency in the Hoxa10 intron was higher in DES-exposed offspring compared with controls (P = 0.017). The methylation level of Hoxa10 was also higher in the caudal portion of the uterus after DES exposure at the promoter and intron (P < 0.01). These changes were accompanied by increased expression of DNA methyltransferases 1 and 3b. No changes in methylation were observed after in vitro or adult DES exposure. DES has a dual mechanism of action as an endocrine disruptor; DES functions as a classical estrogen and directly stimulates HOXA10 expression with short-term exposure, however, in utero exposure results in hypermethylation of the HOXA10 gene and long-term altered HOXA10 expression. We identify hypermethylation as a novel mechanism of DES-induced altered developmental programming.

We identify hypermethylation as a novel mechanism of diethylstilbestrol induced altered developmental programming.

The term “endocrine disrupting chemicals” (EDCs) has been coined to describe numerous compounds found in the environment possessing hormone-like activity. Humans are widely exposed to these EDCs, which have been implicated in the disruption of normal developmental processes (1). More specifically, exposure to estrogenic EDCs during critical stages of differentiation can interfere with the hormonal signaling necessary for normal development and can also result in persistently altered gene expression.

One example of an estrogenic EDC is diethylstilbestrol (DES), a nonsteroidal synthetic estrogen that is a known teratogen and carcinogen. Between the 1940s and 1960s, millions of women were treated with DES during pregnancy with the goal of preventing miscarriage. However, a correlation between DES exposure in mothers and the occurrence of adenocarcinoma of the vagina in their daughters was reported in 1971 (2). Subsequently, it was demonstrated that women exposed to DES in utero had a high incidence of anatomical abnormalities of the genital tract that adversely affected their reproductive capacity (3,4). Although there is evidence that the initiating events in this carcinogenic and teratogenic activity involve changes in gene expression, the molecular mechanism by which transient in utero DES exposure results in permanent reproductive tract anomalies and cancers remains elusive (5,6,7).

Targets for DES action in the female reproductive tract include members of the homeobox (HOX) gene family. HOX genes were first recognized as an evolutionarily conserved family of transcription factors regulating development. HOX genes direct the development of the reproductive tract from the undifferentiated müllerian and wolffian ducts (8,9,10,11). One member of the HOX gene family, HOXA10, directs embryonic uterine development and is also dynamically expressed in adult endometrium, where it is necessary for embryo implantation (12,13).

In humans, HOXA10 is expressed in uterine epithelial and stromal cells, and its expression is regulated by sex steroids. Disturbances in the normal endocrine regulation of HOX genes are a purported mechanism of estrogenic endocrine disruption. We and others have previously demonstrated that exposure to DES alters HOX gene expression in the female reproductive tract (3,14,15). HOXA10 is a target of endocrine disruption by DES both in mice and in human cell lines. DES treatment in mice also leads to changes in the expression pattern of Hox genes, which are associated with structural abnormalities in the reproductive tracts (8,9,10,11,12,13,14).

Although it is tempting to speculate that DES-mediated alterations in HOXA10 gene expression are simply a result of the estrogen-agonist activity of DES, in utero exposure to DES results in lasting changes in gene expression, persisting well after the exposure. Furthermore, the permanent defects in gene expression do not necessarily coincide with the direction or spatial localization of altered expression at acute exposure. Classical endocrine regulation of gene expression does not account for these epigenetic effects.

Models of DES-related neoplasia follow the initiation-promotion paradigm typical of carcinogenesis (16). However, the molecular mechanism by which developmental DES exposure results in permanent reproductive tract anomalies and a predisposition to cancers remains unclear. Recently, aberrant DNA methylation of cytosine guanine dinucleotide (CpG) islands has emerged as an important epigenetic mechanism resulting in long-term changes in gene expression (17,18,19,20,21,22,23). Increased methylation typically leads to down-regulation or silencing of the target gene. In mammals, DNA methylation is mediated by three DNA methyltransferases (DNMTs): DNMT1, DNMT3a, and DNMT3b (24).

Changes in gene methylation are frequently seen in tumor cells. In endometrial carcinomas, HOXA10 expression is significantly decreased, and this decrease is associated with methylation of the HOXA10 promoter (25). Aberrant methylation of HOXA10 is also associated with lower expression of this gene in the endometrium of women with endometriosis (26,27). However, no one has described a mechanism by which these alterations in methylation occur. We hypothesized that the permanent epigenetic effects seen with in utero exposure to DES are mediated through aberrant methylation of the HOXA10 gene. To evaluate this mechanism, we analyzed the DNA methylation status of the HOXA10 gene, as well as the expression of the DNMTs after DES exposure in utero, and in vitro. We describe a molecular mechanism by which endocrine disruptor exposure can result in epigenetic alterations; these changes in gene expression in turn may provide a molecular basis for DES-related reproductive anomalies.

Materials and Methods

Animals

CD-1 mice were obtained from Charles River Laboratories (Wilmington, MA). The mice were housed in standard polypropylene cages in a temperature-controlled room (22 C) with a 14-h light, 10-h dark cycle. Food (Purina Chow; Purina Mills, Richmond, IN) and water were provided ad libitum. Eight-week-old CD-1 female mice were bred to male mice of the same strain. Detection of a vaginal plug was considered d 0 of pregnancy. Pregnant mice were then housed individually and treated with ip injection of DES (Sigma Chemical Co., St. Louis, MO) in sesame oil at a dose of 10 μg/kg maternal body weight on d 9–16 gestation. Controls received sesame oil alone. All experiments were conducted in accordance with the Yale University Animal Care Committee Guidelines.

Female offspring exposed in utero were euthanized by cervical dislocation under CO2 inhaled anesthesia at 2 or 6 wk after birth. Uteri were removed, and one horn was fixed in 4% formalin and embedded in paraffin for histological and immunohistochemical analysis. DNA and RNA were isolated from either the cranial or caudal half of the individual contralateral horns using the DNeasy and RNeasy Mini Kits, respectively (QIAGEN, Inc., Valencia, CA), according to the manufacturer’s protocol.

Cell culture

Human endometrial stromal cells (HESCs) were maintained in a phenol red-free DMEM (Sigma Chemical), containing 10% (vol/vol) charcoal-stripped calf serum and supplemented with 1% penicillin/streptomycin, and 1% sodium pyruvate. Ishikawa cells were maintained in a phenol red-free MEM (Sigma Chemical), containing 10% (vol/vol) charcoal-stripped calf serum and supplemented with 1% penicillin/streptomycin, and 1% sodium pyruvate. Confluent monolayers were harvested by trypsinization, seeded in a six-well plate, and maintained in serum-free media for 24 h. The cells were subsequently treated with DES (5 × 10−8 m) or dimethyl sulfoxide (control) for 24 h. DNA and RNA were isolated from the HESCs and Ishikawa cells using the DNeasy and RNeasy Mini Kit, according to the manufacturer’s protocol. DNA and RNA samples were stored at −80 C until use.

Bisulfite modification and methylation-specific PCR (MSP)

One microgram of genomic DNA, isolated from either cultured cells or mice uteri, was treated with sodium bisulfite using the CpGenome DNA Modification Kit (Upstate, Charlottesville, VA). This process converts unmethylated cytosine residues to uracil, whereas methylated cytosines remain unchanged. Bisulfite-modified samples were aliquoted and stored at −80 C. A total of 200 ng sodium bisulfite-treated DNA was then analyzed using primer sets directed to the 5′ promoter and intron-1 regions of the bisulfite-modified Hoxa10 gene sequence (Fig. 1). These regions contain multiple CpG islands, and alterations in methylation in this region have had HOXA10 regulatory capabilities (24,27). DNA from CpG methylated mouse genomic DNA (New England BioLabs, Ipswich, MA) was used as a positive control for methylated alleles. Unmethylated mouse genomic DNA (New England BioLabs) was used as a negative control for methylated genes.

Figure 1.

Figure 1

Open in a new tab

Target sequences of the HOXA10 gene in the 5′ promoter and intron. A, Mouse promoter region containing 19 CpG sites. B, Mouse intronic region containing eight CpG sites. C, Human promoter region containing 23 CpG sites. D, Human intronic region containing 20 CpG sites. All sequences are 5′ to 3′.

PCR amplification of 5 μl bisulfite-treated DNA template was performed in a 50-μl reaction containing 1.5 μl forward and reverse primers, 1.25 mmol/liter deoxynucleotide triphosphates, 25 mm Mg2+, and 0.5 μl HotStarTaq DNA polymerase (QIAGEN). All primers were synthesized by the Department of Pathology, Yale University School of Medicine. The primer sets are listed in Table 1. Amplification conditions were as follows: 15 min starting at 95 C; 35 cycles at 95 C for 30 sec; 59 C (methylated) or 53 C (unmethylated) for 30 sec; and 72 C for 30 sec, followed by a final extension at 72 C for 10 min. PCR products were resolved by electrophoresis on a 2% agarose gel and stained with ethidium bromide.

Table 1.

Primer sequences for MSP and BSP

Sense primer (5′→3′) Antisense primer (5′→3′)
A U: TTTGAGGTAGTTTTTATAGTTTTGG U: TCTTATACAAAACATACTAAATACAA
M: TTTGAGGTAGTTTTTATAGTTTCGG M: TCTTATACAAAACATACTAAATACGA
B U: TTGGGGGATGAGAATATTAGTG U: ACACATAAAAAATCATAAACTCAAA
M: TTGGGGGATGAGAATATTAGCG M: ACGCATAAAAAATCGTAAACTCG
C U: TTTTTATAGTTTTTGGTTTTTGG U: CACTCCCAATTTAATTTCATAAACAC
M: GTTTTTATAGTTTTCGGTTTTCGG M: ACTCCCAATTTAATTTCGTAAACG
D U: AAGTTTATTAATTGGTGAAGTTTGA U: CCAATAAAAAAAACAAAAAAAACCA
M: ATAAGTTTATTAATCGGCGAAGTTC M: AATAAAAAAAACAAAAAAAACCGAT
E TATTTTGAGGTAGTTTTTATAGTTT CAAATAACCCTTTCTAACTAACATTTC
F TAAAAGGAGGGAGGGTATAATT ATTCTAAAACCAAATTTTCACTTATC
Open in a new tab

PCR primers used for each MSP and BSP reaction are shown. A and B are mouse primers for promoter and intronic regions, respectively. C and D are human primers for promoter and intronic regions, respectively. E and F are BSP primer sets for mouse promoter and intronic regions, respectively. M, Methylated allele; U, unmethylated allele. 

Bisulfite-sequencing PCR (BSP)

Quantification of methylation at the 5′ promoter and intron-1 regions in the mouse was investigated via BSP. A total of 200 ng bisulfite-treated DNA was used in a 50-μl reaction containing 1.5 μl forward and reverse primers, 1.25 mmol/liter deoxynucleotide triphosphates, 25 mm Mg2+, and 0.5 μl HotStarTaq DNA polymerase. Amplification conditions were as follows: 15 min starting at 95 C; 35 cycles at 95 C for 30 sec; 53 C for 30 sec; and 72 C for 30 sec, followed by a final extension at 72 C for 10 min. PCR products were resolved by electrophoresis on a 2% agarose gel and stained with ethidium bromide. The appropriate-sized product bands were then isolated and excised from the gel, and purified using the QIAQuick Gen Extraction Kit (QIAGEN), according to the manufacturer’s protocol. The resultant products were then sequenced using the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA). For each CpG site, a “C” was interpreted as a methylated site, whereas a “T” was interpreted as an umethylated (and, thus, bisulfite-modified) site.

Immunohistochemistry

Immunohistochemical analysis of Hoxa10 expression was performed as previously described (27,28). Briefly, slides were deparaffinized and dehydrated through a serious of xylene and ethanol washes, followed by permeabilization in 95% cold ethanol. After a 5-min rinse in distilled water, slides were steamed in 0.01 m sodium citrate buffer for 20 min and cooled for 20 min. Slides were rinsed for 5 min in PBS with 0.1% Tween 20 (PBST), and sections were circumscribed with a hydrophobic pen. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 5 min, followed by a 5-min PBST wash. Nonspecific binding was blocked with 1.5% normal horse serum in PBST for 1 h at room temperature. The primary Hoxa10 antibody (sc-17159) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Slides were incubated in the primary antibody overnight at 4 C. Normal goat IgG (Santa Cruz Biotechnology) was used as a negative control. Horse α-goat biotinylated secondary antibody was purchased from Vector Laboratories (Burlingame, CA) and applied for 1 h at 4 C. Slides were washed in 1 × PBST, incubated in ABC Elite (Vector Laboratories) for 15 min at room temperature, washed in 1 × PBST, and incubated for 5 min in diaminobenzidine (Vector Laboratories). A 20-sec exposure to hematoxylin was used as a counterstain. All slides were processed simultaneously. Slides were rehydrated through 3 min ethanol and xylene washes and mounted with Permount (Fisher Scientific, Fair Lawn, NJ).

Quantitative real-time RT-PCR

Quantitative real-time RT-PCR was performed using the LightCycler SYBR Green RT-PCR kit from Roche (Stockholm, Sweden). One microgram of total RNA was reverse transcribed in: 20 μl reaction mixture containing 10 mm each deoxy (d) ATP, dCTP, dGTP, and thymidine 5′-triphosphate; 20 pmol oligo(deoxythymidine); 40 U/μl ribonuclease inhibitor; 10 U/μl avian myeloblastosis virus-reverse transcriptase; and 10× avian myeloblastosis virus-reverse transcriptase buffer for 30 min at 61 C. PCR for HOXA10 was performed for 45 cycles of 95 C for 2 sec, 65 C for 5 sec, and 72 C for 18 sec. PCR for DNMT1, DNMT3a, DNMT3b, and for control β-actin was performed for 45 cycles of 95 C for 2 sec, 60 C for 5 sec, and 72 C for 18 sec.

The increasing fluorescence of PCR products during amplification was monitored, from which a quantitative standard curve was created. Quantitation of samples was determined with the Roche LightCycler and adjusted to the quantitative expression of β-actin from these same samples. Melting curve analysis was conducted to determine the specificity of the amplified products and to ensure the absence of primer-dimer formation. All products obtained yielded the predicted melting temperature.

Statistical analysis

Statistical analysis was done with the two-sided Fisher’s exact test for the comparison of DNA methylation frequencies of Hoxa10 gene between DES-treated and control mice. Differences in methylation levels of the Hoxa10 were examined by the two-sided Fisher exact test. The Student’s t test was used to compare the mean number of methylated sites for each region. P < 0.05 was considered statistically significant. The difference in Hoxa10 expression between two groups was calculated by the Student’s t test. The expression of Hoxa10 protein by immunohistochemistry was quantified by two evaluators blinded to the treatment group. An H score was determined separately for the glandular and stromal cells on each slide. Intensity of Hoxa10 nuclear staining was indicated by a value of one, two, or three (weak, moderate, or strong, respectively).

Results

DES exposure alters Hoxa10 gene expression in utero

To evaluate whether in utero DES exposure would produce alterations in Hoxa10 expression, mice were treated with DES or vehicle control, and the female pups were examined. Eight mice were examined in each group. Immunohistochemistry was performed on sections of the uteri from female offspring at 2 wk of age. At 2 wk the uteri obtained from vehicle-treated controls revealed the expected basal expression of Hoxa10 protein. However, the DES-treated mice demonstrated that peak Hoxa10 expression was shifted to the base of the uterus from its normal expression pattern throughout the uterus. Differential cranial-caudal HOXA10 expression was confirmed using real-time PCR (data not shown). Thus, exposure to DES in utero resulted in increased caudal expression of Hoxa10 compared with controls, and Hoxa10 immunostaining appeared reduced in the cranial area of the uterus (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Immunohistochemical analysis shows that DES exposure alters Hoxa10 expression in 2-wk-old female mice exposed in utero to DES. A, Location of cranial and caudal sections of the mouse uterus. B, Hoxa10 expression in the cranial and caudal sections of the uterus. DES-treated mice showed increased caudal expression and decreased cranial expression of Hoxa10 in the uterus compared with controls.

DES alters HOXA10 gene expression in cell culture

To develop a human cell model of adult uterine exposure, the effect of DES on HOXA10 expression was evaluated in HESCs and Ishikawa cells (28). Ishikawa cells are a well-differentiated human uterine adenocarcinoma line, and HESCs are a telomerase-immortalized human uterine stromal cell line in which HOX gene expression has been previously well characterized (28,29,30). Cells were treated with 5 × 10−8 m DES or control for 24 h. HOXA10 mRNA levels after treatment in HESCs and Ishikawa cells are demonstrated in Fig. 3. The expression of HOXA10 in HESCs was increased 3-fold after treatment with DES. A 7-fold increase in HOXA10 expression was seen in Ishikawa cells with DES treatment.

Figure 3.

Figure 3

Open in a new tab

DES induces HOXA10 expression in vitro. DES treatment resulted in a 3-fold increase in HOXA10 expression in HESCs. DES treatment resulted in a 7-fold increase in HOXA10 expression in Ishikawa cells. Results are representative of three independent experiments. *, P < 0.01.

Methylation of the Hoxa10 gene in mice after in utero DES exposure

We investigated whether the alteration of Hoxa10 expression toward the caudal portion of the uterus after DES treatment was correlated with changes in DNA methylation at these regions using MSP and BSP. Portions of the HOXA10 gene rich in CpG islands were identified in the promoter and intron regions (Fig. 1), and primer sets were designed to amplify these regions (Table 1). There were 15 mice from at least three separate litters in each group examined. The methylation frequencies of the Hoxa10 gene in 2-wk-old mice via MSP are shown in Table 2. We found that 100% (15 of 15) of DES-treated mice showed at least partial methylation of the promoter fragment, compared with 93.3% (14 of 15) of control mice (Fig. 4A). However, in the intronic fragment, we found that CpG island methylation frequency was significantly higher in the DES-treated group compared with the control group (100 vs. 60%; P = 0.0169) (Fig. 4B), suggesting that overall, DNA methylation was increased with in utero DES exposure.

Table 2.

Methylation frequencies for DES and control-treated mice

Promoter
Intron
Methylated Unmethylated Methylated Unmethylated
DES 15/15 (100%) 0/15 (0%) 15/15 (100%) 0/15 (0%)
Control 14/15 (93.3%) 1/15 (6.7%) 9/15 (60%) 6/15 (40%)
Open in a new tab

Methylation frequencies of the Hoxa10 gene in the 5′ promoter and intron in DES-treated mice compared with controls are shown. Values are expressed as number/total number (%). 

Figure 4.

Figure 4

Open in a new tab

MSP analysis of the Hoxa10/HOXA10 gene. Primer sets used for amplification are designated as unmethylated (U) or methylated (M). A, Representative samples from the promoter region in DES or control (CTL)-treated offspring. B, Representative samples from the intronic region in DES or control-treated offspring. C, Representative samples of DES or control-treated HESC and Ishikawa (ISHK) cell lines in the intronic region.

The quantitative difference in methylation levels of Hoxa10 in the cranial and caudal portions of 2-wk-old mice is shown in Fig. 5, demonstrating the extent of methylation in each portion of the uterus for both the promoter and intronic regions. In the cranial portion of the uterus, the amount of CpG methylation did not change in either region with DES treatment (0.8 fold, P = 0.17; and 2.0 fold, P = 0.18 for promoter and intron, respectively). However, in the caudal portion of the uterus, DES treatment was associated with significantly increased methylation in both regions (8.6 fold, P < 0.001; and 12 fold, P = 0.002, for promoter and intron, respectively).

Figure 5.

Figure 5

Open in a new tab

Methylation levels of the Hoxa10 gene of the promoter and intron in DES and control-treated mice. The methylation levels in DES-treated mice were significantly higher than those in control mice in the caudal portion of the uterus, including both the promoter and intron fragments (8.6 and 12 fold, respectively). *, P < 0.05; **, P < 0.01.

Methylation of the HOXA10 gene after in vitro DES exposure

To determine whether methylation after in utero developmental exposure differed from direct exposure of uterine cells, uterine cell lines were evaluated for HOXA10 methylation via MSP. In the promoter fragment, exclusively unmethylated DNA was detected in both control and DES-treated HESCs. In the intronic fragment, partial methylation was detected in both DES and control-treated Ishikawa cells (Fig. 4C). Similar results were found in HESCs. These results suggest that DES-mediated changes in HOXA10 in vitro are not related to changes in DNA methylation.

Methylation of the Hoxa10 gene after acute in vivo DES exposure

We also evaluated the acute effects of DES exposure in vivo through a single peritoneal injection of DES into an adult mouse and evaluation of the adult uterus 48 h later. In the cranial portion of the uterus, there was no change in DNA methylation in either region analyzed after DES treatment (P = 0.565 and P = 1.0 for promoter and intron, respectively). Similarly, in the caudal portion of the uterus, there was also no change in DNA methylation in either region (P = 1.0 for both regions).

Alteration in the expression of DNMTs after in utero DES exposure

We investigated whether changes in expression of DNMTs could account for the observed changes in DNA methylation. mRNA levels of DNMT1, DNMT3a, and DNMT3b from the uteri from 2 wk-old offspring exposed to DES in utero are demonstrated in Fig. 6. The expression of DNMT1 was increased 4-fold (P < 0.05), and DNMT3b was increased 3-fold (P < 0.05) after treatment with DES. Expression of DNMT3a was unchanged with treatment. There were no differences detected between the cranial and caudal portions of the uterus for expression of any of the DNMTs (data not shown).

Figure 6.

Figure 6

Open in a new tab

DES induces expression of DNMTs in utero. DES treatment resulted in a 4-fold increase in expression of DNMT1 and a 3-fold increase in expression of DNMT3b. Expression of DNMT3a was unchanged. Results are representative of three independent experiments. *, P < 0.05.

Discussion

Women exposed to DES in utero commonly demonstrate abnormalities of the reproductive tract (31). The frequency of müllerian abnormalities is related to the gestational age of exposure and the total dose of DES received (32,33). DES is widely used as a model for estrogenic endocrine disruption that continues to be a significant health concern. An association between clear cell adenocarcinoma of the vagina in women and in utero DES exposure has been clearly established, yet the mechanism by which DES leads to carcinogenesis is not understood (2). In addition, DES-mediated endocrine disruption during gestation results in developmental anomalies that persist into adulthood in both human and laboratory animals.

Hox genes comprise a highly evolutionarily conserved family of proteins, and they act as the principal regulators of tissue identity during development. They also play an essential role in defining multiple anterior-posterior axes in the developing embryo (34,35). Alterations in Hox gene expression are known to lead to anomalies in tissues that depend on their expression for proper developmental signaling (3). Thus, it is not surprising that the uterine anomalies seen after DES exposure are accompanied by a change in Hox expression. Specifically, the alterations seen in Hox gene expression after exposure to DES in utero result from a posterior or caudal shift from the normal pattern. The decreased levels of expression of Hoxa10 cranially may allow for the increased Hoxa9 expression that is demonstrated after DES exposure (3). This alteration of Hoxa10 expression by DES could provide a molecular mechanism by which DES produces reproductive tract anomalies (4,15).

DNA methylation has regulated a variety of aspects of cellular physiology, including growth and differentiation, through alterations in gene expression (36,37). Specifically, HOXA10 methylation has been associated with several human cancers (17,19,20,22,25,38). Yoshida et al. (25) found that down-regulation of HOXA10 expression in endometrial carcinomas is associated with methylation of the HOXA10 promoter. Wu et al. (24,27) reported that aberrant methylation at HOXA10 may be the cause of its lower expression in the endometrium of women with endometriosis (30). However, altered methylation in an essential developmental gene resulting in permanent reproductive tract anomalies has not been previously reported, nor has a mechanism responsible for these changes been described.

We investigated the frequency of DNA methylation of Hoxa10 upon in utero DES exposure, and have shown aberrant methylation in the promoter and intron of Hoxa10 and that this altered methylation also persisted into adulthood. Furthermore, we have also shown increased levels of mRNA expression of two important DNMTs, the enzymes responsible for DNA methylation. We speculate that the mechanism by which DNMT expression is up-regulated by DES is mediated by the estrogen receptor (ER). It has been recently been demonstrated that estrogens can alter the expression of at least one of the DNMTs (39). Furthermore, alterations in HOX gene expression in the uterus are not seen on ER knockout α-mice (40).

These findings suggest that hypermethylation of the Hoxa10 gene could be the mechanism responsible for the DES-altered developmental programming of the Hoxa10 gene and its associated anomalies. It has been previously reported that DES-induced down-regulation of Hoxa10 or Hoxa11 gene expression is not associated with methylation changes at the proximal promoter (41). However, we did find differences in levels of DNA methylation in both the promoter and the intron in the DES-treated group in the caudal portions of the uterus. It is possible that the changes in DNA methylation are only observed in the regions of the gene that we explored, which were further 5′ than those previously reported. Our methods of MSP and BSP may also have been more sensitive than those previously used.

We found that, spatially, changes in DNA methylation appeared to be confined to the caudal portion of the uterus. This finding was surprising because expression of Hoxa10 was found to be relatively increased in this portion of the uterus, and not decreased, as is typically seen with increased DNA methylation. We suspect that, rather than silencing gene activity altogether, the mechanism of this epigenetic alteration may be mediated through differential methylation of promoter binding sites for transcriptional repressors. For instance, the promoter sequence we investigated contains a binding site for Yin-Yang 1. Yin-Yang 1 is a zinc finger protein that classically functions as a repressor of Hox gene transcription (42,43).

At the same time, we found no significant changes in DNA methylation of HOXA10 in DES-treated HESCs or Ishikawa cells, and these changes were not accompanied by decreased HOXA10 expression. In fact, in vitro treatment with DES resulted in elevated levels of HOXA10 gene expression in these cells, similar to a previous report from our laboratory (44). Thus, the short-term increase in HOXA10 expression upon DES treatment is likely not related to changes in DNA methylation. Instead, this increase in expression is more likely mediated by the direct estrogen-agonist effect of DES on the ER because HOXA10 has been shown previously to both contain an estrogen response element, and to be regulated by estradiol (14,45). On the other hand, changes in DNA methylation may take longer to occur, or alternatively, may only occur during a critical developmental window. The absence of changes in DNA methylation after acute DES exposure in the adult uterus further supports this suggestion.

It has been shown previously that ER-α is necessary to obtain the DES phenotype (40) because ER-α knockout mice show none of the anatomical or gene expression changes related to chronic DES exposure in utero. The effect of DES is likely mediated through ER-α, given the loss of response in the knockout mouse.

In conclusion, we have shown that aberrant DNA methylation of the Hoxa10 gene is associated with changes in Hoxa10 expression after in utero DES exposure, This change in gene methylation provides a molecular mechanism through which DES results in altered developmental programming of the reproductive tract. With short-term exposure, DES appears to act as a classical estrogen, stimulating Hox gene expression; however, after longer exposure in utero, DES induces a permanent epigenetic effect on the expression of Hox genes through changes in DNA methylation. The mechanism of these changes in DNA methylation involves DES-mediated up-regulation of DNMTs. It has recently become clear that alterations in DNA methylation are associated with a variety of processes, including control of gene expression, change in chromatin structure, gene imprinting, and accompanying transcriptional silencing of affiliated genes (46,47,48). Thus, methylation-induced epigenetic changes play an important role in development (49). Because DES is a prototypical xenoestrogen, other EDCs may have similar epigenetic effects. Thus, DNA methylation is a novel mechanism by which endocrine disruptors may regulate developmental programming.

Acknowledgments

We thank Amy Tetrault for excellent technical assistance and Hongling Du for technical advice.

Footnotes

Disclosure Summary: The authors have nothing to disclose.

First Published Online March 19, 2009

Abbreviations: BSP, Bisulfite-sequencing PCR; CpG, cytosine guanine dinucleotide; DES, diethylstilbestrol; DNMT, DNA methyltransferase; EDC, endocrine disrupting chemical; ER, estrogen receptor; HESC, human endometrial stromal cell; HOX, homeobox; MSP, methylation-specific PCR; PBST, PBS with 0.1% Tween 20.

References

  1. Colborn T, vom Saal FS, Soto AM 1993 Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect 101:378–384 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Herbst AL, Ulfelder H, Poskanzer DC 1971 Adenocarcinoma of the vagina. Association of maternal stilbestrol therapy with tumor appearance in young women. N Engl J Med 284:878–881 [DOI] [PubMed] [Google Scholar]
  3. Block K, Kardana A, Igarashi P, Taylor HS 2000 In utero diethylstilbestrol (DES) exposure alters Hox gene expression in the developing müllerian system. FASEB J 14:1101–1108 [DOI] [PubMed] [Google Scholar]
  4. McLachlan JA, Newbold RR, Bullock BC 1980 Long-term effects on the female mouse genital tract associated with prenatal exposure to diethylstilbestrol. Cancer Res 40:3988–3999 [PubMed] [Google Scholar]
  5. Kaldas RS, Hughes Jr CL 1989 Reproductive and general metabolic effects of phytoestrogens in mammals. Reprod Toxicol 3:81–89 [DOI] [PubMed] [Google Scholar]
  6. Mably TA, Bjerke DL, Moore RW, Gendron-Fitzpatrick A, Peterson RE 1992 In utero and lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 3. Effects on spermatogenesis and reproductive capability. Toxicol Appl Pharmacol 114:118–126 [DOI] [PubMed] [Google Scholar]
  7. Walters LM, Rourke AW, Eroschenko VP 1993 Purified methoxychlor stimulates the reproductive tract in immature female mice. Reprod Toxicol 7:599–606 [DOI] [PubMed] [Google Scholar]
  8. Gendron RL, Paradis H, Hsieh-Li HM, Lee DW, Potter SS, Markoff E 1997 Abnormal uterine stromal and glandular function associated with maternal reproductive defects in Hoxa-11 null mice. Biol Reprod 56:1097–1105 [DOI] [PubMed] [Google Scholar]
  9. Hsieh-Li HM, Witte DP, Weinstein M, Branford W, Li H, Small K, Potter SS 1995 Hoxa 11 structure, extensive antisense transcription, and function in male and female fertility. Development 121:1373–1385 [DOI] [PubMed] [Google Scholar]
  10. Mortlock DP, Innis JW 1997 Mutation of HOXA13 in hand-foot-genital syndrome. Nat Genet 15:179–180 [DOI] [PubMed] [Google Scholar]
  11. Warot X, Fromental-Ramain C, Fraulob V, Chambon P, Dollé P 1997 Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development 124:4781–4791 [DOI] [PubMed] [Google Scholar]
  12. Benson GV, Lim H, Paria BC, Satokata I, Dey SK, Maas RL 1996 Mechanisms of reduced fertility in Hoxa-10 mutant mice: uterine homeosis and loss of maternal Hoxa-10 expression. Development 122:2687–2696 [DOI] [PubMed] [Google Scholar]
  13. Satokata I, Benson G, Maas R 1995 Sexually dimorphic sterility phenotypes in Hoxa10-deficient mice. Nature 374:460–463 [DOI] [PubMed] [Google Scholar]
  14. Akbas GE, Song J, Taylor HS 2004 A HOXA10 estrogen response element (ERE) is differentially regulated by 17 β-estradiol and diethylstilbestrol (DES). J Mol Biol 340:1013–1023 [DOI] [PubMed] [Google Scholar]
  15. Ma L, Benson GV, Lim H, Dey SK, Maas RL 1998 Abdominal B (AbdB) Hoxa genes: regulation in adult uterus by estrogen and progesterone and repression in müllerian duct by the synthetic estrogen diethylstilbestrol (DES). Dev Biol 197:141–154 [DOI] [PubMed] [Google Scholar]
  16. Liehr JG 2000 Is estradiol a genotoxic mutagenic carcinogen? Endocr Rev 21:40–54 [DOI] [PubMed] [Google Scholar]
  17. Ballestar E, Paz MF, Valle L, Wei S, Fraga MF, Espada J, Cigudosa JC, Huang TH, Esteller M 2003 Methyl-CpG binding proteins identify novel sites of epigenetic inactivation in human cancer. EMBO J 22:6335–6345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Chu MC, Selam FB, Taylor HS 2004 HOXA10 regulates p53 expression and Matrigel invasion in human breast cancer cells. Cancer Biol Ther 3:568–572 [DOI] [PubMed] [Google Scholar]
  19. Lee TS, Kim JW, Kang GH, Park NH, Song YS, Kang SB, Lee HP 2006 DNA hypomethylation of CAGE promotors in squamous cell carcinoma of uterine cervix. Ann NY Acad Sci 1091:218–224 [DOI] [PubMed] [Google Scholar]
  20. Paz MF, Wei S, Cigudosa JC, Rodriguez-Perales S, Peinado MA, Huang TH, Esteller M 2003 Genetic unmasking of epigenetically silenced tumor suppressor genes in colon cancer cells deficient in DNA methyltransferases. Hum Mol Genet 12:2209–2219 [DOI] [PubMed] [Google Scholar]
  21. Rauch T, Wang Z, Zhang X, Zhong X, Wu X, Lau SK, Kernstine KH, Riggs AD, Pfeifer GP 2007 Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay. Proc Natl Acad Sci USA 104:5527–5532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sakuma M, Akahira J, Ito K, Niikura H, Moriya T, Okamura K, Sasano H, Yaegashi N 2007 Promoter methylation status of the Cyclin D2 gene is associated with poor prognosis in human epithelial ovarian cancer. Cancer Sci 98:380–386 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Whitcomb BP, Mutch DG, Herzog TJ, Rader JS, Gibb RK, Goodfellow PJ 2003 Frequent HOXA11 and THBS2 promoter methylation, and a methylator phenotype in endometrial adenocarcinoma. Clin Cancer Res 9:2277–2287 [PubMed] [Google Scholar]
  24. Wu Y, Strawn E, Basir Z, Halverson G, Guo SW 2007 Aberrant expression of deoxyribonucleic acid methyltransferases DNMT1, DNMT3A, and DNMT3B in women with endometriosis. Fertil Steril 87:24–32 [DOI] [PubMed] [Google Scholar]
  25. Yoshida H, Broaddus R, Cheng W, Xie S, Naora H 2006 Deregulation of the HOXA10 homeobox gene in endometrial carcinoma: role in epithelial-mesenchymal transition. Cancer Res 66:889–897 [DOI] [PubMed] [Google Scholar]
  26. Kim JJ, Taylor HS, Lu Z, Ladhani O, Hastings JM, Jackson KS, Wu Y, Guo SW, Fazleabas AT 2007 Altered expression of HOXA10 in endometriosis: potential role in decidualization. Mol Hum Reprod 13:323–332 [DOI] [PubMed] [Google Scholar]
  27. Wu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW 2005 Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol 193:371–380 [DOI] [PubMed] [Google Scholar]
  28. Sakkas D, Lu C, Zulfikaroglu E, Neuber E, Taylor HS 2003 A soluble molecule secreted by human blastocysts modulates regulation of HOXA10 expression in an epithelial endometrial cell line. Fertil Steril 80:1169–1174 [DOI] [PubMed] [Google Scholar]
  29. Cermik D, Selam B, Taylor HS 2003 Regulation of HOXA-10 expression by testosterone in vitro and in the endometrium of patients with polycystic ovary syndrome. J Clin Endocrinol Metab 88:238–243 [DOI] [PubMed] [Google Scholar]
  30. Taylor HS, Arici A, Olive D, Igarashi P 1998 HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. J Clin Invest 101:1379–1384 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Noller KL, Fish CR 1974 Diethylstilbestrol usage: its interesting past, important present, and questionable future. Med Clin North Am 58:793–810 [DOI] [PubMed] [Google Scholar]
  32. Giusti RM, Iwamoto K, Hatch EE 1995 Diethylstilbestrol revisited: a review of the long-term health effects. Ann Intern Med 122:778–788 [DOI] [PubMed] [Google Scholar]
  33. Swan SH 2000 Intrauterine exposure to diethylstilbestrol: long-term effects in humans. APMIS 108:793–804 [DOI] [PubMed] [Google Scholar]
  34. Duboule D 1991 Patterning in the vertebrate limb. Curr Opin Genet Dev 1:211–216 [DOI] [PubMed] [Google Scholar]
  35. Krumlauf R 1994 Hox genes in vertebrate development. Cell 78:191–201 [DOI] [PubMed] [Google Scholar]
  36. Cedar H 1988 DNA methylation and gene activity. Cell 53:3–4 [DOI] [PubMed] [Google Scholar]
  37. Newell-Price J, Clark AJ, King P 2000 DNA methylation and silencing of gene expression. Trends Endocrinol Metab 11:142–148 [DOI] [PubMed] [Google Scholar]
  38. Enokida H, Shiina H, Urakami S, Igawa M, Ogishima T, Li LC, Kawahara M, Nakagawa M, Kane CJ, Carroll PR, Dahiya R 2005 Multigene methylation analysis for detection and staging of prostate cancer. Clin Cancer Res 11:6582–6588 [DOI] [PubMed] [Google Scholar]
  39. Cui M, Wen Z, Yang Z, Chen J, Wang F 24 December 2008 Estrogen regulates DNA methyltransferase 3B expression in Ishikawa endometrial adenocarcinoma cells. Mol Biol Rep 10.1007/s11033-008-9435-9 [DOI] [PubMed] [Google Scholar]
  40. Couse JF, Korach KS 2004 Estrogen receptor-α mediates the detrimental effects of neonatal diethylstilbestrol (DES) exposure in the murine reproductive tract. Toxicology 205:55–63 [DOI] [PubMed] [Google Scholar]
  41. Li S, Ma L, Chiang T, Burow M, Newbold RR, Negishi M, Barrett JC, McLachlan JA 2001 Promoter CpG methylation of Hox-a10 and Hox-a11 in mouse uterus not altered upon neonatal diethylstilbestrol exposure. Mol Carcinog 32:213–219 [DOI] [PubMed] [Google Scholar]
  42. Luke MP, Sui G, Liu H, Shi Y 2006 Yin Yang 1 physically interacts with Hoxa11 and represses Hoxa11-dependent transcription. J Biol Chem 281:33226–33232 [DOI] [PubMed] [Google Scholar]
  43. Tan DP, Nonaka K, Nuckolls GH, Liu YH, Maxson RE, Slavkin HC, Shum L 2002 YY1 activates Msx2 gene independent of bone morphogenetic protein signaling. Nucleic Acids Res 30:1213–1223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Fei X, Chung H, Taylor HS 2005 Methoxychlor disrupts uterine Hoxa10 gene expression. Endocrinology 146:3445–3451 [DOI] [PubMed] [Google Scholar]
  45. Martin R, Taylor MB, Krikun G, Lockwood C, Akbas GE, Taylor HS 2007 Differential cell-specific modulation of HOXA10 by estrogen and specificity protein 1 response elements. J Clin Endocrinol Metab 92:1920–1926 [DOI] [PubMed] [Google Scholar]
  46. Issa JP 2002 Epigenetic variation and human disease. J Nutr 132(Suppl):2388S–2392S [DOI] [PubMed] [Google Scholar]
  47. Laird PW 2003 The power and the promise of DNA methylation markers. Nat Rev Cancer 3:253–266 [DOI] [PubMed] [Google Scholar]
  48. Robertson KD, Wolffe AP 2000 DNA methylation in health and disease. Nat Rev Genet 1:11–19 [DOI] [PubMed] [Google Scholar]
  49. Li E 2002 Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3:662–673 [DOI] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES