High-Level Biosynthesis of the Anteiso-C₁₇ Isoform of the Antibiotic Mycosubtilin in Bacillus subtilis and Characterization of Its Candidacidal Activity

Abstract

High-level production (880 mg liter⁻¹) and isolation of the anteiso-C₁₇ isoform of the lipopeptide mycosubtilin produced by a genetically engineered Bacillus subtilis strain are reported. Antifungal activity of this isoform, as determined via culture and fluorometric and cell leakage assays, suggests its potential therapeutic use as an antifungal agent, in particular against Candida spp.

The soil bacterium Bacillus subtilis ATCC 6633 synthesizes the lipopeptides mycosubtilin and surfactin via a so-called nonribosomal peptide synthetase. Mycosubtilin belongs to the iturin family and is composed of seven α-amino acids linked to a unique C₁₆ or C₁₇ β-amino fatty acid with a linear or branched (iso or anteiso) acyl chain (15). This amphiphilic structure confers interesting biological properties on this secondary metabolite, particularly antifungal activity, which increases with the number of carbon atoms of the acyl chain (10). However, studies and applications of mycosubtilin are compromised by limited production by the native producer, cosynthesis of surfactin, and the existence of different mycosubtilin homologues and isoforms. In this work, utilization of specific precursors together with appropriate culture conditions for a genetically engineered strain led to the synthesis of a large amount of the most biologically active mycosubtilin homologue. Structural characterizations by mass spectrometry and nuclear magnetic resonance (NMR) spectroscopy demonstrated that this homologue corresponds to the anteiso-C₁₇ isoform. Its antifungal activity against pathogenic Candida spp. was examined by MIC determination, fluorescence spectroscopy, and leakage experiments.

Overproduction of mycosubtilin in B. subtilis ATCC 6633 was obtained by replacement of the native promoter of the myc operon, which encodes mycosubtilin synthetase, by the strong and tightly regulated xylA promoter from the Bacillus megaterium xylose isomerase (16). To this end, a repressor-promoter xylR-pxylA fragment was PCR amplified from pAXO1 (9) with Pfu DNA polymerase (Promega) and primers R100 and R101 before being cloned at the HincII site of pBG103 to yield pBG113 (Tables 1 and 2). Then, a spectinomycin resistance cassette was rescued from pRFB122 by PstI/EagI digestion and inserted into pBG113 at the corresponding site to yield pBG113s (Table 1). This construct was used to transform B. subtilis ATCC 6633 as previously described (8), and transformants were selected on Luria-Bertani plates supplemented with spectinomycin (100 μg/ml). Correct integration in the resulting RFB107 strain was verified by analytical PCR using primers R102 and R103 (Table 2). In a second step, the srf operon, encoding surfactin synthetase, was disrupted in RFB107 to render the strain unable to synthesize surfactin. The knockout was targeted downstream of the comS regulator involved in competence mechanisms, which lies nested and out of frame within the srf operon (6, 7). The disruption cassette was obtained by a ligation-mediated PCR method (12) as follows. Fragments of srfAB and srfAD open reading frames were PCR amplified (primer pairs R106 and R107 and R108 and R109, respectively) from B. subtilis ATCC 6633 genomic DNA (obtained with the Wizard genomic DNA purification kit; Promega) while the erythromycin resistance cassette (ERY) of pDML1567 was amplified with primers R110 and R111. PCR fragments (200 ng) were digested with SfiI, purified with the GFX purification kit (GE Healthcare), and ligated with T4 DNA ligase (Promega) before being used as a template for PCR amplification using primers R106 and R109. The resulting srfAB-ERY-srfAD cassette was then used to transform B. subtilis RFB107, and transformants were selected on Luria-Bertani erythromycin (1 μg/ml) plates. Integration by a double-crossing event in the resulting strain RFB112 was verified by analytical PCR using primers R104 and R105 (Table 1) and by liquid chromatography-electrospray ionization-mass spectrometry analysis of the purified culture supernatant as described elsewhere (14).

TABLE 1.

Plasmids and Bacillus strains used in this study

TABLE 2.

Synthetic primers used for PCR amplification

Name	Sequencea (5′-3′)	Restriction site
R100	GGGAGCTCGGATCCCATTTCCC
R101	CGATATCTCTGCAGTCGCGATG
R102	CCACTCCTTTGTTTATCCACCGAAC
R103	GACGTTCAAATAAGTGTGATTGGCC
R104	ACGGAGGGAGACGATTTGCA
R105	ACATTCGGTGAATAAGGAAGCA
R106	GTGAAAATCCGAGGCTACCGC
R107	GGGGGCCCCAGCGGCCATATAAGCCGCCAGCTGGCG	SfiI
R108	CAGGGCCCAGTGGGCCGCAGGGCGAAACGCTAGATAGG	SfiI
R109	GCTGTCACAAACGGAAGAAGTC
R110	CATGGCCCACTGGGCCCTGCTTCCTAATGCAGGAGTCGC	SfiI
R111	CCCCGGCCGCTGGGGCCCCCGCGATCGCCTATTTGGC	SfiI

^aUnderlining indicates SfiI restriction sites.

For mycosubtilin production, strain RFB112 was cultured at 25°C for 48 h in a medium containing 1 g liter⁻¹ yeast extract, 15 mM sucrose, 75 mM xylose, 15 mM isoleucine, 10 mM K₂HPO₄, 4 mM MgSO₄, and 6 mM KCl. The mycosubtilin concentration in the culture broth, determined by reverse-phase high-performance liquid chromatography on a C₁₈ X-Terra column (4.6 by 15 mm, 3.5-μm pore size; Waters) (8), was 880 mg liter⁻¹. This represents a 50-fold-increased production yield compared to the native strain for a culture time reduced by up to 40% (8). For mycosubtilin purification, the culture supernatant was loaded onto a 50-ml C₁₈ octadecyl silane matrix (Macherey-Nagel) equilibrated with 10 bed volumes of MilliQ water. The matrix was subsequently washed with MilliQ water and with a mixture of MilliQ water-methanol (1:1, vol/vol) (five bed volumes each). Crude mycosubtilin was then eluted with three bed volumes of methanol before being 10-fold concentrated by rotary evaporation. Further purification was performed by reverse-phase high-performance liquid chromatography, and the peak corresponding to the mycosubtilin was collected and vacuum dried. The purified molecule, analyzed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry as previously described (13), showed signals at m/z 1,107.5 and 1,123.5 Da, which are in accordance with the calculated mass values of Na⁺ and K⁺ adducts of the C₁₇ mycosubtilin homologue. Additional ions corresponding to C₁₆ homologues were not detected, suggesting that the latter were not synthesized under these conditions (Fig. 1). Acyl chain isomery was further characterized by either ¹H or ¹H-¹³C heteronuclear single-quantum coherence NMR spectroscopy (18) on a Bruker 500-MHz spectrometer at 25°C with a 10 mM solution of purified mycosubtilin in methanol-d₄. In the high-field methyl region, two signals were observed at (δ_H 0.89, δ_C 18.5) and (δ_H 0.93, δ_C 13), corresponding to a doublet and a triplet with J values of 6.9 Hz and 7.4 Hz, respectively (Fig. 2; data not shown). These signals, with very low proton chemical shift (δ_H 0.89 and δ_H 0.93), correspond to methyl groups of the long-chain β-amino acid found in the iturin lipopeptide (11). The proton multiplicity (i.e., doublet and triplet) observed for these two methyl groups could account only for the anteiso isomery of the heptadecanoic acyl chain of mycosubtilin.

FIG. 1.

Matrix-assisted laser desorption ionization-time of flight spectra of lipopeptide produced by B. subtilis RFB112. Intens., intensity; a.u., arbitrary units.

FIG. 2.

Detail of ¹H-¹³C heteronuclear single-quantum coherence spectra of lipopeptides produced by B. subtilis strain RFB112. Spectra were acquired as described previously (18). The methyl signals are indicated by arrows.

The biological activity of the purified anteiso-C₁₇ mycosubtilin was first characterized by determining the susceptibility of an array of yeasts and molds. As shown in Table 3, a strong antifungal activity was obtained for yeast strains whereas no significant growth inhibition was observed for molds. Despite the various susceptibilities of both yeast species and specific isolates of the same species, the relatively low MICs obtained, especially for isolates resistant to conventional drugs (fluconazole and amphotericin B), point to the powerful properties of this particular mycosubtilin isoform. The moderate effectiveness against the sterol auxotrophic Candida glabrata isolates could be explained by the presence of free ergosterol, which is known as a strong iturin antagonist (2), in the culture medium. For iturin A, an iturinic lipopeptide closely related to mycosubtilin, a membrane pore-forming mode of action has been suggested for Saccharomyces cerevisiae spheroplasts (3). Accordingly, the antifungal activity of the purified mycosubtilin was further investigated by determining its ability to induce cell membrane destabilization by measuring the transmembrane electrical potential (ΔΨ) with the fluorescent probe 3′-dipropylthia dicarbocyanine iodide [Disc(3)5] (5). As shown in Fig. 3, the significant fluorescence signal observed upon addition of 10 μM of mycosubtilin to a Candida albicans reference strain ATCC 10231 cell suspension loaded with fluorescent dye demonstrated the complete disruption of the ΔΨ (as shown by the lack of an additional fluorescence signal upon addition of the ionophore valinomycin). At the same time, an extensive cell leakage of UV-absorbing molecules (i.e., protein and nucleic acids) (for details see reference 17) could be observed, suggesting the formation of transmembrane pores due to the action of mycosubtilin (not shown).

TABLE 3.

In vitro susceptibilities of different yeasts and molds to purified anteiso-C₁₇ mycosubtilin

Species or strain	MICa (μg/ml)	Origin or referenceb
Saccharomyces cerevisiae	4	Lab stock
Yarrowia lipolytica CBS6303	8	CBS
Pichia pastoris	32	Lab stock
Candida albicans ATCC 10231c	32	ATCC
Candida albicans IHEM3742	64	IHEM
Candida albicansc	18	Lab stock
Candida parapsilosis IHEM9557	128	IHEM
Candida tropicalis IHEM6246	16	IHEM
Candida tropicalisc,d,e	16	Lab stock
Candida guilliermondii IHEM1067	128	IHEM
Candida glabrata IHEM6161	16	IHEM
Candida glabrata L999	2	1
Candida glabrata S53452c,e,f	150	1
Candida glabrata H34736c,e,f	150	1
Candida glabrata W16119c,e,f	150	1
Candida glabratac,e	16	Lab stock
Cryptococcus neoformans IHEM3969	8	IHEM
Aspergillus parasiticus IHEM4383	>300	IHEM
Aspergillus terreus IHEM2499	>300	IHEM
Aspergillus fumigatus IHEM3562	>300	IHEM

^aResults are mean values of four independent experiments. Breakpoints for the determination of antibiotic resistance were determined according to the M27-A3 procedure (4). Experiments were performed in triplicate.

^bIHEM, biomedical fungus and yeast collection (http://bccm.belspo.be); ATCC, American Type Culture Collection (http://www.lgcpromochem-atcc.com); CBS, Centraalbureau voor Schimmelcultures, fungal and yeast collection (http://www.cbs.knaw.nl/databases/).

^cResistant to fluconazole.

^dResistant to amphotericin B.

^eClinical isolate.

^fAuxotroph for sterol; culture medium was supplemented with ergosterol at 20 μg/ml.

FIG. 3.

Transmembrane ΔΨ determination for a C. albicans ATCC 10231 suspension (0.5 McFarland standard). Fluorophore Disc(3)5 (1 μM; arrow 1), mycosubtilin (15 μM; arrow 2), and valinomycin (1 μM; arrow 3) were added to the cell suspension after 50, 600, and 1,000 s, respectively. Displayed data represent one representative result of three independent experiments. A.U., arbitrary units.

Considering that the antifungal activity of iturinic lipopeptides increases with the length of their fatty acid moieties and that mycosubtilin is considered the most active iturin (10), the aim of this study was to specifically overproduce a C₁₇ mycosubtilin homologue. As this lipopeptide is of great fundamental interest and shows great antibiotic potential, its study is particularly worthwhile. The extent to which mycosubtilin overproduction occurs in the engineered strain is greater than what has ever been observed to date (13). In combination with low culture temperature, which also contributes to this high level of production (8), addition of isoleucine made it possible to direct mycosubtilin synthesis toward the anteiso-C₁₇ isoform with high efficiency. This preliminary investigation of the antifungal properties of this particular mycosubtilin isoform is very promising and must be pursued. We are currently investigating the mechanism of antifungal activity in greater detail, especially on Candida strains less susceptible to conventional antifungal drugs.