Skip to main content
Annals of Botany logoLink to Annals of Botany
. 2008 Oct 24;103(1):29–38. doi: 10.1093/aob/mcn205

Differential expression of miRNAs in response to salt stress in maize roots

Dong Ding 1, Lifang Zhang 2, Hang Wang 1, Zhijie Liu 1, Zuxin Zhang 3, Yonglian Zheng 1,*
PMCID: PMC2707283  PMID: 18952624

Abstract

Background and Aims

Corn (Zea mays) responds to salt stress via changes in gene expression, metabolism and physiology. This adaptation is achieved through the regulation of gene expression at the transcriptional and post-transcriptional levels. MicroRNAs (miRNAs) have been found to act as key regulating factors of post-transcriptional gene expression. However, little is known about the role of miRNAs in plants' responses to abiotic stresses.

Methods

A custom μparaflo™ microfluidic array containing release version 10.1 plant miRNA probes (http://microrna.sanger.ac.uk/) was used to discover salt stress-responsive miRNAs using the differences in miRNA expression between the salt-tolerant maize inbred line ‘NC286’ and the salt-sensitive maize line ‘Huangzao4’.

Key Results

miRNA microarray hybridization revealed that a total of 98 miRNAs, from 27 plant miRNA families, had significantly altered expression after salt treatment. These miRNAs displayed different activities in the salt response, and miRNAs belonging to the same miRNA family showed the same behaviour. Interestingly, 18 miRNAs were found which were only expressed in the salt-tolerant maize line, and 25 miRNAs that showed a delayed regulation pattern in the salt-sensitive line. A gene model was proposed that showed how miRNAs could regulate the abiotic stress-associated process and the gene networks coping with the stress.

Conclusions

Salt-responsive miRNAs are involved in the regulation of metabolic, morphological and physiological adaptations of maize seedlings at the post-transcriptional level. The miRNA genotype-specific expression model might explain the distinct salt sensitivities between maize lines.

Key words: Salt stress, Zea mays, microRNA, microarray, transcription regulation, Zea mays

INTRODUCTION

Salt stress is one of the most serious abiotic stresses of crop plants worldwide. To cope with high salt stress in their sessile lifestyle, crop plants have evolved a considerable degree of developmental plasticity, including adaptation via cascades of molecular networks. One of the most obvious features of the adaptation to salt tolerance are changes in gene expression profiles for genes involved in a broad spectrum of biochemical, cellular and physiological processes such as energy metabolism, signal transduction, transcription, protein biosynthesis and decay, membrane trafficking and photosynthesis (Vinocur and Altman, 2005). In addition, post-transcriptional regulation also plays a role in the plant salt response. Borsani et al. (2005) found that natural cis–antisense gene pairs initiated nat-siRNA (natural antisense small interfering RNA) formation, and the nat-siRNA then guided the cleavage of the P5CDH [Δ(1)-pyrroline-5-carboxylate dehydrogenase] transcript, which is a salt stress-related functional gene.

MicroRNAs (miRNAs) are approx. 21-nucleotide (nt) non-coding RNAs that play critical roles in gene expression regulation at the post-transcriptional level. In plants, cleavage of the target mRNA appears to be the prevalent method of post-transcriptional regulation, yet Brodersen et al. (2008) provided evidence that plant miRNA-guided silencing has a widespread translational inhibitory component. Plant miRNA-guided gene regulation has been shown to be involved in multiple developmental processes including organ polarity (Bowman, 2004), leaf growth (Chuck et al., 2007a), sex determination (Chuck et al., 2007b) and male or female sterility (Millar and Gubler, 2005). The observation that some plant miRNAs respond to stress conditions and some miRNA targets are stress-related genes suggests that miRNAs may play important roles in the plant stress response (Phillips et al., 2007). Several stress-specific miRNAs have also been identified in model plants under various biotic and abiotic stress conditions, including nutrient deficiency (Fujii et al., 2005), drought (Zhao et al., 2007), cold (Zhou et al., 2008), high salinity (Sunkar et al., 2008), bacterial infection (Navarro et al., 2006), UV-B radiation (Zhou et al., 2007) and mechanical stress (Lu et al., 2005 ).

Microarray technology has been applied in the high-throughput detection of gene expression and it has proved a useful tool in miRNA expression assays (Liu et al., 2008). A microarray-based search was undertaken to discover submergence stress-responsive miRNAs in maize roots (Zhang et al., 2008). High salinity is a serious abiotic stress for maize seedlings, and miRNA-guided post-transcriptional regulation might be involved in the response by the salt-shocked maize seedlings. In this study, a custom μparaflo™ microfluidic array (LC Sciences, Houston, TX) containing release version 10.1 plant miRNA probes (http://microrna.sanger.ac.uk/; Griffiths-Jones et al., 2008) was used to discover differentially expressed miRNAs between two maize inbred lines with distinct salt sensitivities. The results indicated that only a minority of the differentially expressed miRNAs were uniformly regulated between the two maize lines; the vast majority of the differentially expressed miRNAs show a genotype-specific expression model. These miRNAs potentially play vital roles in the morphological and metabolic adaptation response in salt-shocked root cells of maize, and the genotype-specific expression model may explain the distinct salt sensitivities between the two maize lines.

MATERIALS AND METHODS

Plant treatment and RNA isolation

Seeds of ‘NC286’ (a salt-tolerant maize, Zea mays, inbred line) and ‘Huangzao4’ (a salt-sensitive maize line) were used in this study. For each inbred line, 60 uniform seeds were surface-sterilized in 70 % (v/v) ethanol for 15 min, and then rinsed several times with sterile distilled water. The seeds were sown in sterile sand irrigated with sterile distilled water. The seeds were allowed to germinate in the incubator with a 16 h photoperiod at an optimal temperature regime of 24/21 °C (light/dark). Uniform seedlings with two leaves were transferred into 1× Hoagland's nutrient solution (supplied with 4 mL L−1 Fe-sequestrene, 6 mm K+ and 4 mm Ca2+) and grown hydroponically with aeration. When the seedlings developed three leaves, they were transferred into either a nutrient solution containing 200 mm NaCl for salt stress treatment or the nutrient solution without NaCl, as a control. Plants were treated at 08 00 h, and roots of ten plants were harvested at 0·5, 5 and 24 h after salt stress; the roots of untreated control were also harvested at the corresponding time points. The collected roots were immediately frozen in liquid nitrogen and ground into a fine powder. The total RNA from each sample was extracted with Trizol reagent (Invitrogen, Carlsbad, CA).

miRNA microarray assay

miRNA microarray assays were performed by LC Sciences. The custom μparaflo™ microfluidic chip contained 653 unique plant miRNAs of release version 10.1, representing 877 miRNAs from 17 plant species (http://microrna.sanger.ac.uk/; Griffiths-Jones et al., 2008). Each chip contained five repetitions of each probe. The 877 miRNAs comprised 154 from Arabidopsis thaliana, 115 from Oryza sativa, 187 from Physcomitrella patens, 100 from Populus trichocarpa, 43 from Zea mays and 278 from 12 other plant species. For microarray quality control, four controls were used. Maize 5S rRNA served as the inner positive control; and PUC2-20B, an artificial non-homologous nucleic acid, was used as an external positive control. The perfect match and single-base mismatch counterparts to the external positive control, named PUC2PM-20B and PUC2MM-20B, were spiked into the RNA samples before probe labelling. Blank and non-homologous nucleic acids were used as negative controls. Approximately 5 µg of total RNA was used as the starting material for each assay. RNAs were size-fractionated using a YM-100 Microcon centrifugal filter (Millipore, Bedford, MA), and the small RNAs (<300 nucleotides) were isolated and 3′-extended with a poly(A) tail using poly(A) polymerase. An oligonucleotide tag was ligated to the poly(A) tail for later fluorescent dye staining; two different tags were used for the two RNA samples in the dual-sample experiments. Briefly, purified small RNAs were labelled with Cy3 and Cy5 fluorescent dyes (salt shocked and its corresponding control, respectively) and then hybridized with the dual-channel microarray. Hybridization was performed overnight in 6× SSPE buffer (0·90 m NaCl, 60 mm Na2HPO4, 6 mm EDTA, pH 6·8) containing 25 % formamide at 34 °C. Chip hybridization experiments were carried out in triplicate initiated from different biological samples. Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Devices, Sunnyvale, CA) and digitized using Array-Pro image analysis software (Media Cybernetics, Silver Spring, MD). Data were analysed by first subtracting the background and then normalizing the signals using a LOWESS filter (locally weighted regression). The ratio of the two sets of detected signals (log2-transformed, balanced) and P-values of the t-test were calculated; differentially detected signals were those with P-values <0·01.

miRNA promoter cis-acting element analysis and target prediction

miRNAs are derived from longer primary transcripts (pri-miRNAs) that are processed into smaller stem–loop miRNA precursors (pre-miRNAs). Pre-miRNAs are then processed to yield mature miRNAs by an RNase named DICER (Xie et al., 2005). The mature miRNAs are conserved among plant species, but with regard to pre-miRNAs the conservation is due to the stem–loop structure, rather than the sequences (Bonnet et al., 2004). This indicates that the exact matches between pre-miRNAs and the genomic sequences should be helpful in searching the miRNA genes. miRNAs were proved to be transcribed in eukaryotes by RNA polymerase (Lee et al., 2004), and the TSS (transcription start site) may be as little as 50 nt and as much as 2·5 kb upstream of the pre-miRNA sequences in the transcript (Bracht et al., 2004; Megraw et al., 2006). To discover maize salt stress-responsive miRNA genes, each pre-miRNA sequence downloaded from http://microrna.sanger.ac.uk/ was aligned to the maize genome sequence (http://www.maizesequence.org). About 2500 bp of upstream sequences of the pre-miRNAs were checked by PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/; Lescot et al., 2002), the −75 CAAT-box and −30 TATA-box were recognized as the milestones to confirm the TSS. The 1500 bp DNA sequence upstream of the TSS was truncated to identify cis-acting motifs via PlantCARE. To validate the precision of the TSS prediction and promoter analysis, 5′ RACE (rapid amplification of cDNA ends) was undertaken to obtain the TSS, and primers of the upstream sequences were then designed to amplify the promoter regions of the miRNA genes. About 1000 bp of DNA sequence upstream of the TSS of each miRNA gene was amplified and sequenced to validate the prediction of the promoter sequences. The Supplementary Information (Table S1C, available online) shows the primers for five miRNA gene promoters.

In plants, miRNAs recognize their target mRNAs by perfect or near-perfect base pairing. Computational sequence similarity algorithms were developed to identify potential miRNA targets. For the prediction of plant miRNA target mRNAs, a web-based computing system, miRU (Zhang et al., 2005), was queried by mature miRNA sequences. All potential sequences complementary to the query with limited mismatches were selected. The number of mismatches was limited to no more than 3 nt, indels were no more than 1 nt, and fewer than five G–U pairs were allowed. The predicted target expressed sequence tags (ESTs) were aligned and searched by BLAST for functional annotation.

Validation of the mature miRNA expression profile via stem–loop RT-PCR

The expression profiles of seven salt-responsive mature miRNAs were assayed by stem–loop reverse transcription-PCR (RT–PCR). A 200 ng aliquot of total RNA was used for the initiation of the reverse transcription reaction. The stem–loop reverse transcription primers were designed following the method described by Chen et al. (2005) and Varkonyi-Gasic et al. (2007). Briefly, 6 nt tips pairing with the mature miRNA 3′ end were linked to a self-looped sequence (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC) to make up the stem–loop RT-PCR primers; the primers bind to the 3′ portion of miRNA molecules, initiating reverse transcription of the mature miRNA. The reverse transcription product is amplified using a miRNA-specific forward primer and a universal reverse primer. The stem–loop reverse transcription reactions were performed by MMLV reverse transcriptase (Toyobo, Osaka, Japan) according to the supplier's manual. PCR primers were then added to perform the PCR. One of the uniformly expressed miRNAs, miR172, was used as the inner control for stem–loop RT-PCR. Supplementary Table S1A shows the sequences of stem–loop RT primers and miRNA-specific PCR primers.

Validation of the miRNA target gene expression profiles by RT-PCR

The expression profiles of the predicted target genes were assayed by RT-PCR. A 10 µg aliquot of total RNA was used for initiating the reverse transcription reaction. The oligo(dT) primer was added and incubated with the total RNA. The reverse transcription reaction was performed by MMLV reverse transcriptase (Toyobo, Osaka, Japan) according to the supplier's manual. The target gene primers were then added to perform the PCR. A maize housekeeping gene, γ-tubulin, was used as the inner control for RT-PCR. Supplementary Table S1B shows the primer sequences of the target genes and the γ-tubulin gene.

RESULTS

Salt-stress-responsive miRNAs in maize roots

The microarray data showed that the expression profiles of many miRNAs changed in response to salt stress in maize roots. These miRNAs were identified from diverse families of plant miRNAs. Mature miRNAs are conserved among plant species; members of the same miRNA families differ from each other by only 1–3 nt, or they are identical. The differences exist in the pre-miRNA sequences. Thus, cross-hybridization might have occurred in the microarray between members of the same miRNA family, or between homologous sequences across species. To refine the differentially expressed miRNAs, miRNA families where many members showed changed expression profiles, especially whose members showed similar expression profiles, were considered as salt stress-responsive miRNA families. miRNAs with similar expression profiles reflected the expression of the family counterparts in maize. A total of 98 miRNAs, about 15 % (98/653) of the probes on the microarray, were identified as putative salt-responsive miRNAs at the 1 % significance level (Table 1). A total of 77 out of the 98 miRNAs aligned with 55 members of ten maize miRNA families, while the other miRNAs corresponded to several members of miRNA families from another six plant species, including osa-miR528/529, ath-miR395/398/827/854, ptc-miR474, ppt-miR395/477/529/535/894/896/903/1026, tae-miR1125 and smo-miR1082. The results shown in Fig. 1 indicate that, during the salt stress process, the differentially expressed miRNAs were transcriptionally regulated at different time points in the two maize lines. By stem–loop RT-PCR, the expression profiles of seven salt-responsive miRNAs were generated in the two maize inbred lines (Fig. 2B). The results are consistent with the microarray data (Fig. 2A).

Table 1.

Salt-stress-responsive miRNA families and members

miR family Members of identified miRNAs miR family members
zma-miR156 ath-miR156a/g/h zma-miR156a/b/c/d/e/f/g/h/i
bna-miR156a
osa-miR156l
ptc-mir156 k
smo-miR156c zma-miR156 k
sbi-miR156e
vvi-miR156e
zma-miR159 ath-miR159a/b/c zma-miR159a, zma-miR159b
osa-miR159a/c/d/e/f
pta-miR159a/b
ptc-miR159d/f zma-miR159c/d
smo-miR159
sof-miR159e
zma-miR160 ppt-miR160b zma-miR160a/b
zma-miR162 ath-miR162a zma-miR162
zma-miR164 ath-miR164a/c zma-miR164a/b/c/d
osa-miR164c/d/e
ptc-miR164f
sbi-miR164c
zma-miR166 ath-miR166a zma-miR166a
osa-miR166e/k/m zma-miR166b/c/d/e/f/g/h/i
ppt-miR166j
ptc-miR166n/p zma-miR166l/m
sbi-miR166a zma166j/k
vvi-miR166b/d
zma-miR167 ath-miR167a/c/d zma-miR167a/b/c/d
bna-miR167a
ppt-miR167 zma-miR167e/f/g/h/i
ptc-miR167e/f/h
vvi-miR167c
zma-miR168 ath-miR168a zma-miR168a/b
osa-miR168a/b
sof-miR168b
zma-miR171 ath-miR171a zma-miR171c
osa-miR171 g zma-miR171d/e/i/j
ptc-miR171c/e zma-miR171 g
smo-miR171a
zma-miR171c
zma-miR319 ath-miR319a/c zma-miR319a/b/c/d
gma-miR319a/c
osa-miR319a
ppt-miR319a
pta-miR319
ptc-miR319e
vvi-miR319b
zma-miR395 ath-miR395b zma-miR395a/b/c
ppt-miR395
zma-miR396 osa-miR396d zma-miR396a/b
zma-miR399 ptc-miR399f/i zma-miR399a/c

Fig. 1.

Fig. 1.

Clustering of differently expressed miRNA members under salt stress at three time points in two maize inbred lines. (A) Significantly detected miRNAs in the salt-sensitive maize line ‘Huangzao4’; (B) significantly detected miRNAs in the salt-tolerant maize line ‘NC286’. The three time points are shown at the top, and salt-responsive miRNAs are listed on the right. Green indicates salt-repressed, whereas red indicates salt-induced miRNAs.

Fig. 2.

Fig. 2.

Expression profiles of seven maize salt-responsive miRNAs and their corresponding target genes detected by microarray, stem–loop RT-PCR and RT-PCR assay. (A) The expression of four responsive miRNAs in the roots of two maize lines at three time points by microarray assay. (B) The stem–loop RT-PCR results of the miRNAs. (C) The RT-PCR results of the miRNA target genes. CK indicates the untreated control and T indicates salt-treated samples.

Different expression profiles of salt-stress-responsive miRNAs between inbred lines

At three time points during the salt shock, miRNAs showed different expression profiles within the two inbred lines (Fig. 1). There are both congruously and differently regulated miRNAs, and inbred line-specific miRNAs were also detected. The differentially expressed miRNAs were classified into four groups using their expression profiles between the two maize inbred lines as a basis. Only six miRNAs (from three miRNA families, ptc-miR474, ath-miR395 and osa-miR528) were detected to be uniformly regulated at all three time points in the two maize inbred lines. The vast majority of the differentially expressed miRNAs showed different expression patterns either among the three time points, or between the two maize lines. miRNAs from eight families showed the same expression trends, yet were regulated at different time points, most of which exhibited a delayed expression pattern in the salt-sensitive maize line ‘Huangzao4’. Nine miRNA families have different expression trends during the salt stress period between the two lines. There exists another group of salt stress-responsive miRNAs from ten families, which could only be detected in the salt-tolerant maize line ‘NC286’. The results strongly suggested that the different miRNA regulation patterns might contribute to and partly explain the distinct salt sensitivities between the two maize lines.

Potential target genes of salt-stress-responsive miRNAs

miRNAs regulate gene expression by a perfect or near-perfect binding with their target mRNAs and in turn guide cleavage of the target transcripts or translational repression (Sunkar et al., 2007). This facilitates the prediction of plant miRNA targets via programmed algorithms of homology query, e.g. miRU. A total of 32 potential target genes were identified by miRU (Table 2). These genes are involved in a broad spectrum of cellular, metabolic, physiological and developmental processes, including energy metabolism, signal transduction, transcriptional regulation and cell defence. The expression profiles of seven of the target genes were validated by RT-PCR, and show a negative correlation with their corresponding zma-miRNAs (Fig. 2C). Using the functional annotations of the predicted target genes, they could be classified into four categories. Similarly to previously reported data in model plants, many miRNAs detected in the maize salt stress response directly targeted transcription factors (TFs) involved in plant development and organ formation. The TFs Myb, NAC1 and homeodomain-leucine zipper protein (HD-ZIP) were predicted as the targets of zma-miR159a/b, zma-miR164a/b/c/d and zma-miR166l/m, respectively. The results were consistent with those reported in arabidopsis and rice (Jones-Rhoades and Bartel, 2004). Other TFs predicted as the miRNA targets, such as MADS-box proteins and zinc-finger proteins, have been reported as salt stress-responsive factors in plants (Fang et al., 2006; Xu et al., 2008). Several targets of the miRNAs, including auxin response factor 8, ethylene-responsive element-binding factor and GAMyb, are involved in phytohormone signal cascades. In addition, several targets of miRNAs encode proteins that play roles in diverse metabolic pathways or are involved in various physiological processes. Many of the predicted targets, such as NADP-dependent malic enzyme (NADP-ME) and cytochrome oxidase, were previously reported as salt stress-responsive functional genes in plant cells (Yan et al., 2005; Cheng and Long, 2007). Interestingly, an ARGONAUTE1 (AGO1) mRNA and a DCL1 gene, which encode key factors involved in miRNA processing, were predicted as the targets of zma-miR168a/b and zma-miR162, respectively. This result indicated that feedback regulation might play a role in miRNA activity under salt-stressed conditions in maize.

Table 2.

Predicted target genes and their protein annotation

MiR ID Accession no. of miRNA targets Protein annotation
zma-miR156a/b/c/d/e/f/g/h/i No hit
zma-miR156j TC252322 SBP-domain protein 6
TC270942 P-type R2R3 Myb protein
TC271657 Zinc finger protein-like
zma-miR156 k No hit
zma-miR159a/b/c/d TC274797 MADS box interactor
TC250597 ZAG1
TC270317 Protein phosphatase PP2A-3
TC260832 Transcription factor GAMyb
zma-miR160a/b/c/d TC248728 40S ribosomal protein S16
TC254064 Two-component response regulator ARR11
zma-miR162 TC255650 Endoribonuclease Dicer
TC265329 Cytochrome P450
zma-miR164a/b/c/d TC258020 NAC domain protein NAC1
zma-miR166a/j/k/l/m TC271068 HD-ZIP rolled leaf1
zma-miR166b/c/d/e/f/g/h/i NP939611 Homeodomain-leucine zipper protein
zma-miR167a/b/c/d/e/f/g/h/i TC268965 Auxin response factor 8
zma-miR168a/b TC274908 PZE40 protein
TC248481 Cytoplasmic aldolase
TC265929 AGO1-1
CA758338 A winged helix TF MFH-1
zma-miR171d/e/i/j TC257183 Sprouty homologue 2 (Spry-2)
TC264725 Scl1 protein
zma-miR171 g TC270818 GPI-anchored protein
zma-miR319a/b/c/d TC260832 Transcription factor GAMyb
TC250597 ZAG1 protein
TC269978 Deoxycytidine deaminase
zma-miR395a/b/c TC260342 ATP sulfurylase
TC276738 l-Isoaspartyl methyltransferase
TC252974 Beta-d-xylosidase
TC260238 NADP-dependent malic protein
zma-miR396a/b TC255359 Cytochrome oxidase subunit I
zma-miR399a/c TC256314 HASTY
TC259578 Granule-bound starch synthase

Key cis-acting elements within the promoter regions of miRNA genes

All of the promoter regions of 60 maize counterpart salt stress-responsive miRNA genes were queried by PlantCARE. Five of the miRNA genes promoters were further validated by 5′ RACE and PCR amplification. The Supplementary Information (Figure S1, available online) shows the sequences of the five promoters. The experimental results showed a perfect consistency with the prediction. Stress-responsive cis-motifs were found in the 5′-upstream area (1·5 kb predicted promoter regions) of these miRNA genes (Supplementary Information, Table S2). The cis-elements include ABRE (ABA-responsive element), MBS (MYB binding site), TCA (salicylic acid-responsive element), HSE (heat shock-responsive element), LTR (low temperature-responsive element), GC-motif, ARE (anaerobic-response element) and GARE (gibberellin-responsive element). Each of the salt stress-responsive miRNAs has more than one stress-responsive cis-acting element in their promoter regions, indicating that these miRNAs are involved in regulation of cascades of various biotic and abiotic responses. As shown in Supplementary Table S2, the three most frequently appearing cis-acting motifs of the salt stress-responsive miRNA genes are MBS, ARE and ABRE. In addition, the miRNA members in the same miRNA family often share the same cis-acting motifs in their promoter regions, suggesting that the miRNA members of the same miRNA family may respond to the same biotic, abiotic or phytohormone stimuli.

DISCUSSION

Specifically and non-specifically regulated miRNAs responding to salt stress

Some miRNAs have been shown to be stress regulated and could be involved in cell responses to abiotic stresses such as salinity, cold and dehydration (Zhao et al., 2007; Sunkar et al., 2008; Zhou et al., 2008). Some miRNA target genes are stress-responsive TFs or functional genes (Yan et al., 2005; Fang et al., 2006; Cheng and Long, 2007; Prashanth et al., 2008; Xu, 2008), indicating that miRNA-dependent post-transcriptional regulation may play a role in the plant stress response. Stress response-specific miRNAs were observed in previous studies. The miRNA ath-miR319c was specifically upregulated by cold but not by ABA, dehydration or salt shock (Sunkar and Zhu, 2004). The miRNA osa-miR169 g was confirmed as the only miRNA induced by drought in rice (Zhao et al., 2007). Genotypic specificity is also evident, since different genotypes express the same miRNA in the same tissues, but at different levels (Mica et al., 2006). Sunkar et al. (2007) reviewed the plant small RNAs responsive to abiotic stresses and nutrient deprivation and speculated that small RNAs that are positively regulated by stress might target negative regulators of stress tolerance for enhanced suppression; in contrast, small RNAs that are suppressed during stress are likely to target positive regulators of stress tolerance, resulting in the accumulation of gene products. In the present research, salt-responsive miRNAs were detected in two maize inbred lines that have distinct salt sensitivities. There are uniformly regulated miRNAs, yet a majority of the responding miRNAs were differentially regulated between the two maize lines (92/98). The differentially regulated miRNAs were either detected only in one inbred line or had distinct expression trends. The similarly regulated miRNAs may represent the fundamental mechanism of adapting to salt shock, and the differentially regulated miRNAs might explain the distinct salt sensitivities between the two maize inbred lines. Members of the miR474 and miR395 families were found to be similarly regulated between the two maize lines; they were both upregulated, indicating that they might target negative regulators of salt tolerance, resulting in enhanced suppression of these factors. Members of the miR396 family were found to be downregulated in both lines, yet at different time points. This result indicated that accumulation of different levels of positive regulators during the stress process might result in different salt sensitivities among maize inbred lines. Under salt stress conditions, global gene expression profiles were changed, resulting in metabolic and physiological alterations. The differential expression of the miRNAs within the two maize inbred lines showed that there were both non-specific and specific responses of miRNAs under salt shock in maize root cells.

Non-specific cascades controlled by miRNAs

miRNAs are known to silence genes post-transcriptionally by guiding target mRNAs for degradation or by repressing translation (Sunkar et al. 2007). NADP-ME is a key enzyme that catalyses the oxidative decarboxylation of l-malate to yield pyruvate, CO2 and NADPH in the presence of a divalent cation (Cheng and Long, 2007). In plants, NADP-ME functions in many different pathways. Malate can be decarboxylated in the mitochondrial matrix through the action of NAD-ME to produce pyruvate, which is oxidized by the tricarboxylic acid cycle. These two enzymes are predicted to be the target genes of miR395 and miR474, respectively. These two miRNA families were found to be upregulated in both salt-shocked maize lines, indicating a salt-induced non-specific responding pathway, perhaps involved in maintenance of energy supply. An osa-miR528-like miRNA was also uniformly regulated in the two maize lines. It is widely accepted that under salt stress conditions, reactive oxygen species (ROS) such as superoxide radicals, hydroxyl radicals and hydrogen peroxide (H2O2) are produced in excess. ROS are mostly scavenged by superoxide dismutase (SOD; Banu et al., 2008). Cu/Zn SOD, a predicted target gene of miR528 in maize, was reported to be upregulated in salt-stressed rice leaves (D. W. Kim et al., 2007). Thus, the scavenging of ROS may be another salt stress strategy conserved among maize inbred lines.

miRNA affect salt sensitivities of maize lines

AGO1 encodes the RNA slicer enzyme of the miRNA pathway and is regulated by miR168-programmed, AGO1-catalysed mRNA cleavage. It is the only member of the arabidopsis ARGONAUTE family involved in the miRNA-directed mRNA cleavage processes. Transcriptional co-regulation of miR168 and AGO1 genes and post-transcriptional stabilization of miR168 by AGO1 are required for AGO1 homeostasis. The co-adjustment of miR168 and AGO1 indicated negative feedback regulation in the miRNA pathway (Vaucheret et al., 2006). miR168 was found to be a salt stress-responsive miRNA; the members of the zma-miR168 family were induced in the salt-tolerant maize inbred line ‘NC286’ and repressed in the salt-sensitive line ‘Huangzao4’ at the 0·5 h time point. Correspondingly, AGO1 mRNA was suppressed in ‘NC286’ and accumulated in ‘Huangzao4’. Since AGO1 is a key miRNA pathway regulator, the difference in AGO1 mRNA expression at the early phase under salt shock may induce further changes of numerous miRNA activities. In general, during the early period under salt shock, miRNA function was enhanced in ‘Huangzao4’ and reduced in ‘NC286’. The watershed for the salt stress response in plants is 24 h; after this time point the expression profiles of various mRNAs may change. miR168 was detected to be downregulated in both lines at 24 h, resulting in AGO1 mRNA accumulation and enhanced miRNA functions. This might explain why there are so many changes in expression of mRNAs after 24 h of salt stress.

It has been reported that many miRNA target genes were mRNAs of TFs, indicating an upstream regulation of miRNAs during the development processes and environmental response. Some miRNAs, including miR166, miR159, miR156 and miR319, showed altered expression profiles in at least one salt-shocked maize line. They were shown to regulate the levels of TF transcripts, which in turn affected the levels of TF proteins. The maize Rolled leaf 1 (rld1) gene is a homologue of the arabidopsis HD-ZIP gene. In maize, miR166 was found to cleave rld1 mRNA and alter leaf polarity (Juarez et al., 2004). The ath-miR166-mediated cleavage of HD-ZIP was found to regulate the pattern of vasculature and the establishment and maintenance of abaxial–adaxial polarity in lateral organs (Williams et al., 2005). Other than their involvement in leaf polarity regulation, the HD-ZIP family members were also reported to be induced by various stress conditions, including drought and phytohormones (Agalou et al., 2008; Dai et al., 2008). Shin et al. (2004) reported that Athb-12, a HD-ZIP from arabidopsis, could suppress the Na+-sensitive phenotype. Expression of Athb-12 dramatically enhanced NaCl tolerance. Athb-12 can regulate the expression of NaCl-inducible PMR2A, which encodes a plasma membrane Na+-ATPase involved in Na+ transport. Downregulation of miR166 in the salt-tolerant maize line ‘NC286’ after 5 h of salt shock indicated that an HD-ZIP, perhaps rld1, was involved in maize salt tolerance. The downregulation of miR166 in the salt-tolerant maize line and the upregulation of the target HD-ZIP transcripts might enhance the salt tolerance. The TCP domain is a plant-specific DNA-binding domain found in proteins from a diverse array of species. TCP TFs direct the developmental process of plant leaf size and form, and flower symmetry (Busov et al., 2008). The mRNA of the TCP TFs were targets of miR319, which was downregulated in the salt-tolerant maize line ‘NC286’ after 5 h and in the salt-sensitive maize line ‘Huangzao4’ after 24 h of salt shock. The downregulation of miR166 and miR319 after a period of salt shock in the maize inbred lines indicated an induction of their target TF transcripts and resulted in enhanced salt tolerance. The unique regulation of the miRNAs and their target TF transcripts might explain the different salt sensitivities between the two maize lines.

The regulation of miR166 and miR319 after 5 and 24 h of salt shock suggested that, although the miR-TF model is involved in the salt stress response, the salt response actions were not initiated by regulation of the TFs. At the 0·5 h time point, miR167 and miR164 were found to be downregulated in ‘NC286’, hinting that these miRNAs might be involved in the initiation of receipt of the salt stress signal. ARF8, an auxin-responsive factor gene, was predicted as the target of zma-miR167. Auxin response is regulated by various positive and negative feedback mechanisms as well as environmental signals. ARFs regulate the transcription of early auxin-responsive genes, including the AUX/IAA genes (Ulmasov et al., 1997), whereas AUX/IAA proteins interact with ARFs and repress their activities (Tiwari et al., 2003). Auxin induces targeted ubiquitinylation/degradation of specific AUX/IAA proteins (Gray et al., 2001) and frees ARFs from repression by AUX/IAA proteins. The accumulation of ARF transcripts resulting from the downregulation of miR167 might enhance the auxin response and thus enhance shoot and leaf development. NAC-domain proteins, named from a conserved domain originally associated with the NO APICAL MERISTEM (NAM) phenotype, were reported to be salt induced in many species (Hu et al., 2006; S. G. Kim et al., 2007). NAC-domain proteins are unique to plants, and their transcripts are the predicted targets of zma-miR164. Xie et al. (2000) reported that in arabidopsis, 35S::NAC1-overexpressing lines were bigger, with larger leaves, thicker stems and more abundant roots than the wild type. They thought that NAC1 might be an early auxin-responsive gene, and confirmed that NAC1 was located downstream of TIR1 and upstream of AIR3 and DBP in transmitting the auxin signal to the AIR3 gene to promote lateral root development. TIR1 is likely to regulate NAC1 at the transcriptional level, perhaps through auxin-dependent degradation of a negative regulator of NAC1. The placement of lateral roots is not pre-determined but it is strongly influenced by endogenous auxin levels and exogenous environmental conditions. It was observed in this study that the lateral roots flourished more in ‘NC286’ than in ‘Huangzao4’; this might have resulted from the early accumulation of auxin-responsive factors. At the early stage of salt stress, the salt-tolerant maize lines might change their morphological characteristics to enhance root and shoot development, thus accumulating more biomass to counteract the wastage brought on by salt shock.

Here a model has been proposed for the molecular mechanisms of the response of maize root cells to salt shock using the changed expression profiles of miRNA and subsequent target transcripts as a basis. The responsive miRNAs show a transitory expression model. Figure 3 shows the proposed regulation cascades after 0·5 h salt shock in ‘NC286’ root cells. This study indicates that the salt-responsive miRNAs are involved at post-transcriptional levels in the regulation of the metabolic, physiological and morphological processes of maize seedlings under salt-shocked conditions.

Fig. 3.

Fig. 3.

The potential regulatory network of salt-responsive miRNAs in maize roots. The data contributing to the network were collected from 0·5 h salt-shocked ‘NC286’ root, and show the potential roles of the salt-responsive miRNAs in the early hours of salt shock.

SUPPLEMENTARY INFORMATION

Supplementary information is available online at www.aob.oxfordjournals.org/ and consists of the following. Table S1(A), the stem–loop reverse transcription and PCR primer sequences; Table S1(B), the accessions of target genes and primers for RT-PCR; Table S1(C), PCR primers for miRNA promoter amplification. Table S2, stress-responsive key cis-elements found in zma-miRNA promoters. Figure S1, five of the maize miRNA promoter sequences obtained by PCR amplification and sequencing.

ACKNOWLEDGEMENTS

This work was supported by the Hi-Tech Research and Development Program of China (2006AA100103); the State Key Basic Research and Development Plan of China (2006CB101700); and the 111 Project (B07041).

LITERATURE CITED

  1. Agalou A, Purwantomo S, Overnäs E, et al. A genome-wide survey of HD-Zip genes in rice and analysis of drought-responsive family members. Plant Molecular Biology. 2008;66:87–103. doi: 10.1007/s11103-007-9255-7. [DOI] [PubMed] [Google Scholar]
  2. Banu MN, Hoque MA, Watanabe-Sugimoto M, et al. Proline and glycinebetaine induce antioxidant defense gene expression and suppress cell death in cultured tobacco cells under salt stress. Journal of Plant Physiology. 2008 doi: 10.1016/j.jplph.2008.03.002. Epub ahead of print. [DOI] [PubMed] [Google Scholar]
  3. Bonnet E, Wuyts J, Rouzé P, Van de Peer Y. Detection of 91 potential conserved plant microRNAs in Arabidopsis thaliana and Oryza sativa identifies important target genes. Proceedings of the National Academy of Sciences; USA. 2004. pp. 11511–11516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borsani O, Zhu J, Verslues PE, Sunkar R, Zhu JK. Endogenous siRNAs derived from a pair of natural cis–antisense transcripts regulate salt tolerance in Arabidopsis. Cell. 2005;123:1279–1291. doi: 10.1016/j.cell.2005.11.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bowman JL. Class III HD-Zip gene regulation, the golden fleece of ARGONAUTE activity? BioEssays. 2004;26:938–942. doi: 10.1002/bies.20103. [DOI] [PubMed] [Google Scholar]
  6. Bracht J, Hunter S, Eachus R, Weeks P, Pasquinelli AE. Trans-splicing and polyadenylation of let-7 microRNA primary transcripts. RNA. 2004;10:1586–1594. doi: 10.1261/rna.7122604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, et al. Widespread translational inhibition by plant miRNAs and siRNAs. Science. 2008;320:1185–1190. doi: 10.1126/science.1159151. [DOI] [PubMed] [Google Scholar]
  8. Busov VB, Brunner AM, Strauss SH. Genes for control of plant stature and form. New Phytologist. 2008;177:589–607. doi: 10.1111/j.1469-8137.2007.02324.x. [DOI] [PubMed] [Google Scholar]
  9. Chen C, Ridzon DA, Broomer AJ, et al. Real-time quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Research. 2005;33:e179. doi: 10.1093/nar/gni178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cheng Y, Long M. A cytosolic NADP-malic enzyme gene from rice (Oryza sativa L.) confers salt tolerance in transgenic Arabidopsis. Biotechnology Letters. 2007;29:1129–1134. doi: 10.1007/s10529-007-9347-0. [DOI] [PubMed] [Google Scholar]
  11. Chuck G, Cigan AM, Saeteurn K, Hake S. The heterochronic maize mutant Corngrass1 results from overexpression of a tandem microRNA. Nature Genetics. 2007;39:544–549. doi: 10.1038/ng2001. [DOI] [PubMed] [Google Scholar]
  12. Chuck G, Meeley R, Irish E, Sakai H, Hake S. The maize tasselseed4 microRNA controls sex determination and meristem cell fate by targeting Tasselseed6/indeterminate spikelet1. Nature Genetics. 2007;39:1517–1521. doi: 10.1038/ng.2007.20. [DOI] [PubMed] [Google Scholar]
  13. Dai M, Hu Y, Ma Q, Zhao Y, Zhou DX. Functional analysis of rice HOMEOBOX4 (Oshox4) gene reveals a negative function in gibberellin responses. Plant Molecular Biology. 2008;66:289–301. doi: 10.1007/s11103-007-9270-8. [DOI] [PubMed] [Google Scholar]
  14. Fang Q, Xu Z, Song R. Cloning, characterization and genetic engineering of FLC homolog in Thellungiella halophila. Biochemical and Biophysical Research Communications. 2006;347:707–714. doi: 10.1016/j.bbrc.2006.06.165. [DOI] [PubMed] [Google Scholar]
  15. Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK. A miRNA involved in phosphate-starvation response in Arabidopsis. Current Biology. 2005;15:2038–2043. doi: 10.1016/j.cub.2005.10.016. [DOI] [PubMed] [Google Scholar]
  16. Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M. Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature. 2001;414:271–276. doi: 10.1038/35104500. [DOI] [PubMed] [Google Scholar]
  17. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Research. 2008;36:154–158. doi: 10.1093/nar/gkm952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proceedings of the National Academy of Sciences; USA. 2006. pp. 12987–12992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jones-Rhoades MW, Bartel DP. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Molecular Cell. 2004;14:787–799. doi: 10.1016/j.molcel.2004.05.027. [DOI] [PubMed] [Google Scholar]
  20. Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature. 2004;428:84–88. doi: 10.1038/nature02363. [DOI] [PubMed] [Google Scholar]
  21. Kim DW, Shibato J, Agrawal GK, et al. Gene transcription in the leaves of rice undergoing salt-induced morphological changes (Oryza sativa L.) Molecules and Cells. 2007;24:45–59. [PubMed] [Google Scholar]
  22. Kim SG, Kim SY, Park CM. A membrane-associated NAC transcription factor regulates salt-responsive flowering via FLOWERING LOCUS T in Arabidopsis. Planta. 2007;226:647–654. doi: 10.1007/s00425-007-0513-3. [DOI] [PubMed] [Google Scholar]
  23. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. MicroRNA genes are transcribed by RNA polymerase II. EMBO Journal. 2004;23:4051–4060. doi: 10.1038/sj.emboj.7600385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lescot M, Déhais P, Thijs G, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research. 2002;30:325–327. doi: 10.1093/nar/30.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Liu HH, Tian X, Li YJ, Wu CA, Zheng CC. Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA. 2008;14:836–843. doi: 10.1261/rna.895308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL. Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis. The Plant Cell. 2005;17:2186–2203. doi: 10.1105/tpc.105.033456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Megraw M, Baev V, Rusinov V, Jensen ST, Kalantidis K, Hatzigeorgiou AG. MicroRNA promoter element discovery in Arabidopsis. RNA. 2006;12:1612–1619. doi: 10.1261/rna.130506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mica E, Gianfranceschi L, Pè ME. Characterization of five microRNA families in maize. Journal of Experimental Botany. 2006;57:2601–2612. doi: 10.1093/jxb/erl013. [DOI] [PubMed] [Google Scholar]
  29. Millar AA, Gubler F. The Arabidopsis GAMYB-like genes, MYB33 and MYB65, are microRNA-regulated genes that redundantly facilitate anther development. The Plant Cell. 2005;17:705–721. doi: 10.1105/tpc.104.027920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Navarro L, Dunoyer P, Jay F, et al. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science. 2006;312:436–439. doi: 10.1126/science.1126088. [DOI] [PubMed] [Google Scholar]
  31. Phillips JR, Dalmay T, Bartels D. The role of small RNAs in abiotic stress. FEBS Letters. 2007;581:3592–3597. doi: 10.1016/j.febslet.2007.04.007. [DOI] [PubMed] [Google Scholar]
  32. Prashanth SR, Sadhasivam V, Parida A. Over expression of cytosolic copper/zinc superoxide dismutase from a mangrove plant Avicennia marina in indica rice var Pusa Basmati-1 confers abiotic stress tolerance. Transgenic Research. 2008;17:281–291. doi: 10.1007/s11248-007-9099-6. [DOI] [PubMed] [Google Scholar]
  33. Shin D, Koo YD, Lee J, et al. Athb-12, a homeobox-leucine zipper domain protein from Arabidopsis thaliana, increases salt tolerance in yeast by regulating sodium exclusion. Biochemical and Biophysical Research Communications. 2004;323:534–540. doi: 10.1016/j.bbrc.2004.08.127. [DOI] [PubMed] [Google Scholar]
  34. Sunkar R, Zhu JK. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. The Plant Cell. 2004;16 doi: 10.1105/tpc.104.022830. 2001–2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sunkar R, Chinnusamy V, Zhu J, Zhu JK. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends in Plant Science. 2007;12:301–309. doi: 10.1016/j.tplants.2007.05.001. [DOI] [PubMed] [Google Scholar]
  36. Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biology. 2008;8:25. doi: 10.1186/1471-2229-8-25. doi:10.1186/1471-2229-8-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tiwari SB, Hagen G, Guilfoyle T. The roles of auxin response factor domains in auxin-responsive transcription. The Plant Cell. 2003;15:533–543. doi: 10.1105/tpc.008417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ulmasov T, Hagen G, Guilfoyle TJ. ARF1, a transcription factor that binds to auxin response elements. Science. 1997;276:1865–1868. doi: 10.1126/science.276.5320.1865. [DOI] [PubMed] [Google Scholar]
  39. Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP. Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods. 2007;3:12. doi: 10.1186/1746-4811-3-12. doi:10.1186/1746-4811-3-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Vaucheret H, Mallory AC, Bartel DP. AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Molecular Cell. 2006;22:129–136. doi: 10.1016/j.molcel.2006.03.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vinocur B, Altman A. Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations. Current Opinion in Biotechnology. 2005;16:123–132. doi: 10.1016/j.copbio.2005.02.001. [DOI] [PubMed] [Google Scholar]
  42. Williams L, Grigg SP, Xie M, Christensen S, Fletcher JC. Regulation of Arabidopsis shoot apical meristem and lateral organ formation by microRNA miR166 g and its AtHD-ZIP target genes. Development. 2005;132:3657–3668. doi: 10.1242/dev.01942. [DOI] [PubMed] [Google Scholar]
  43. Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC. Expression of Arabidopsis MIRNA genes. Plant Physiology. 2005;138:2145–2154. doi: 10.1104/pp.105.062943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Xu DQ, Huang J, Guo SQ, et al. Overexpression of a TFIIIA-type zinc finger protein gene ZFP252 enhances drought and salt tolerance in rice (Oryza sativa L.) FEBS Letters. 2008;582:1037–1043. doi: 10.1016/j.febslet.2008.02.052. [DOI] [PubMed] [Google Scholar]
  45. Yan S, Tang Z, Su W, Sun W. Proteomic analysis of salt stress-responsive proteins in rice root. Proteomics. 2005;5:235–244. doi: 10.1002/pmic.200400853. [DOI] [PubMed] [Google Scholar]
  46. Zhang Y. miRU: an automated plant miRNA target prediction server. Nucleic Acids Research. 2005;33:W701–W704. doi: 10.1093/nar/gki383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang ZX, Wei LY, Zou XL, Tao YS, Liu ZJ, Zheng YL. Submergence-responsive microRNAs are potentially involved in the regulation of morphological and metabolic adaptations in maize root cells. Annals of Botany. 2008;102:509–519. doi: 10.1093/aob/mcn129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhao B, Liang R, Ge L, et al. Identification of drought-induced microRNAs in rice. Biochemical and Biophysical Research Communications. 2007;354:585–590. doi: 10.1016/j.bbrc.2007.01.022. [DOI] [PubMed] [Google Scholar]
  49. Zhou X, Wang G, Zhang W. UV-B responsive microRNA genes in Arabidopsis thaliana. Molecular Systems Biology. 2007;3:103. doi: 10.1038/msb4100143. doi:10.1038/msb4100143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhou X, Wang G, Sutoh K, Zhu JK, Zhang W. Identification of cold-inducible microRNAs in plants by transcriptome analysis. Biochimica et Biophysica Acta. 2008 doi: 10.1016/j.bbagrm.2008.04.005. In press. doi:10.1016/j.bbagrm.2008.04.005. [DOI] [PubMed] [Google Scholar]

Articles from Annals of Botany are provided here courtesy of Oxford University Press

RESOURCES