Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2009 Apr 29;47(7):2090–2096. doi: 10.1128/JCM.02048-08

Putative Adhesins of Enteropathogenic and Enterohemorrhagic Escherichia coli of Serogroup O26 Isolated from Humans and Cattle ▿

Marjorie Bardiau 1,*, Sabrina Labrozzo 1, Jacques G Mainil 1
PMCID: PMC2708474  PMID: 19403767

Abstract

Enterohemorrhagic Escherichia coli (EHEC) strains are responsible for food poisoning in developed countries via consumption of vegetal and animal food sources contaminated by ruminant feces, and some strains (O26, O111, and O118 serogroups) are also responsible for diarrhea in young calves. The prevalence of 27 putative adhesins of EHEC and of bovine necrotoxigenic E. coli (NTEC) was studied with a collection of 43 bovine and 29 human enteropathogenic (EPEC) and EHEC strains and 5 non-EPEC/non-EHEC (1 bovine and 4 human) O26 strains, using specific PCRs. Four “groups” of adhesins exist, including adhesins present in all O26 strains, adhesins present in most O26 strains, adhesins present in a few O26 strains, and adhesins not present in O26 strains. The common profile of EHEC/EPEC strains was characterized by the presence of loc3, loc5, loc7, loc11, loc14, paa, efa1, iha, lpfAO26, and lpfAO113 genes and the absence of loc1, loc2, loc6, loc12, loc13, saa, and eibG genes. Except for the lpfAO26 gene, which was marginally associated with bovine EHEC/EPEC strains in comparison with human strains (P = 0.012), none of the results significantly differentiated bovine strains from human strains. One adhesin gene (ldaE) was statistically (P < 0.01) associated with O26 EHEC/EPEC strains isolated from diarrheic calves in comparison with strains isolated from healthy calves. ldaE-positive strains could therefore represent a subgroup possessing the specific property of producing diarrhea in young calves. This is the first time that the distribution of putative adhesins has been described for such a large collection of EHEC/EPEC O26 strains isolated from both humans and cattle.


Enteropathogenic (EPEC) and enterohemorrhagic (EHEC) Escherichia coli strains represent two important classes of enteric pathogens that cause diarrhea in humans and animals. They have in common the ability to produce a histopathological lesion on enterocytes, called an “attaching and effacing” lesion. The intimate attachment of the bacteria to enterocytes and the localized effacement of microvilli are the main characteristics of the attaching and effacing lesion (26).

EPEC strains are an important cause of infant diarrhea in developing countries and are often associated with high mortality rates (8). Human EPEC strains are subdivided into classical (type 1) and nonclassical (type 2) strains on the basis of the production of bundle-forming pili or the presence of the encoding genes. Nonclassical EPEC strains are also present in different animal species. In bovines, nonclassical EPEC strains are associated with diarrhea in young calves of up to 3 months of age (9).

EHEC strains are considered to have evolved from EPEC strains through the acquisition of bacteriophages encoding Shiga toxins (Stxs) (31, 45). EHEC strains cause several clinical syndromes in humans (mainly in children and elderly people), such as diarrhea, hemorrhagic colitis, hemolytic-uremic syndrome, and thrombotic thrombocytopenic purpura. These have been responsible for large outbreaks in many developed countries, especially Japan, the United States, and the United Kingdom (26). Transmission can occur via consumption of vegetal and animal foodstuffs contaminated by ruminant feces (mainly cattle) (7). Some EHEC strains are also responsible for undifferentiated diarrhea in young calves of up to 3 months of age (24).

EPEC and EHEC strains can belong to more than 1,000 O:H serotypes. In EHEC infections, O157:H7 is the main serotype responsible for several outbreaks and sporadic cases of hemorrhagic colitis and hemolytic-uremic syndrome, but non-O157 serogroups (such as O26, O145, O111, and O103) can also be associated frequently with severe illness in humans (5, 35). Though most, if not all, EHEC serogroups are carried by healthy animal ruminants, a few are associated with diarrhea in calves (O5, O26, O111, O118, etc.). Human and animal EPEC strains also belong to a series of O antigenic groups, including O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158 (6). Thus, several serogroups are present in both pathotypes (EHEC and EPEC) and can infect both humans and cattle. Although classical EPEC strains have always been regarded as host specific, EHEC strains have not, and the actual situation regarding nonclassical EPEC strains remains unknown.

The first step in EPEC and EHEC infection is the initial adherence of bacteria to intestinal cells. This adherence step could be the basis for any host specificity via the production of colonization factors, such as the bundle-forming pilus adhesin of classical human EPEC strains.

Low et al. analyzed 14 putative fimbrial gene clusters revealed by the EHEC O157:H7 Sakai sequence (21). Of these 14 putative fimbriae, several had already been described under other names, including LpfA1 (42), LpfA2 (43), F9 (20), type 1 fimbriae (32) (34), and curli fimbriae (30). Long polar fimbria (Lpf)-encoding genes had also been described previously, including lpfAO26 and lpfAO113, described by Toma et al. (41) and Doughty et al. (12), respectively.

In addition, other putative adhesins have been described, as follows: a 67-kDa adherence-conferring protein (Iha) similar to Vibrio cholerae IrgA confers the capacity to adhere to epithelial cells in a diffuse pattern (38); Efa1 (EHEC factor for adherence), described by Nicholls et al. (27), mediates the binding of bacteria to CHO cells in vitro; ToxB, a protein encoded by a gene located on the 93-kb pO157 plasmid, is required for full adherence of the EHEC O157:H7 Sakai strain (39); Saa is an autoagglutinating adhesin identified in locus of enterocyte effacement-negative verotoxigenic E. coli strains (29); EibG is a protein responsible for the chain-like adherence phenotype of Saa-negative verotoxigenic E. coli strains (22); Paa (porcine attaching and effacing-associated) adhesin, described by An et al. (1), is involved in the early steps of the adherence mechanism of porcine EPEC strains (2); and the hemorrhagic coli pilus (HCP), whose inactivation of the main subunit (hcpA gene) reduces adherence to cultured human intestinal and bovine renal epithelial cells and to porcine and bovine gut explants, was observed in EHEC O157:H7 (46).

The aim of this study was to establish the prevalence in bovine and human EPEC and EHEC strains belonging to the O26 serogroup of a total of 23 putative adhesins previously described for EHEC strains and of four fimbrial and afimbrial adhesins associated with bovine necrotoxigenic E. coli (NTEC) (36). The presence of these genes was correlated, on the one hand, with the source of isolation, and on the other hand, with EHEC/EPEC virulence factors (eae, stx1, stx2, and EHEC hlyA).

MATERIALS AND METHODS

Bacterial strains.

A total of 77 strains of serogroup O26 isolated in the United States, Ireland, Belgium, France, Japan, and Brazil were studied (Table 1) and included 5 non-EPEC/non-EHEC strains, 28 EPEC strains, and 44 EHEC strains. Forty-four strains were isolated from the feces or intestines of young calves (1 non-EPEC/non-EHEC, 18 EPEC, and 25 EHEC strains), and 33 strains were isolated from humans (4 non-EPEC/non-EHEC, 10 EPEC, and 19 EHEC strains). Most of the strains had been described previously (37), but their pathotype (EPEC or EHEC) and serotype O26:H11 status were confirmed by PCR for the stx1, stx2, eae, EHEC hlyA, wzx-wzyO26, and fliCH11 genes (Table 1) (10, 13, 15).

TABLE 1.

Serotypes, sources of isolation, geographical origins, and pathotypes of tested strains

Strain Host Status of hosta Origin EPEC or EHEC Presence of adhesin gene or variant (for stx)
eae stx EHEC hlyA wzx-wzyO26 fliCH11
TC3108 Cattle Healthy United States EHEC + 1 − + +
TC3109 Cattle Healthy United States EHEC + 1 + + +
TC3117 Cattle Healthy United States EHEC + 1 + + +
TC3180 Cattle Healthy United States EHEC + 1 + + +
TC3269 Cattle Healthy United States EHEC + 1 + + +
TC3273 Cattle Healthy United States EHEC + 1 + + +
TC3302 Cattle Healthy United States EHEC + 1 + + +
TC3305 Cattle Healthy United States EHEC + 1 + + +
TC3375 Cattle Healthy United States EHEC + 1 + + +
TC3380 Cattle Healthy United States EHEC + 1 + + +
TC3629 Cattle Healthy United States EHEC + 1 + + +
TC3630 Cattle Healthy United States EHEC + 1 + + +
TC3631 Cattle Healthy United States EHEC + 1 + + +
TC3632 Cattle Healthy United States EHEC + 1 + + +
TC3656 Cattle Healthy United States EHEC + 1 + + +
TC3657 Cattle Healthy United States EHEC + 1 + + +
TC6169 Cattle Diarrheic United States EHEC + 1 + + +
4276 Cattle Diarrheic Ireland EHEC + 1 + + +
A39 Cattle ? ? EHEC + 1 + + +
357S89 Cattle Diarrheic Belgium EHEC + 1 + + +
379S89 Cattle Diarrheic Belgium EHEC + 1 + + +
122 Cattle ? ? EHEC + 1 + + +
63 Cattle ? ? EHEC + 1 + + +
A14 Cattle ? ? EHEC + 1 + + +
331S89 Cattle Diarrheic Belgium EHEC + 1 + + +
EH031 Human Diarrheic Belgium EHEC + 1 + + +
EH182 Human Diarrheic Belgium EHEC + 1 + + +
EH193 Human Diarrheic Belgium EHEC + 2 + + +
EH296 Human Diarrheic Belgium EHEC + 2 + + +
EH298 Human Diarrheic Belgium EHEC + 2 + + +
EH196 Human Diarrheic Belgium EHEC + 2 + + +
EH284 Human Diarrheic Belgium EHEC + 1 + + +
EH322 Human Diarrheic Belgium EHEC + 1 + + +
EH324 Human Diarrheic Belgium EHEC + 1 + + +
TC5710 Human HUS United States EHEC + 1 and 2 − + +
TC5711 Human HUS United States EHEC + 1 + + +
TC6168 Human Diarrheic United States EHEC + 1 − + +
02/113 Human ? France EHEC + 1 + + +
99/109 Human ? France EHEC + 2 + + +
03/151 Human ? France EHEC + 1 + + +
03/139 Human ? France EHEC + 1 + + +
99/145 Human ? France EHEC + 1 + + +
99/147 Human ? France EHEC + 1 + + +
11368 Human Diarrheic Japan EHEC + 1 + + +
TC1988 Human ? Brazil EPEC + − + + +
TC3145 Cattle Healthy United States EPEC + − + + +
TC3486 Cattle Healthy United States EPEC + − + + +
TC3748 Cattle Healthy United States EPEC + − + + +
TC4004 Cattle Healthy United States EPEC + − + + +
TC4219 Cattle Healthy United States EPEC + − + + +
TC4221 Cattle Healthy United States EPEC + − + + +
TC3848 Cattle Healthy United States EPEC + − + + +
TC659 Cattle Diarrheic United States EPEC + − + + +
333KH91 Cattle Diarrheic Belgium EPEC + − + + +
334KH91 Cattle Diarrheic Belgium EPEC + − − + +
351KH91 Cattle Diarrheic Belgium EPEC + − − + +
352KH91 Cattle Diarrheic Belgium EPEC + − + + +
631KH91 Cattle Diarrheic Belgium EPEC + − − + +
C15333 Cattle ? ? EPEC + − − + +
331KH91 Cattle Diarrheic Belgium EPEC + − − + +
335KH91 Cattle Diarrheic Belgium EPEC + − − + +
355KH91 Cattle Diarrheic Belgium EPEC + − − + +
354KH91 Cattle Diarrheic Belgium EPEC + − − + +
TC6165 Human Diarrheic United States EPEC + − + + +
TC6166 Human Diarrheic United States EPEC + − + + +
TC6167 Human Healthy United States EPEC + − − + +
03/178 Human ? France EPEC + − + + +
00/054 Human ? France EPEC + − + + +
00/106 Human ? France EPEC + − − + +
00/113 Human ? France EPEC + − − + +
02/145 Human ? France EPEC + − − + +
02/057 Human ? France EPEC + − − + +
T282 Cattle Diarrheic United States Non-EPEC/non-EHEC − − − + +
00/103 Human ? France Non-EPEC/non-EHEC − − − + +
00/130 Human ? France Non-EPEC/non-EHEC − − − + +
03/023 Human ? France Non-EPEC/non-EHEC − − − + +
C4071 Human ? France Non-EPEC/non-EHEC − − − + +
a

HUS, hemolytic-uremic syndrome.

The following positive controls were used: strains EH017 and EH383 (for the 14 putative fimbrial gene clusters, toxB gene, paa gene, iha gene, and hcpA gene), strain 239KH89 (for the afa8-E gene), strain 25KH9 (for the f17A gene), and strain 31A (for the clpG and clpE genes). The nonpathogenic strain HS (O9:H4) was used as a negative control.

PCR.

All primers used in this study are listed in Table 2. DNA templates were prepared by boiling, as previously described (10). For PCRs, the following mixture was used: 1 U of Taq DNA polymerase (New England Biolabs), 5 μl of a mixture with a 2 mM concentration of each deoxynucleoside triphosphate, 5 μl of 10× ThermoPol reaction buffer [20 mM Tris-HCl (pH 8.8, 25°C), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100], 5 μl of each primer (10 μM), and 3 μl of DNA template in a total volume of 50 ml. All PCR conditions have been described previously (Table 2), and the annealing temperatures are listed in Table 2. Some PCRs were performed in duplicate to confirm the results.

TABLE 2.

Primers used in this study

Primer Sequence (5′ to 3′) Target Annealing temp (°C) Amplicon size (bp) Reference
loc1-F CGACAACGTTGATGTTTAGC loc1 main subunit 48 300-500 21
loc1-R GCCTTTTGTAACAGGATTGC
loc2-F GGTATGCATAGCGTTACC loc2 main subunit 42 300-500 21
loc2-R CTGCTGGCAAATCTTATGC
loc3-F GCGGTACAATTCACTTTGAAGG loc3 main subunit 53 300-500 21
loc3-R CATTTGCTTGCCCTGCTGATGC
loc4-F GCCATATCTCTACTATTCGC loc4 main subunit 43 300-500 21
loc4-R GTTATCCATCTGTTCCATCC
loc5-F CTGTGGTATGTGCAACGTCC loc5 main subunit 51 300-500 21
loc5-R CCCCGTAGCGATATAATCAAC
loc6-F CCTACAGTCACTTTTCAGGG loc6 main subunit 44 300-500 21
loc6-R GATTAATTAGAGGTAGCTCAGG
loc7-F CTTCATTTAATCAGGCAGCC loc7 main subunit 47 300-500 21
loc7-R GAGTACCATACTGTGTAATATTTGC
loc8-F GGTGATGAATCAGTAACGACC loc8 main subunit 48 300-500 21
loc8-R GTGCCATCAATCAAGTCGG
loc9-F CACCATGTACATTTGTCGC loc9 main subunit 46 300-500 21
loc9-R CAGTACGTCACTGCTATCTCC
loc10-F GCTGCAACAATGGTAATGGG loc10 main subunit 53 300-500 21
loc10-R GTAATCTGGAAGGTCGTGTTGGC
loc11-F CTTTTCGCAGGTAATGCCG loc11 main subunit 50 300-500 21
loc11-R GATTTCGGATGCTTCAACG
loc12-F GTGGTATCGCAATCTTCC loc12 main subunit 42 300-500 21
loc12-R GGTAAAGTAGAGAACCG
loc13-F GATTGTAGGAGCATTAGCG loc13 main subunit 45 300-500 21
loc13-R CTATCGATCTGACTCAATGCC
loc14-F GTCGTTGCTGCCAATGTTTGC loc14 main subunit 48 300-500 21
loc14-R GAAATGTAGCGAAGTAGAGCC
LpfA-O26-F GTT CTG TTT GCC TTA TCT GC lpfAO26 52 509 40, 41
LpfA-O26-R TAA GTC AGG TTG AAG TCG AC
LpfA-O113-F ATGAAGCGTTAATATTATAG lpfAO113 50 573 28
LpfA-O113-R TTATTTCTTATATTCGAC
efa1-F TAA GCG AGC CCT GAT AAG CA efa1 55 630 17
efa1-R CGT GTT GCT TGC CTT TGC
toxB-F ATACCTACCTGCTCTGGATTGA toxB 55 602 41
toxB-R TTCTTACCTGATCTGATGCAGC
afa8-E-F CTAACTTGCCATGCTGTGACAGTA afa8-E 65 302 36
afa8-E-R TTATCCCCTGCGTAGTTGTGAATC
f17A-F GCAGAAAATTCAATTTATCCTTGG f17A 55 537 36
f17A-R CTGATAAGCGATGGTGTAATTAAC
clpE-F GGTCAGGCCTGGGTGGACAATATC clpE 58 240 36
clpE-R GCGATAGAACAGTTTCAGCTTCGT
clpG-F GGGCGCTCTCTCCTTCAAC clpG 55 403 36
clpG-R CGCCCTAATTGCTGGCGAC
paa-F TCAGAACAATCTGCTCTGGCTA paa 52 413 19
paa-R CACGTAGTCTGGCGCTATTTC
iha-F CAAATGGCTCTCTTCCGTCAATGC iha 59 925 36
iha-F CAGGTCGGGGTTACCAAGT
saa-F CGTGATGAACAGGCTATTGC saa 50 119 18
saa-R ATGGACATGCCTGTGGCAAC
eibG-F ATCGGCTTTCATCGCATCAGGAC eibG 60 ? 22
eibG-R CCACAAGGCGGGTATTCGTATC
B52 AGGCTTCGTCACAGTTG eaeA 50 570 10
B53 CCATCGTCACCAGAGGA
B54 AGAGCGATGTTACGGTTTG sltI 50 388 10
B55 TTGCCCCCAGAGTGGATG
B56 TGGGTTTTTCTTCGGTATC sltII 50 807 10
B57 GACATTCTGGTTGACTCTCTT
EHEC-hlyA-F ACGATGTGGTTTATTCTGGA EHEC hlyA 58 165 15
EHEC-hlyA-R CTTCACGTGACCATACATAT
wzx-wzyO26-F AAATTAGAAGCGCGTTCATC wzx-wzyO26 56 596 13
wzx-wzyO26-R CCCAGCAAGCCAATTATGACT
fliC-H11-F ACTGTTAACGTAGATAGC fliCH11 56 224 13
fliC-H11-R TCAATTTCTGCAGAATATAC
G98-F TCGCTAGTTGCTGACAGATTT hcpA 49 ? 46
G99-R AATGTCTGTTGTGTGCGACTG
ldaG-F ATGAAAAAGACACTATTAGCACTGG ldaG 48 ? 33
ldaG-R TGAATCTCCCAGCCAAAA
loc4U1-F CCTCTATGTCGCACCACAC loc4 usher1 48 300-500 21
loc4U1-R GTCGGCGTCATTGTATTTG
loc4U2-F GCTCAATCAAAAAGGCGTC loc4 usher2 46 300-500 21
loc4U2-R CCGTTATTCCACGTTGAG
loc9U1-F GGATAATAATCCTGGTGAGTG loc9 usher1 46 300-500 21
loc9U1-R CACTTTGCTTGCTCGCAC
loc9U2-F GGAACCGCGATCAGTTTA loc9 usher2 46 300-500 21
loc9U2-R GCTGTCCATCGGATCTTA
loc9fim-F GCATTGAAGTTTAACTGGTG loc9 fimbrial subunit 44 300-500 21
loc9fim-R CCTGGTTTATCTGTTTTCC
loc10U1-F GATGACGATGTTATCAACGG loc10 usher1 48 300-500 21
loc10U1-R GAAGAAACCGCCTTCCAC
loc10U2-F GGAGTTATGTCAATGCCT loc10 usher2 42 300-500 21
loc10U2-R GGATCCCAGTTGATGTCG

DNA sequencing.

The DNA fragments were purified using a NucleoSpin Extract II kit (Macherey-Nagel, Germany) according to the manufacturer's instructions. Sequencing of the two DNA strands was performed by the dideoxynucleotide triphosphate chain termination method with an ABI 3730 capillary sequencer and a BigDye Terminator kit, version 3.1 (Applied Biosystems), at the Groupe Interdisciplinaire de Génoprotéomique Appliquée (University of Liège, Belgium). Sequence analysis was performed using Vector NTI 10.1.1 (Invitrogen).

Statistical analysis.

Fisher's exact test was performed to assess statistical differences (P < 0.01).

RESULTS

Distribution of putative EPEC and EHEC adhesin-encoding genes.

The distribution of putative EPEC and EHEC adhesin-encoding genes is shown in Table 3. The following genes were detected in the majority of the strains: loc3 (in 100% of the strains), loc14 (in 100% of the strains), loc5 (in 99% of the strains), loc7 (in 99% of the strains), loc8 (in 83% of the strains), loc11 (in 97% of the strains), efa1 (in 92% of the strains), toxB (in 79% of the strains), paa (in 97% of the strains), iha (in 92% of the strains), lpfAO26 (in 94% of the strains), and lpfAO113 (in 95% of the strains).

TABLE 3.

Distribution of putative adhesin genes

Strain type No. of strains tested No. (%) of strains positive for gene by PCR
loc1 loc2 loc3 loc4 loc5 loc6 loc7 loc8 loc9 loc10 loc11 loc12 loc13 loc14 efa1 toxB afa8-E f17A ldaE clpE/clpG paa iha saa eibG lpfAO26 lpfAO113 hcpA
Total 77 0 (0) 0 (0) 77 (100) 2 (3) 76 (99) 0 (0) 76 (99) 64 (83) 3 (4) 2 (3) 75 (97) 0 (0) 0 (0) 77 (100) 71 (92) 61 (79) 4 (5) 2 (3) 17 (22) 1 (1) 75 (97) 71 (92) 0 (0) 0 (0) 72 (94) 73 (95) 4 (5)
Bovine strains 44 0 (0) 0 (0) 44 (100) 1 (2) 43 (98) 0 (0) 43 (98) 38 (86) 2 (5) 1 (2) 44 (100) 0 (0) 0 (0) 44 (100) 43 (98) 37 (84) 4 (9) 2 (5) 11 (25) 1 (2) 43 (98) 43 (98) 0 (0) 0 (0) 44 (100) 43 (98) 3 (7)
Human strains 33 0 (0) 0 (0) 33 (100) 1 (3) 33 (100) 0 (0) 33 (100) 26 (79) 1 (3) 1 (3) 31 (94) 0 (0) 0 (0) 33 (100) 28 (85) 24 (73) 0 (0) 0 (0) 6 (18) 0 (0) 32 (97) 28 (85) 0 (0) 0 (0) 28 (85) 30 (91) 1 (3)
stx1-positive strains 38 0 (0) 0 (0) 38 (100) 1 (3) 38 (100) 0 (0) 37 (97) 30 (79) 2 (5) 0 (0) 38 (100) 0 (0) 0 (0) 38 (100) 38 (100) 36 (95) 0 (0) 0 (0) 3 (8) 0 (0) 38 (100) 38 (100) 0 (0) 0 (0) 38 (100) 38 (100) 1 (3)
stx2-positive strains 5 0 (0) 0 (0) 5 (100) 0 (0) 5 (100) 0 (0) 5 (100) 4 (80) 0 (0) 0 (0) 5 (100) 0 (0) 0 (0) 5 (100) 5 (100) 5 (100) 0 (0) 0 (0) 0 (0) 0 (0) 5 (100) 5 (100) 0 (0) 0 (0) 5 (100) 5 (100) 0 (0)
stx1- and stx2-positive strains 1 0 (0) 0 (0) 1 (100) 0 (0) 1 (100) 0 (0) 1 (100) 1 (100) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0)
EPEC strains 28 0 (0) 0 (0) 28 (100) 0 (0) 27 (96) 0 (0) 28 (100) 27 (96) 0 (0) 1 (4) 28 (100) 0 (0) 0 (0) 28 (100) 27 (96) 19 (68) 4 (14) 2 (7) 14 (50) 1 (4) 27 (96) 26 (93) 0 (0) 0 (0) 27 (96) 27 (96) 2 (7)
Non-EPEC/non-EHEC strains 5 0 (0) 0 (0) 5 (100) 1 (20) 5 (100) 0 (0) 5 (100) 2 (40) 1 (20) 0 (0) 3 (600) 0 (0) 0 (0) 5 (100) 0 (0) 1 (20) 0 (0) 0 (0) 0 (0) 0 (0) 4 (80) 1 (20) 0 (0) 0 (0) 1 (20) 2 (40) 1 (20)
EHEC strains 44 0 (0) 0 (0) 44 (100) 1 (2) 44 (100) 0 (0) 43 (98) 35 (80) 2 (5) 1 (2) 44 (100) 0 (0) 0 (0) 44 (100) 44 (100) 41 (93) 0 (0) 0 (0) 3 (7) 0 (0) 44 (100) 44 (100) 0 (0) 0 (0) 44 (100) 44 (100) 1 (2)
Belgian strains 21 0 (0) 0 (0) 21 (100) 0 (0) 20 (95) 0 (0) 21 (100) 17 (81) 0 (0) 1 (5) 21 (100) 0 (0) 0 (0) 21 (100) 21 (100) 16 (76) 4 (19) 2 (10) 7 (33) 1 (5) 20 (95) 20 (95) 0 (0) 0 (0) 21 (100) 20 (95) 3 (14)
Brazilian strains 1 0 (0) 0 (0) 1 (100) 0 (0) 1 (100) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 1 (100) 0 (0) 0 (0) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0)
French strains 16 0 (0) 0 (0) 16 (100) 1 (6) 16 (100) 0 (0) 16 (100) 12 (75) 1 (6) 0 (0) 14 (88) 0 (0) 0 (0) 16 (100) 11 (69) 9 (56) 0 (0) 0 (0) 3 (19) 0 (0) 15 (94) 11 (69) 0 (0) 0 (0) 11 (69) 13 (81) 1 (6)
Irish strains 1 0 (0) 0 (0) 1 (100) 0 (0) 1 (100) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 1 (100) 0 (0) 0 (0) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0)
Japanese strains 1 0 (0) 0 (0) 1 (100) 0 (0) 1 (100) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 1 (100) 0 (0) 0 (0) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0) 0 (0) 1 (100) 1 (100) 0 (0)
American strains 32 0 (0) 0 (0) 32 (100) 0 (0) 32 (100) 0 (0) 32 (100) 27 (84) 1 (3) 1 (3) 32 (100) 0 (0) 0 (0) 32 (100) 31 (97) 29 (91) 0 (0) 0 (0) 3 (9) 0 (0) 32 (100) 32 (100) 0 (0) 0 (0) 32 (100) 32 (100) 0 (0)
Strains of unknown origin 5 0 (0) 0 (0) 5 (100) 1 (20) 5 (100) 0 (0) 4 (80) 5 (100) 1 (20) 0 (0) 5 (100) 0 (0) 0 (0) 5 (100) 5 (100) 4 (80) 0 (0) 0 (0) 4 (80) 0 (0) 5 (100) 5 (100) 0 (0) 0 (0) 5 (100) 5 (100) 0 (0)
European strains 38 0 (0) 0 (0) 38 (100) 1 (3) 37 (97) 0 (0) 38 (100) 30 (79) 1 (3) 1 (3) 36 (95) 0 (0) 0 (0) 38 (100) 33 (87) 26 (68) 4 (11) 2 (5) 10 (26) 1 (3) 36 (95) 32 (84) 0 (0) 0 (0) 33 (87) 34 (89) 0 (0)
Diarrheic bovine strains 16 0 (0) 0 (0) 16 (100) 0 (0) 15 (94) 0 (0) 16 (100) 15 (94) 1 (6) 1 (6) 16 (100) 1 (6) 0 (0) 16 (100) 15 (94) 11 (69) 4 (25) 2 (13) 7 (44) 1 (6) 15 (94) 15 (94) 12 (75) 0 (0) 16 (100) 15 (94) 3 (19)
Healthy bovine strains 23 0 (0) 0 (0) 23 (100) 0 (0) 23 (100) 0 (0) 23 (100) 18 (78) 0 (0) 0 (0) 23 (100) 0 (0) 0 (0) 23 (100) 23 (100) 22 (96) 0 (0) 0 (0) 0 (0) 0 (0) 23 (100) 23 (100) 19 (83) 0 (0) 23 (100) 23 (100) 0 (0)

In addition, a few strains were positive for some adhesins that have not yet been described for EPEC/EHEC O26 strains, including hcpA (four strains), loc4 (two strains), loc9 (three strains), and loc10 (two strains). These amplicons were sequenced for further identification and comparison. The four hcpA amplicon sequences had 100% identity with the hcpA gene. The two loc4 amplicon sequences were 69% identical to the loc4 gene of the positive control and 100% identical to the ybgD gene of Shigella, coding for a putative fimbrial subunit-like protein. Nevertheless, the two usher protein-encoding genes (loc4 usher1 and loc4 usher2 genes) associated with the loc4 fimbriae were not detected in those two strains. The three loc9 amplicon sequences were identical to the amplicon sequence of the positive control. The two usher protein-encoding genes and the fimbrial subunit-encoding gene (loc9 usher1, loc9 usher2, and loc9 fimbrial subunit genes) were also detected in the three strains by PCR. One of the two loc10 amplicon sequences was identical to the loc10 gene, whereas the second one had only 74% identity. The latter sequence was 99% identical to the yfcV gene, coding for a putative fimbrial subunit of E. coli UTI89. However, the two usher protein-encoding genes (loc4 usher1 and loc4 usher2 genes) associated with the loc10 fimbriae were detected in neither strain. Three genes, loc1, loc2, and loc6, were not detected in any of the strains.

Distribution of putative NTEC adhesin-encoding genes.

Fimbrial and afimbrial adhesins (Afa8-E, F17A, ClpG, and ClpE) associated with bovine NTEC strains had previously been used as search targets for 24 EHEC and EPEC strains of serogroup O26 (36). We extended the adhesin search to 77 strains. Four strains were afa8-E positive, 2 strains were f17A positive, 1 strain was clpG positive, and 18 strains (25%) were clpE positive. These amplicons were also further identified and compared after being sequenced. The afa8-E and f17A amplicon sequences were identical to the amplicon sequences of the respective positive controls. One clpE amplicon sequence was 100% identical to the clpE gene. The strain carrying this sequence was also positive for the clpG gene. The other 17 clpE amplicon sequences had 100% identity with each other, 90% identity with the clpE gene, and 100% identity with the ldaE gene, coding for the chaperone of the “locus for diffuse adherence,” described by Scaletsky et al. (33). Eleven of the 17 strains carrying these sequences were also positive for the ldaG gene, coding for the main subunit of the locus for diffuse adherence.

Distribution of putative adhesins according to source of isolation (cattle or humans), geographical origin, and pathotype.

Several adhesin-encoding genes (loc8, loc11, efa1, toxB, iha, lpfAO26, lpfAO113, and ldaE) were statistically associated with the EHEC/EPEC strains in comparison with the non-EPEC/non-EHEC strains (P < 0.01), and the lpfAO26 gene was marginally statistically associated with bovine EHEC/EPEC strains in comparison with human strains (P = 0.012). Moreover, the ldaE gene was statistically associated with the bovine EHEC/EPEC strains isolated from diarrheic calves in comparison with the other bovine strains (P < 0.01) but not in comparison with the human EHEC/EPEC strains. The f17A, afa8-E, and clpG/clpE genes were detected only in the EPEC strains isolated from diarrheic calves in Belgium, though this association was not statistically significant due to the small number of positive strains. For the other adhesins, no relationship was observed between the source (cattle or humans), the geographical origin, or the pathotype of the strains and their prevalence.

DISCUSSION

Studies on the prevalence of putative EHEC adhesins have focused mostly on O157:H7 strains and more rarely on a few non-O157 strains. However, non-O157:H7 serogroups (such as O26, O145, O111, and O103) are frequently associated with severe illness in humans (5), and in many countries, O26 strains are the second most prevalent serogroup of EHEC strains (4). Moreover, O26 strains possess the particularity of producing disease in both humans and calves (23). Evidence also exists that human and bovine EHEC O26 strains are heterogeneous, leading to the hypothesis that at least some of them may be host specific. The step involving the initial adherence of bacteria to intestinal cells could be the basis of such host specificity, as is the case with other pathogenic E. coli strains and virulence factors, such as F18a of porcine verotoxigenic E. coli, AF/R1 and AF/R2 of rabbit enteropathogenic E. coli, F4 and F6 of porcine enterotoxigenic E. coli, etc. (16, 25). Therefore, 77 EHEC and EPEC O26 strains recovered from different sources (human or bovine) in different countries were tested by PCR for the presence of genes coding for 27 putative adhesins previously described or used as search targets for EHEC and EPEC strains (these previous attempts had either not involved O26 strains or used only a limited number of those strains). This is the first time that the distribution of so many putative adhesin-encoding genes has been described for such a large collection of EPEC/EHEC O26 strains.

According to the PCR results, the following four “groups” of adhesin genes exist: adhesin genes present in all O26 strains (loc3 and loc14), adhesin genes present in most O26 strains (loc5, loc7, loc8, loc11, efa1, toxB, paa, iha, lpfAO26, and lpfAO113), adhesin genes present in a few O26 strains (loc4, loc9, loc10, afa8-E, f17A, ldaE, clpE/clpG, and hcpA), and adhesin genes not present in O26 strains (loc1, loc2, loc6, loc12, loc13, saa, and eibG). The common adhesin profile of EHEC/EPEC O26 strains is therefore characterized by the presence of loc3, loc5, loc7, loc11, loc14, paa, efa1, iha, lpfAO26, and lpfAO113 genes and the absence of loc1, loc2, loc6, loc12, loc13, saa, and eibG genes. Interestingly, the loc8, loc11, afa8-E, f17A, ldaE, efa1, toxB, iha, lpfAO26, and lpfAO113 genes were more frequent in EHEC/EPEC strains than in other strains. Also, several strains were found to be positive for some adhesin genes that have so far not been described for EPEC/EHEC O26 strains, such as hcpA, loc4, loc9, loc10, afa8-E, f17A, and clpE/clpG.

Nevertheless, none of the adhesins studied was significantly associated with bovine or human strains (P > 0.01). On the other hand, the ldaE gene was found to be statistically associated with EHEC/EPEC O26 strains isolated from diarrheic calves in comparison with strains isolated from healthy calves. These ldaE-positive strains may therefore represent a subgroup possessing the specific property of producing diarrhea in young calves (without presuming their capacity to cause disease in humans).

Since not all EHEC/EPEC strains isolated from diarrheic calves are positive for ldaE, the capacity of the other strains to cause diarrhea in young calves must be based upon another property, such as (i) other, rarer adhesins (afa8-E, f17A, clpG/clpE, etc.); (ii) the existence of differences in the sequences of genes coding for some adhesins present in human and bovine strains, resulting in host and tissue tropism, as already described for other families of fimbrial (P family) and afimbrial (AFA family) adhesins (3, 16), which can be detected only after sequencing of the whole encoding genes; (iii) variation in the expression of some adhesin-encoding genes according to the growth environment (bovine or human intestine, intestinal segment, age of the host, etc.), as observed for other genes (11); or (iv) properties other than adherence, such as intermediate metabolism, which allows bacteria to be better adapted to a bovine intestinal environment, such as the young calf intestine (14, 44).

In conclusion, the answer to the question of host specificity of bovine and human EHEC/EPEC O26 strains may simply be that several subgroups of strains exist depending on the presence or absence of one or several properties allowing the pathogens to colonize (or hampering them from doing so) one specific host intestine (young calf, adult cattle, and/or human intestine) and allowing them to cause diarrhea. Only adherence experiments with enterocytes from humans and bovines and/or in vivo challenge of young calves with wild-type strains and mutants would bring final answers to these questions.

Acknowledgments

Marjorie Bardiau is a Ph.D. fellow of the Fonds pour la Formation à la Recherche dans l'Industrie et dans l'Agriculture (FRIA). This study was supported by a grant from the Service Public Fédéral Santé Publique, Sécurité de la Chaîne Alimentaire et Environnement, Division Recherche Contractuelle (contract S-6172), and by the European Network of Excellence EADGENE (European Animal Disease Genomics Network of Excellence for Animal Health and Food Safety) for gene sequencing.

Footnotes

▿

Published ahead of print on 29 April 2009.

REFERENCES

  • 1.An, H., J. Fairbrother, C. Desautels, and J. Harel. 1999. Distribution of a novel locus called Paa (porcine attaching and effacing associated) among enteric Escherichia coli. Adv. Exp. Med. Biol. 473179-184. [DOI] [PubMed] [Google Scholar]
  • 2.Batisson, I., M. P. Guimond, F. Girard, H. An, C. Zhu, E. Oswald, J. M. Fairbrother, M. Jacques, and J. Harel. 2003. Characterization of the novel factor paa involved in the early steps of the adhesion mechanism of attaching and effacing Escherichia coli. Infect. Immun. 714516-4525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Berendson, R., C. P. Cheney, P. A. Schad, and E. C. Boedeker. 1983. Species-specific binding of purified pili (AF/R1) from the Escherichia coli RDEC-1 to rabbit intestinal mucosa. Gastroenterology 85837-845. [PubMed] [Google Scholar]
  • 4.Bielaszewska, M., W. Zhang, A. Mellmann, and H. Karch. 2007. Enterohaemorrhagic Escherichia coli O26:H11/H−: a human pathogen in emergence. Berl. Munch. Tierarztl. Wochenschr. 120279-287. [PubMed] [Google Scholar]
  • 5.Brooks, J. T., E. G. Sowers, J. G. Wells, K. D. Greene, P. M. Griffin, R. M. Hoekstra, and N. A. Strockbine. 2005. Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983-2002. J. Infect. Dis. 1921422-1429. [DOI] [PubMed] [Google Scholar]
  • 6.Campos, L. C., M. R. Franzolin, and L. R. Trabulsi. 2004. Diarrheagenic Escherichia coli categories among the traditional enteropathogenic E. coli O serogroups—a review. Mem. Inst. Oswaldo Cruz 99545-552. [DOI] [PubMed] [Google Scholar]
  • 7.Caprioli, A., S. Morabito, H. Brugëre, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36289-311. [DOI] [PubMed] [Google Scholar]
  • 8.Chen, H., and G. Frankel. 2005. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol. Rev. 2983-98. [DOI] [PubMed] [Google Scholar]
  • 9.China, B., V. Pirson, and J. Mainil. 1998. Prevalence and molecular typing of attaching and effacing Escherichia coli among calf populations in Belgium. Vet. Microbiol. 63249-259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.China, B., V. Pirson, and J. Mainil. 1996. Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulence-associated genes. Appl. Environ. Microbiol. 623462-3465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.de Sablet, T., C. Chassard, A. Bernalier-Donadille, M. Vareille, A. P. Gobert, and C. Martin. 2009. Human microbiota-secreted factors inhibit Shiga toxin synthesis by enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 77783-790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Doughty, S., J. Sloan, V. Bennett-Wood, M. Robertson, R. M. Robins-Browne, and E. L. Hartland. 2002. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect. Immun. 706761-6769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Durso, L. M., J. L. Bono, and J. E. Keen. 2005. Molecular serotyping of Escherichia coli O26:H11. Appl. Environ. Microbiol. 714941-4944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dziva, F., P. M. van Diemen, M. P. Stevens, A. J. Smith, and T. S. Wallis. 2004. Identification of Escherichia coli O157:H7 genes influencing colonization of the bovine gastrointestinal tract using signature-tagged mutagenesis. Microbiology 1503631-3645. [DOI] [PubMed] [Google Scholar]
  • 15.Fagan, P. K., M. A. Hornitzky, K. A. Bettelheim, and S. P. Djordjevic. 1999. Detection of Shiga-like toxin (stx1 and stx2), intimin (eaeA), and enterohemorrhagic Escherichia coli (EHEC) hemolysin (EHEC hlyA) genes in animal feces by multiplex PCR. Appl. Environ. Microbiol. 65868-872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fairbrother, J. M., E. Nadeau, and C. L. Gyles. 2005. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 617-39. [DOI] [PubMed] [Google Scholar]
  • 17.Janka, A., M. Bielaszewska, U. Dobrindt, and H. Karch. 2002. Identification and distribution of the enterohemorrhagic Escherichia coli factor for adherence (efa1) gene in sorbitol-fermenting Escherichia coli O157:H. Int. J. Med. Microbiol. 292207-214. [DOI] [PubMed] [Google Scholar]
  • 18.Jenkins, C., N. T. Perry, T. Cheasty, D. J. Shaw, G. Frankel, G. Dougan, G. J. Gunn, H. R. Smith, A. W. Paton, and J. C. Paton. 2003. Distribution of the saa gene in strains of Shiga toxin-producing Escherichia coli of human and bovine origins. J. Clin. Microbiol. 411775-1778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Leclerc, S., P. Boerlin, C. Gyles, J. D. Dubreuil, M. Mourez, J. M. Fairbrother, and J. Harel. 2007. paa, originally identified in attaching and effacing Escherichia coli, is also associated with enterotoxigenic E. coli. Res. Microbiol. 15897-104. [DOI] [PubMed] [Google Scholar]
  • 20.Low, A., F. Dziva, A. Torres, J. Martinez, T. Rosser, S. Naylor, K. Spears, N. Holden, A. Mahajan, J. Findlay, J. Sales, D. Smith, J. Low, M. Stevens, and D. Gally. 2006. Cloning, expression, and characterization of fimbrial operon F9 from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 742233-2244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Low, A., N. Holden, T. Rosser, A. Roe, C. Constantinidou, J. Hobman, D. Smith, J. Low, and D. Gally. 2006. Analysis of fimbrial gene clusters and their expression in enterohaemorrhagic Escherichia coli O157:H7. Environ. Microbiol. 81033-1047. [DOI] [PubMed] [Google Scholar]
  • 22.Lu, Y., S. Iyoda, H. Satou, K. Itoh, T. Saitoh, and H. Watanabe. 2006. A new immunoglobulin-binding protein, EibG, is responsible for the chain-like adhesion phenotype of locus of enterocyte effacement-negative, Shiga toxin-producing Escherichia coli. Infect. Immun. 745747-5755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mainil, J. 1999. Shiga/verocytotoxins and Shiga/verotoxigenic Escherichia coli in animals. Vet. Res. 30235-257. [PubMed] [Google Scholar]
  • 24.Mainil, J. G., and G. Daube. 2005. Verotoxigenic Escherichia coli from animals, humans and foods: who's who? J. Appl. Microbiol. 981332-1344. [DOI] [PubMed] [Google Scholar]
  • 25.Nagy, B., and P. Z. Fekete. 1999. Enterotoxigenic Escherichia coli (ETEC) in farm animals. Vet. Res. 30259-284. [PubMed] [Google Scholar]
  • 26.Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11142-201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nicholls, L., T. H. Grant, and R. M. Robins-Browne. 2000. Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells. Mol. Microbiol. 35275-288. [DOI] [PubMed] [Google Scholar]
  • 28.Osek, J., M. Weiner, and E. L. Hartland. 2003. Prevalence of the lpfO113 gene cluster among Escherichia coli O157 isolates from different sources. Vet. Microbiol. 96259-266. [DOI] [PubMed] [Google Scholar]
  • 29.Paton, A. W., P. Srimanote, M. C. Woodrow, and J. C. Paton. 2001. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 696999-7009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pawar, D. M., M. L. Rossman, and J. Chen. 2005. Role of curli fimbriae in mediating the cells of enterohaemorrhagic Escherichia coli to attach to abiotic surfaces. J. Appl. Microbiol. 99418-425. [DOI] [PubMed] [Google Scholar]
  • 31.Reid, S. D., C. J. Herbelin, A. C. Bumbaugh, R. K. Selander, and T. S. Whittam. 2000. Parallel evolution of virulence in pathogenic Escherichia coli. Nature 40664-67. [DOI] [PubMed] [Google Scholar]
  • 32.Roe, A. J., C. Currie, D. G. Smith, and D. L. Gally. 2001. Analysis of type 1 fimbriae expression in verotoxigenic Escherichia coli: a comparison between serotypes O157 and O26. Microbiology 147145-152. [DOI] [PubMed] [Google Scholar]
  • 33.Scaletsky, I. C., J. Michalski, A. G. Torres, M. V. Dulguer, and J. B. Kaper. 2005. Identification and characterization of the locus for diffuse adherence, which encodes a novel afimbrial adhesin found in atypical enteropathogenic Escherichia coli. Infect. Immun. 734753-4765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shaikh, N., N. J. Holt, J. R. Johnson, and P. I. Tarr. 2007. Fim operon variation in the emergence of enterohemorrhagic Escherichia coli: an evolutionary and functional analysis. FEMS Microbiol. Lett. 27358-63. [DOI] [PubMed] [Google Scholar]
  • 35.Sonoda, C., A. Tagami, D. Nagatomo, S. Yamada, R. Fuchiwaki, M. Haruyama, Y. Nakamura, K. Kawano, M. Okada, Y. Shioyama, K. Iryoda, H. Wakamatu, and Y. Hidaka. 2008. An enterohemorrhagic Escherichia coli O26 outbreak at a nursery school in Miyazaki, Japan. Jpn. J. Infect. Dis. 6192-93. [PubMed] [Google Scholar]
  • 36.Szalo, I. M., F. Goffaux, V. Pirson, D. Pièrard, H. Ball, and J. Mainil. 2002. Presence in bovine enteropathogenic (EPEC) and enterohaemorrhagic (EHEC) Escherichia coli of genes encoding for putative adhesins of human EHEC strains. Res. Microbiol. 153653-658. [DOI] [PubMed] [Google Scholar]
  • 37.Szalo, I. M., B. Taminiau, F. Goffaux, V. Pirson, J. McCappin, H. J. Ball, and J. G. Mainil. 2004. 2F3 monoclonal antibody recognizes the O26 O-antigen moiety of the lipopolysaccharide of enterohemorrhagic Escherichia coli strain 4276. Clin. Diagn. Lab. Immunol. 11532-537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tarr, P. I., S. S. Bilge, J. C. Vary, Jr., S. Jelacic, R. L. Habeeb, T. R. Ward, M. R. Baylor, and T. E. Besser. 2000. Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure. Infect. Immun. 681400-1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tatsuno, I., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H. Taguchi, S. Kamiya, T. Hayashi, and C. Sasakawa. 2001. toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect. Immun. 696660-6669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Toma, C., N. Higa, S. Iyoda, M. Rivas, and M. Iwanaga. 2006. The long polar fimbriae genes identified in Shiga toxin-producing Escherichia coli are present in other diarrheagenic E. coli and in the standard E. coli collection of reference (ECOR) strains. Res. Microbiol. 157153-161. [DOI] [PubMed] [Google Scholar]
  • 41.Toma, C., E. Martìnez Espinosa, T. Song, E. Miliwebsky, I. Chinen, S. Iyoda, M. Iwanaga, and M. Rivas. 2004. Distribution of putative adhesins in different seropathotypes of Shiga toxin-producing Escherichia coli. J. Clin. Microbiol. 424937-4946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Torres, A. G., J. A. Giron, N. T. Perna, V. Burland, F. R. Blattner, F. Avelino-Flores, and J. B. Kaper. 2002. Identification and characterization of lpfABCC′DE, a fimbrial operon of enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 705416-5427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Torres, A. G., K. J. Kanack, C. B. Tutt, V. Popov, and J. B. Kaper. 2004. Characterization of the second long polar (LP) fimbriae of Escherichia coli O157:H7 and distribution of LP fimbriae in other pathogenic E. coli strains. FEMS Microbiol. Lett. 238333-344. [DOI] [PubMed] [Google Scholar]
  • 44.van Diemen, P. M., F. Dziva, M. P. Stevens, and T. S. Wallis. 2005. Identification of enterohemorrhagic Escherichia coli O26:H− genes required for intestinal colonization in calves. Infect. Immun. 731735-1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J. Bacteriol. 1871783-1791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Xicohtencatl-Cortes, J., V. Monteiro-Neto, M. A. Ledesma, D. M. Jordan, O. Francetic, J. B. Kaper, J. L. Puente, and J. A. Girûn. 2007. Intestinal adherence associated with type IV pili of enterohemorrhagic Escherichia coli O157:H7. J. Clin. Investig. 1173519-3529. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES