Abstract
In the majority of cases, high-risk human papillomavirus (HR HPV) infections regress spontaneously, with only a small percentage progressing to high-grade lesions. Current screening methods are based on DNA detection. An alternative would be to monitor expression of the E6 and E7 viral oncogenes continuously expressed by malignant phenotypes. In the work reported in this paper, we compared the two methods for a group of women with high-risk HPV infections. Cervical specimens from 400 women, previously found to be HPV DNA positive, were analyzed for HPV DNA by a liquid hybridization assay and typed by multiplex PCR (for types 16, 18, 31, and 33). Identification of HR HPV E6 and E7 RNA transcripts was performed using real-time reverse transcription-PCR and nucleic acid sequence-based amplification assays. Results were compared with concurrent cytological data. HR HPVs were found in 61.2% of patients. The most common genotype was HPV type 16 (HPV-16) (47.1%), followed by HPV-18, HPV-31, and HPV-33. Nine percent of cases involved other genotypes. Among 223 HPV DNA-positive samples, only 118 were positive in the RNA test. Among HPV DNA-positive patients with normal cytology, we detected E6 and E7 RNA transcripts in two cases (18.2%). The rate of detection increased gradually with the grade of the observed lesions, rising from 20% for patients with atypical squamous cells of undetermined significance to 48.1% for women with low-grade squamous intraepithelial lesions and 86.3% for those with high-grade squamous intraepithelial lesions. These results suggest that testing for HPV E6 and E7 transcripts could be a useful tool for screening and patient management, providing more accurate predictions of risk than those obtained by DNA testing.
Cancer of the cervix is the second most frequent gynecological malignancy in the world. It is well established that the main cause is infection with human papillomavirus (HPV) (30, 43, 46, 48). However, only certain specific types of virus lead to cancer. We can thus distinguish between high-risk and low-risk HPVs (HR HPV and LR HPV, respectively) (1, 6, 12, 31, 43). Epidemiological studies of HPV show that more than 70% of cervical cancers worldwide are caused by HPV type 16 (HPV-16) and HPV-18. The remaining cases of malignancy are associated with other types of HR HPV (mainly HPV-31, -33, and -45). Today, these viruses are among the most important known risk factors for human cancer (6, 20, 31, 38).
Most HR HPV infections regress spontaneously 6 to 12 months after their appearance, probably due to successful attack by the immune system (33). Only a small percentage of infections persist. Without surgical treatment, these infections can progress to high-grade lesions and to squamous cell carcinoma or adenocarcinoma of the cervix (37, 47, 48).
The introduction of the Pap smear test by Papanicolaou made it possible to identify precursor lesions and to significantly reduce mortality. However, the test cannot reliably predict whether a mild dysplasia will regress or progress (5, 36). Recently, it was suggested that cervical cancer screening could be improved by combining the cytological assay with testing for HPV DNA (2, 7, 13, 19, 21, 36). However, the high prevalence of papillomavirus infection means that such testing has a low positive predictive value (17, 25, 26).
It is known that the development of a malignant phenotype requires continuous expression of the E6 and E7 viral oncogenes. E6 and E7 viral oncoproteins bind and modulate cellular gene products (p53 and pRb) that play a key role in cell cycle control and DNA repair. The resulting genomic instability is a necessary condition for cell transformation and immortalization (29, 30, 46, 48). Increased expression of these transcripts has been described for both high-grade squamous intraepithelial lesions (HSIL) and clinical samples of cervical carcinoma (8, 20, 25, 30). It is logical, therefore, to hypothesize that E6 and E7 RNA transcripts could predict disease progression (4, 19, 26, 27). Although the value of RNA testing has yet to be assessed in large-scale clinical trials, recent studies (8, 9, 10, 22, 25, 44) are encouraging. Since DNA-based assays cannot distinguish between transient and potentially transforming infections, several studies (4, 11, 26, 40, 41) have suggested that testing for HPV E6 and E7 RNAs could be more specific. Taken together, these results suggest that RNA-based assays could have a higher prognostic value than DNA-based tests and that they could play an important role in future screening programs (2, 9).
In this study, we evaluate this possibility, comparing DNA and RNA assays of cervical brush samples from women with a previous diagnosis of infection with HR HPV.
MATERIALS AND METHODS
Patients and sampling.
This study was conducted on cervical specimens from 400 Italian women (age range, 21 to 59 years) undergoing tests for HPV detection at the Outpatient Department of the Institute of Microbiology (Università Cattolica del Sacro Cuore, Rome, Italy). Specimens were collected in the period from May 2006 to September 2007. All of the patients in the study had previously tested positive for HR HPV, in tests carried out at our own institution, 8 to 10 months before samples were taken. Patients who had tested positive only for LR HPV or who did not undergo concurrent cytological tests were not included in the study. All participants in the study gave their informed consent.
Cytological investigations were carried out at the Institute of Pathology (Università Cattolica del Sacro Cuore, Rome, Italy) in the same period that the DNA and RNA assays were performed. Cytology and RNA/DNA testing were conducted independently.
Patients were grouped based on cytological findings, as follows: 108 women showed normal cytology, in 84 we detected atypical squamous cells of undetermined significance (ASCUS), in 136 we found low-grade squamous intraepithelial lesions (LSIL), and in 72 we found HSIL. Cervical brush samples were collected using a cervical brush transport kit (Digene, Milan, Italy). Three identical aliquots were prepared, including one for DNA detection by the Hybrid Capture II HPV DNA test (hc2; Digene, Milan, Italy) and two for DNA and RNA extractions. Aliquots were stored appropriately for further processing.
HPV DNA detection by liquid hybridization assay.
All samples were analyzed using the Hybrid Capture II HPV DNA test (hc2; Digene, Milan Italy) according to the manufacturer's directions. The hc2 assay, in routine use in our laboratory, effectively differentiates between LR HPV types (6, 11, 42, 43, 44) and HR HPV types (types 16, 18, 31, 33, 35, 39, 45, 51, 52, 58, 59, and 68) but does not allow precise identification of genotypes.
Nucleic acid isolation.
Two identical aliquots were centrifuged, and the concentrated cell pellets were used for DNA and RNA extraction. Total RNA was extracted using a Qiagen Protect Mini kit (Qiagen SpA, Milan, Italy) and treated with DNase to eliminate DNA contamination according to the manufacturer's instructions. Extracted RNA was eluted with 60 μl of diethyl pyrocarbonate-treated water. DNA was purified using a spin column-based QIAamp DNA Mini kit (Qiagen SpA, Milan, Italy) and eluted in 60 μl of sterile water, following the manufacturer's directions.
HPV genotyping by multiplex PCR for HPV-16, -18, -31, and -33.
Samples positive for HR HPV by the hc2 assay (Digene, Milan, Italy) were analyzed by a multiplex PCR assay using type-specific primer sequences as described by van den Brule et al. (24, 42), with some modifications. Each assay used 10 μl of DNA and 20 pmol of each of the four primer sets. The reaction mixture contained 25 μl of HotStar Taq master mix (Qiagen SpA, Milan, Italy) and 7 μl of RNase-free water in a final volume of 50 μl. The amplification profile consisted of 15 min at 95°C to activate the HotStar Taq DNA polymerase (Qiagen SpA, Milan, Italy), followed by 45 cycles of denaturation (94°C for 30 s), annealing (56°C for 40 s), and extension (72°C for 40 s). Assays were performed on an iCycler thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA). Amplicons were detected by electrophoresis of 20 μl of amplification products in a 2% agarose gel and visualized by ethidium bromide staining under a Fluor-S UV light transilluminator. Molecular sizes of amplicons (HPV-16, 152 bp; HPV-18, 216 bp; HPV-31, 513 bp; and HPV-33, 455 bp) were determined by matching the bands against commercial DNA molecular size markers (molecular weight markers V and VIII; Roche Diagnostics, GmbH, Mannheim, Germany).
To assess sensitivity, plasmids containing genomic DNAs of HPV-16 and -18, kindly provided by E. M. de Villiers (Deutsches Krebsforschungszentrum, Heidelberg, Germany), and specific PCR products of HPV-31 and -33 cloned into the pCR2.1 vector (Invitrogen, San Diego, CA) were quantified by optical density measurement. Constructs were serially diluted and subsequently amplified using type-specific primers. Multiplex PCR was shown to detect concentrations as low as five copies per sample.
Primers and probes.
Type-specific reverse transcription-PCR (RT-PCR) and real-time PCR primers and probes for the E6 and E7 regions of the four HPV types were designed using DNASIS, version 2.1, for Windows (Hitachi Software Genetic System, San Francisco, CA) and synthesized by Applied Biosystems (Monza, Milan, Italy). Fluorescent probes were labeled at the 5′ end with 6-carboxyfluorescein and at the 3′ end with 6-carboxytetramethylrhodamine. The sequences of primers and TaqMan probes, GenBank accession numbers, and the lengths of the amplification products are listed in Table 1.
TABLE 1.
Sequences of primers (F and R) and TaqMan probes (P) used for real-time PCR, target locations, and lengths of amplification products
| Primer or probe | Sequence (5′ to 3′) | Locationa | Product size (bp) |
|---|---|---|---|
| HPV 16 E6-F | GCACCAAAAGAGAACTGCAATGTT | 85-108 | 152 |
| HPV 16 E6-R | AGTCATATACCTCACGTCGCAGTA | 197-236 | |
| HPV 16 E6-P | GGACCCACAGGAGCGACCCAGAAAGTTA | 112-139 | |
| HPV 16 E7-F | CAAGTGTGACTCTACGCTTCGG | 738-759 | 81 |
| HPV 16 E7-R | GTGGCCCATTAACAGGTCTTCCAA | 796-818 | |
| HPV 16 E7-P | TGCGTACAAAGCACACACGTAGACATTCGT | 763-792 | |
| HPV 18 E6-F | CTATAGAGGCCAGTGCCATTCG | 503-524 | 79 |
| HPV 18 E6-R | TTATACTTGTGTTTCTCTGCGTCG | 558-581 | |
| HPV 18 E6-P | CAACCGAGCACGACAGGAACGACTCCA | 530-556 | |
| HPV 18 E7-F | TAATCATCAACATTTACCAGCCCG | 721-744 | 113 |
| HPV 18 E7-R | CGTCTGCTGAGCTTTCTACTACTA | 810-833 | |
| HPV 18 E7-P | CGAGCCGAACCACAACGTCACACAATGTT | 745-774 | |
| HPV 31, E6-F | AAGACCGTTGTGTCCAGAAG | 428-447 | 106 |
| HPV 31, E6-R | GTCTTCTCCAACATGCTATGC | 511-534 | |
| HPV 31, E6-P | CGTCCTGTCCACCTTCCTCCTATG | 488-511 | |
| HPV 31, E7-F | TGTGTTAGATTTGCAACCTGAG | 592-613 | 78 |
| HPV 31, E7-R | ACATCCTCCTCATCTGAGCT | 669-649 | |
| HPV 31, E7-P | CAACTGACCTCCACTGTTATGAGCAAT | 615-641 | |
| HPV 33, E6-F | TGCACGACTATGTTTCAAGAC | 100-120 | 132 |
| HPV 33, E6-R | CTCAGATCGTTGCAAAGGTTT | 211-231 | |
| HPV 33, E6-P | ATTCCACGCACTGTAGTTCAATGTTGT | 179-205 | |
| HPV 33, E7-F | TTGTAACCTGTTGTCACACTTG | 733-754 | 88 |
| HPV 33, E7-R | AGTAGTTGCTGTATGGTTCGTA | 799-820 | |
| HPV 33, E7-P | ACTTGCTGTACTGTTGACACATAAACGA | 767-794 |
Real-time PCR and real-time RT-PCR assays.
Positive samples were analyzed to determine DNA and RNA copy numbers for HPV genotypes 16, 18, 31, and 33. Real-time PCR and real-time RT-PCR were performed using the iCycler iQ detection system (Bio-Rad Laboratories Inc., Hercules, CA). Quantitative PCR amplification for viral DNA detection was performed in a reaction volume of 50 μl containing 10 μl of DNA, 5 μl of primers (5 μM), 5 μl of probe (1.5 μM), and 25 μl of Platinum Quantitative PCR Super-Mix-UDG buffer (Invitrogen, San Diego, CA). Thermal cycling conditions were 2 min at 50°C and 15 min at 95°C followed by 50 cycles of 15 s at 95°C and 30 s at 57°C for DNA detection by real-time PCR. Real-time RT-PCR for E6 and E7 mRNA detection used the same reaction conditions and thermal profile except for an initial 30 min at 50°C for RT (RT-PCR Super-Mix-UDG; Invitrogen, San Diego, CA).
Specific PCR products for each target sequence were cloned into the pDRive cloning vector (Invitrogen, San Diego, CA), quantitated in triplicate by measurement of UV absorption, mixed with HPV-negative human genomic DNA, and serially diluted to generate a standard curve ranging from 10 to 10 × 107 copies. After confirmation of the accuracy of the standard dilution series, standards were stored at −20°C in small aliquots. Amplification was measured as an increase in reporter fluorescence. Data were collected in real time and analyzed by sequence detection system software (Bio-Rad Laboratories Inc., Hercules, CA). A standard curve was constructed by plotting the log of the starting plasmid concentration against the cycle threshold, that is, the first cycle number at which reporter fluorescence was significantly higher than the mean background fluorescence. This curve was subsequently used to determine DNA and RNA concentrations in specimens. Preliminary studies showed that both real-time PCR assays were able to detect 10 to 107 plasmid copies per reaction. For each sample, we computed the ratio between the numbers of mRNA and DNA copies (RNA/DNA copy number ratio). This method allowed us to correct for the highly variable numbers of cells in cervical samples.
HPV RNA detection by real-time multiplex nucleic acid sequence-based amplification.
DNA-positive samples were retested for the presence of E6 and E7 transcripts of HR HPV types 16, 18, 31, 33, and 45 by use of the NucliSENS EasyQ HPV test (bioMerieux, Rome, Italy) according to the manufacturer's directions.
Controls.
Specimen quality was assessed with a primer set that amplifies a 268-bp fragment coding for human beta-globin (35) and with a glyceraldehyde-3-phosphate dehydrogenase primer set that amplifies a 240-bp product from human cDNA (39).
The specificity of HPV primer pairs was evaluated by testing them against specimens negative for the targeted type but positive for other types. No PCR product was generated from these DNA and RNA amplifications.
As positive controls for HPV-18 and HPV-16, we used HeLa cells (American Type Culture Collection) and CaSki cells (Interlab Cell Line Collection, Istituto Nazionale per la Ricerca sul Cancro, Genoa, Italy); for HPV types 31 and 33, we used cloned DNAs from previously typed cervical biopsies. In each amplification run, we used distilled water as a negative control. Procedures to prevent specimen contamination and PCR carryover were rigorously observed at all stages.
RESULTS
Initial screening with the hc2 DNA assay detected HR HPV infection in 245 of 400 women (61.25%). In 67, we detected concurrent infection with LR types. The remaining 155 women tested negative (Table 2). HR HPV DNA was found in 16.7% of patients with normal cytology (18/108 patients), 54.7% of women with ASCUS (46/84 patients), 83.1% of those with LSIL (113/136 patients), and 94.5% of those with HSIL (68/72 patients) (Table 2).
TABLE 2.
HPV DNA test and cytological findings for cervical brush specimens from 400 women who tested positive for HPV DNA 8 to 10 months previously
| Cytology result | Age (yr) (range [mean]) | Total no. of patients | No. (%) of patients with hc2 HR HPV test result
|
|
|---|---|---|---|---|
| Positive | Negative | |||
| Normal | 23-49 (33.7) | 108 | 18 (16.7) | 90 (83.3) |
| ASCUS | 21-59 (34.4) | 84 | 46 (54.7) | 38 (45.3) |
| LSIL | 21-57 (35.2) | 136 | 113 (83.1) | 23 (16.9) |
| HSIL | 24-56 (36.3) | 72 | 68 (94.5) | 4 (5.5) |
| Total | 400 | 245 (61.25) | 155 (38.75) | |
All specimens were positive for beta-globin DNA, confirming the quality of the DNA preparations.
The 245 samples positive for HR HPV by hc2 assay were typed by multiplex PCR. HR genotypes (types 16, 18, 31, and 33) were detected in 223 cases (91.0%) (Table 3). The commonest genotype was HPV-16 (105 cases [47.1%]), followed by HPV-18 (30 cases [13.4%]), HPV-31 (18 cases [8.1%]), and HPV-33 (15 cases [6.7%]). In 55 cases (24.6%), we detected infection with multiple types. Twenty-two of these involved mixed infections with HPV-16 and HPV-18. In 22 (9%) cases, we detected no HPV of types 16, 18, 31, and 33 (Table 4).
TABLE 3.
Cytology and HR HPV genotyping by multiplex PCR for cervical brush samples from 245 HPV DNA-positive patients
| Cytology result | No. of HR HPV-positive samples by hc2 test | No. (%) of positive samples by multiplex PCR (for HPV-16, -18, -31, and -33) |
|---|---|---|
| Normal | 18 | 11 (61.1) |
| ASCUS | 46 | 40 (86.9) |
| LSIL | 113 | 106 (93.8) |
| HSIL | 68 | 66 (97.1) |
| Total | 245 | 223 (91.0) |
TABLE 4.
Cytology and HR HPV genotypes for 223 HPV-positive patients
| Cytology result | No. (%) of patients testing positive for HPV type(s) by multiplex PCR
|
Total | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 16 | 18 | 31 | 33 | 16 and 18 | 16 and 31 | 16 and 33 | 18 and 31 | 18 and 33 | 31 and 33 | ||
| Normal | 3 | 2 | 1 | 2 | 1 | 1 | 1 | 11 | |||
| ASCUS | 24 | 3 | 3 | 1 | 2 | 2 | 2 | 1 | 2 | 40 | |
| LSIL | 43 | 14 | 9 | 8 | 14 | 5 | 5 | 2 | 3 | 3 | 106 |
| HSIL | 35 | 11 | 5 | 4 | 6 | 2 | 1 | 1 | 1 | 66 | |
| Total | 105 (47.1) | 30 (13.4) | 18 (8.1) | 15 (6.7) | 22 (9.9) | 10 (4.5) | 8 (3.6) | 4 (1.8) | 4 (1.8) | 7 (3.1) | 223 (100) |
The lowest rate of prevalence for HR genotypes was for patients with normal cytology or ASCUS. A total of 93.8% of patients with LSIL and 97.1% of patients with HSIL displayed simple or mixed infections with HPV-16, -18, -31, and -33 (Table 3).
Viral DNA loads, estimated by “in-house” RT-PCR, ranged from 102 to 106 copies per specimen. These data correlated well with relative light unit values from the hc2 HPV DNA test (data not shown); minor differences were probably due to differences in the methods used (amplification versus hybridization). Quantities of HPV DNA varied widely within and between patient groups. There was no significant correlation between copy number and grade of lesion.
In our RNA assay, RT-PCR (for HPV-16, -18, -31, and -33) detected E6 and E7 oncogene transcripts in 118 patients (52.9%) who had tested positive for specific HR genotypes (Table 5). Amplification with a glyceraldehyde-3-phosphate dehydrogenase cDNA primer set confirmed the adequacy of RNA-negative samples. These results were replicated using the NucliSENS EasyQ HPV test (bioMerieux, Rome, Italy). The results matched for all except two samples.
TABLE 5.
Cytology, HR genotypes, and presence of E6 and E7 transcripts for patients previously classified as HPV DNA positive
| Cytology result | No. of patients positive for HPV-16, -18, -31, and -33 | No. (%) of patients positive for E6 and E7 transcripts by real-time RT-PCR and EasyQ HPV test |
|---|---|---|
| Normal | 11 | 2 (18.2) |
| ASCUS | 40 | 8 (20.0) |
| LSIL | 106 | 51 (48.1) |
| HSIL | 66 | 57 (86.3) |
| Total | 223 | 118 (52.9) |
For patients with normal cytology, E6 and E7 transcripts were detected in 18.2% of cases (Table 5). The proportion of patients with detectable HPV transcripts increased progressively with the grade of observed lesions, rising from 20% for patients with ASCUS (8/40 patients) to 48.1% for those with low-grade lesions (51/106 patients) and 86.3% for those with high-grade lesions (57/66 patients) (Table 5).
The results for the prevalence of specific genotypes were similar to those from the earlier DNA assay. In 56.8% of cases, we detected HPV-16. The second commonest genotype was HPV-18 (17%), followed by HPV-31 (10.2%) and HPV-33 (5.9%) (Table 6). The assay detected six mixed infections with HPV-16 and -18, three with HPV-16 and -31, two with HPV-18 and -31, and one with HPV-16 and -33. In two cases (one mixed infection of HPV-16 and HPV-18 and one of HPV-16 and HPV-33), the NucliSENS EasyQ HPV test (bioMerieux, Rome, Italy) failed to detect the genotypes detected by RT-PCR. For two other patients, the test detected the presence of HPV-45 in association with HPV-18. Our RT-PCR assay did not include primers for HPV-45 and could not detect this virus.
TABLE 6.
Cytology and prevalence of E6 and E7 transcripts from HPV types 16, 18, 31, and 33 in cervical brush samples
| Cytology result | No. (%) of samples positive for HPV type(s) by RNA genotyping by real-time RT-PCR
|
Total no. of positive samples | |||||||
|---|---|---|---|---|---|---|---|---|---|
| 16 | 18 | 31 | 33 | 16 and 18 | 16 and 31 | 16 and 33 | 18 and 33 | ||
| Normal | 1 | 1 | 2 | ||||||
| ASCUS | 6 | 1 | 1 | 8 | |||||
| LSIL | 26 | 9 | 6 | 6 | 2 | 2 | 51 | ||
| HSIL | 35 | 9 | 6 | 1 | 4 | 2 | 57 | ||
| Total | 67 (56.8) | 20 (17.0) | 12 (10.2) | 7 (5.9) | 6 (5.1) | 3 (2.5) | 1 (0.8) | 2 (1.7) | 118 (100) |
E6 and E7 RNA transcripts ranged from 102 to 107 copies per specimen. The RNA/DNA copy number ratio was higher for patients with LSIL and HSIL (mean = 14.43; standard deviation [SD] = 12.63) than for patients with normal cytology or ASCUS (mean = 2.27; SD = 1.44). This difference was statistically significant (Student's t = 12.57; P < 0.001) and was observed for all genotypes (Table 7).
TABLE 7.
Cytology and mean RNA/DNA copy number ratios
| Cytology result | Mean RNA/DNA copy no. ratio for positive samples
|
||||
|---|---|---|---|---|---|
| HPV types
|
All typesa | ||||
| 16 | 18 | 31 | 33 | ||
| Normal | 2.6 | 2.3 | 0.8 | 1.92 | |
| ASCUS | 2.6 | 3.5 | 0.5 | 2.21 | |
| LSIL | 12.9 | 5.8 | 12.0 | 7.5 | 9.56 |
| HSIL | 22.2 | 11.6 | 7.2 | 10.2 | 12.8 |
The mean for all types for samples with normal cytology and ASCUS was 2.27 (SD, 1.44), and that for samples with HSIL and LSIL cytology was 14.43 (SD, 12.63). The difference between these means was statistically significant (Student's t = 12.57; P < 0.001).
Among the 55 samples with multiple HPV infections, 12 (21.8%) were positive for E6 and E7 transcripts. The level of expression was always significantly higher for one of the two genotypes. This finding contrasts with the DNA findings, which showed no significant differences between genotypes.
DISCUSSION
Given the importance of HPV in the etiology of cervical cancer (38, 43, 45, 46, 48), many groups have developed methods for detecting the virus (34). These tests have been shown to have a higher sensitivity for high-grade cervical lesions than that of cytology (5, 7, 21, 36). It has therefore been suggested that DNA-based HPV detection should play a routine role in screening (3, 10, 11, 14, 37).
Ninety percent of HPV infections clear spontaneously over a period of 6 to 24 months (33). Generally speaking, only persistent infections lead to cancer (6, 18, 28). This implies that although DNA testing has a high negative predictive value, its positive predictive value is relatively low (26, 27, 33), and tests need to be repeated periodically, with a negative impact on health service costs and patient comfort.
Research in recent years has found that histologically proven cases of cervical intraepithelial neoplasia 3 (CIN3) and invasive cervical carcinoma are associated with the presence of transcripts from the E6 and E7 oncogenes (8, 19, 20, 30, 32). It has been suggested that tests for these transcripts or for other biomarkers, such as p16 (16), could be more effective than DNA detection in predicting disease progression (25-27, 31, 44).
In this study, therefore, we compared the two approaches (DNA and RNA testing) with clinical specimens from patients previously diagnosed with HR HPV.
Multiplex PCR detected DNA from HR HPV in 91% of the patients who had tested positive by the hc2 assay. The most common genotype was HPV-16, followed by HPV-18, HPV-33, and HPV-31. The majority of the patients who tested positive showed lesions classified as LSIL or HSIL (93.8% and 97.1%, respectively). These findings match prevalence data in the literature and confirm the importance of HPV-16 and -18 as highly specific markers for risk (6). The value of genotyping for other HR types (6, 7, 14, 18) is limited by their low frequencies.
A total of 38.8% of the 400 women tested negative for HPV DNA after 8 to 10 months. This result matches usual rates of clearance for HPV infections, as reported in previous studies (33).
Quantitation showed large variations in viral load among patients with lesions of the same grade and a certain degree of overlap between women with and without high-grade lesions. The variability in the data is possibly due to the highly variable nature of cervical specimens (2). Although the methods used provide no data on the number of infected cells or the number of HPV genomes per cell, these findings support suggestions from other authors that viral load may be a poor predictor of acquisition or progression of disease (2, 37, 45), with limited applicability in the clinic (10, 11, 15).
Compared to the DNA test, the RNA assay produced fewer positive results. E6 and E7 transcripts were detected in just 52.9% of patients who tested positive for HR HPV. The lack of RNA transcripts possibly reflects an episomal state of the virus in which regulation of the transcription process is still effective, creating a higher probability that the infection will clear spontaneously. Negative test results were common for women with normal cytology, ASCUS, and LSIL. In contrast, 86.3% of patients with HSIL tested positive. The high frequency of E6 and E7 transcripts in high-grade dysplasia confirms that the integration of HR HPV into the host genome, loss of control over oncogene transcription, and consequent expression of E6 and E7 gene products are necessary conditions for the development and maintenance of malignant phenotypes.
The remaining 13.7% of HPV DNA-positive HSIL cases were E6 and E7 mRNA negative. It is possible that these negative results may have been due to a very low level or a lack of transcriptional viral activity. Alternatively, the viruses detected by the DNA assays may have belonged to types we did not consider in our study. However, the cytological diagnosis of HSIL includes lesions, such as CIN2, that sometimes regress (9, 20, 22). For reasons of safety, patients with these lesions undergo surgical resection. Other studies have suggested, however, that some of these women may be overtreated. The results of our own studies support this hypothesis (23).
In our study, we detected E6 and E7 transcripts not only in specimens showing high-grade lesions but also in cytologically normal or borderline samples. This indicates that HR HPV may be oncogenically active even before it produces detectable changes in cells. Given the significant association between RNA/DNA copy number ratio and the severity of lesions, E6 and E7 transcripts could provide a sensitive, early predictor of persistent infection and subsequent severe dysplasia.
In sum, the findings from our study support the hypothesis that, especially for patients with normal cytology or low-grade lesions, E6 and E7 mRNA detection may be a more specific diagnostic tool and a better predictor of disease progression than DNA-based assays. We are aware that these results on their own are not enough to demonstrate the usefulness of mRNA testing in the clinic. This would require a comparative analysis of the sensitivities and specificities of DNA- and RNA-based methods for HPV-positive and -negative patients followed up by colposcopy, cytology, and histological examination. To meet this need, we recently began a longitudinal study in which we will assess the value of the RNA assay as a predictor of clinical outcomes.
Acknowledgments
This work was partly supported by grant 7021327 D.1 from the Università Cattolica del Sacro Cuore, Rome, Italy.
We thank Simona Galuppi for her expert technical assistance and Richard Walker for critically reading the manuscript.
Footnotes
Published ahead of print on 29 April 2009.
REFERENCES
- 1.Bosch, F. X., M. M. Manos, N. Munoz, M. Sherman, A. M. Jansen, J. Peto, M. H. Schiffman, V. Moreno, R. Kurman, K. V. Shah, et al. 1995. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer. J. Natl. Cancer Inst. 87796-802. [DOI] [PubMed] [Google Scholar]
- 2.Boulet, G. A., C. A. Horvath, S. Berghmans, and J. Bogers. 2008. Human papillomavirus in cervical cancer screening: important role as biomarker. Cancer Epidemiol. Biomarkers Prev. 17810-817. [DOI] [PubMed] [Google Scholar]
- 3.Bulkmans, N. W., L. Rozendaal, P. J. Snijders, F. J. Voorhorst, A. J. Boeke, G. R. Zandwijken, F. J. van Kemenade, R. H. Verheijen, K. van Groningen, M. E. Boon, H. J. Keuning, M. van Ballegooijen, A. J. van den Brule, and C. J. Meijer. 2004. POBASCAM, a population-based randomised controlled trial for implementation of high risk HPV testing in cervical screening: design, methods and baseline data of 44,102 women. Int. J. Cancer 11094-101. [DOI] [PubMed] [Google Scholar]
- 4.Castle, P. E., J. Dockter, C. Giachetti, F. A. Garcia, M. K. McCormick, A. L. Mitchell, E. B. Holladay, and D. P. Kolk. 2007. A cross-sectional study of a prototype carcinogenic human papillomavirus E6/E7 messenger RNA assay for the detection of cervical precancer and cancer. Clin. Cancer Res. 132599-2605. [DOI] [PubMed] [Google Scholar]
- 5.Clary, K. M., J. F. Silverman, Y. Liu, C. D. Sturgis, D. M. Grzybicki, L. K. Mahood, and S. S. Raab. 2002. Cytohistologic discrepancies: a means to improve pathology practice and patient outcomes. Am. J. Clin. Pathol. 117567-573. [DOI] [PubMed] [Google Scholar]
- 6.Clifford, G. M., J. S. Smith, M. Plummer, N. Munoz, and S. Franceschi. 2003. Human papillomavirus types in invasive cervical cancer worldwide: a meta-analysis. Br. J. Cancer 8863-73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cox, T., and J. Cuzick. 2006. HPV DNA testing in cervical cancer screening: from evidence to policies. Gynecol. Oncol. 1038-11. [DOI] [PubMed] [Google Scholar]
- 8.Cuschieri, K. S., M. J. Whitley, and H. A. Cubie. 2004. Human papillomavirus type specific DNA and RNA persistence—implications for cervical disease progression and monitoring. J. Med. Virol. 7365-70. [DOI] [PubMed] [Google Scholar]
- 9.Cuschieri, K., and N. Wentzensen. 2008. Human papillomavirus RNA and p16 detection as biomarkers for the improved diagnosis of cervical neoplasia. Cancer Epidemiol. Biomarkers Prev. 172536-2545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cuzick, J., C. Clavel, K. U. Petry, C. J. Meijer, H. Hoyer, S. Ratnam, A. Szarewski, P. Birembaut, S. Kulasingam, P. Sasieni, and T. Iftner. 2006. Overview of the European and North American studies on HPV testing in primary cervical cancer screening. Int. J. Cancer 1191095-1101. [DOI] [PubMed] [Google Scholar]
- 11.Cuzick, J., M. H. Mayrand, G. Ronco, P. Snijders, and J. Wardle. 2006. Chapter 10: new dimensions in cervical cancer screening. Vaccine 24S90-S97. [DOI] [PubMed] [Google Scholar]
- 12.de Villiers, E. M., C. Fauquet, T. R. Broker, H. U. Bernard, and H. zur Hausen. 2004. Classification of papillomaviruses. Virology 32417-27. [DOI] [PubMed] [Google Scholar]
- 13.Dunne, E. F., and L. E. Markowitz. 2006. Genital human papillomavirus infection. Clin. Infect. Dis. 43624-629. [DOI] [PubMed] [Google Scholar]
- 14.Elfgren, K., E. Rylander, T. Radberg, B. Strander, A. Strand, K. Panjanen, I. Sjoberg, W. Ryd, I. Silins, and J. Dillner. 2005. Colposcopic and histopathologic evaluation of women participating in population-based screening for human papillomavirus deoxyribonucleic acid persistence. Am. J. Obstet. Gynecol. 193650-657. [DOI] [PubMed] [Google Scholar]
- 15.Gravitt, P. E., M. B. Kovacic, R. Herrero, M. Schiffman, C. Bratti, A. Hildesheim, J. Morales, M. Alfaro, M. E. Sherman, S. Wacholder, A. C. Rodriguez, and R. D. Burk. 2007. High load for most high risk human papillomavirus genotypes is associated with prevalent cervical cancer precursors but only HPV16 load predicts the development of incident disease. Int. J. Cancer 1212787-2793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hariri, J., and A. Øster. 2007. The negative predictive value of p16INK4a to assess the outcome of cervical intraepithelial neoplasia 1 in the uterine cervix. Int. J. Gynecol. Pathol. 26223-238. [DOI] [PubMed] [Google Scholar]
- 17.Ho, G. Y., R. Bierman, L. Beardsley, C. J. Chang, and R. D. Burk. 1998. Natural history of cervicovaginal papillomavirus infection in young women. N. Engl. J. Med. 338423-428. [DOI] [PubMed] [Google Scholar]
- 18.Kjaer, S. K., A. J. van den Brule, G. Paull, E. I. Svare, M. E. Sherman, B. L. Thomsen, M. Suntum, J. E. Bock, P. A. Poll, and C. J. Meijer. 2002. Type specific persistence of high risk human papillomavirus (HPV) as indicator of high grade cervical squamous intraepithelial lesions in young women: population based prospective follow up study. BMJ 325572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kraus, I., T. Molden, L. E. Erno, H. Skomedal, F. Karlsen, and B. Hagmar. 2004. Human papillomavirus oncogenic expression in the dysplastic portio; an investigation of biopsies from 190 cervical cones. Br. J. Cancer 901407-1413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kraus, I., T. Molden, R. Holm, A. K. Lie, F. Karlsen, G. B. Kristensen, and H. Skomedal. 2006. Presence of E6 and E7 mRNA from human papillomavirus types 16, 18, 31, 33, and 45 in the majority of cervical carcinomas. J. Clin. Microbiol. 441310-1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Laara, E., N. E. Day, and M. Hakama. 1987. Trends in mortality from cervical cancer in the Nordic countries: association with organised screening programmes. Lancet i1247-1249. [DOI] [PubMed] [Google Scholar]
- 22.Lie, A. K., B. Risberg, B. Borge, B. Sandstad, J. Delabie, R. Rimala, M. Onsrud, and S. Thoresen. 2005. DNA-versus RNA-based methods for human papillomavirus detection in cervical neoplasia. Gynecol. Oncol. 97908-915. [DOI] [PubMed] [Google Scholar]
- 23.Manavi, M., G. Hudelist, A. Fink-Retter, D. Gschwantler-Kaulich, K. Pischinger, and K. Czerwenka. 2008. Human papillomavirus DNA integration and messenger RNA transcription in cervical low- and high-risk squamous intraepithelial lesions in Austrian women. Int. J. Gynecol. Cancer 18285-294. [DOI] [PubMed] [Google Scholar]
- 24.Melchers, W., A. van den Brule, J. Walboomers, M. de Bruin, M. Burger, P. Herbrink, C. Meijer, J. Lindeman, and W. Quint. 1989. Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and Southern-blot analysis. J. Med. Virol. 27329-335. [DOI] [PubMed] [Google Scholar]
- 25.Molden, T., I. Kraus, F. Karlsen, H. Skomedal, J. F. Nygård, and B. Hagmar. 2005. Comparison of human papillomavirus messenger RNA and DNA detection: a cross-sectional study of 4,136 women >30 years of age with a 2-year follow-up of high-grade squamous intraepithelial lesion. Cancer Epidemiol. Biomarkers Prev. 14367-372. [DOI] [PubMed] [Google Scholar]
- 26.Molden, T., J. F. Nygård, I. Kraus, F. Karlsen, M. Nygård, G. B. Skare, H. Skomedal, S. O. Thoresen, and B. Hagmar. 2005. Predicting CIN2+ when detecting HPV mRNA and DNA by PreTect HPV-proofer and consensus PCR: a 2-year follow-up of women with ASCUS or LSIL Pap smear. Int. J. Cancer 114973-976. [DOI] [PubMed] [Google Scholar]
- 27.Molden, T., I. Kraus, F. Karlsen, H. Skomedal, and B. Hagmar. 2006. Human papillomavirus E6/E7 mRNA expression in women younger than 30 years of age. Gynecol. Oncol. 10095-100. [DOI] [PubMed] [Google Scholar]
- 28.Moscicki, A. B., M. Schiffman, S. Kjaer, and L. L. Villa. 2006. Chapter 5: updating the natural history of HPV and anogenital cancer. Vaccine 24S42-S51. [DOI] [PubMed] [Google Scholar]
- 29.Munger, K., and P. M. Howley. 2002. Human papillomavirus immortalization and transformation functions. Virus Res. 89213-228. [DOI] [PubMed] [Google Scholar]
- 30.Munger, K., A. Baldwin, K. M. Edwards, H. Hayakawa, C. L. Nguyen, M. Owens, M. Grace, and K. Huh. 2004. Mechanisms of human papillomavirus-induced oncogenesis. J. Virol. 7811451-11460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Munoz, N., F. X. Bosch, S. de Sanjose, R. Herrero, X. Castellsague, K. V. Shah, P. J. Snijders, C. J. Meijer, et al. 2003. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N. Engl. J. Med. 348518-527. [DOI] [PubMed] [Google Scholar]
- 32.Nakagawa, S., H. Yoshikawa, T. Yasugi, M. Kimura, K. Kawana, K. Matsumoto, M. Yamada, T. Onda, and Y. Taketani. 2000. Ubiquitous presence of E6 and E7 transcripts in human papillomavirus-positive cervical carcinomas regardless of its type. J. Med. Virol. 62251-258. [DOI] [PubMed] [Google Scholar]
- 33.Plummer, M., M. Schiffman, P. E. Castle, D. Maucort-Boulch, C. M. Wheeler, and ALTS Group. 2007. A 2-year prospective study of human papillomavirus persistence among women with a cytological diagnosis of atypical squamous cells of undetermined significance or low-grade squamous intraepithelial lesion. J. Infect. Dis. 1951582-1589. [DOI] [PubMed] [Google Scholar]
- 34.Quint, W. G., S. R. Pagliusi, N. Lelie, E. M. de Villiers, C. M. Wheeler, et al. 2006. Results of the first World Health Organization international collaborative study of detection of human papillomavirus DNA. J. Clin. Microbiol. 44571-579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Saiki, R. K., T. L. Bugawan, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1986. Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 32463-66. [DOI] [PubMed] [Google Scholar]
- 36.Sasieni, P. D., J. Cuzick, and E. Lynch-Farmery. 1996. Estimating the efficacy of screening by auditing smear histories of women with and without cervical cancer. Br. J. Cancer 731001-1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Scheurer, M. E., G. Tortolero-Lunay, and K. Adler-Storthzz. 2005. Human papillomavirus infection: biology, epidemiology, and prevention. Int. J. Gynecol. Cancer 15727-746. [DOI] [PubMed] [Google Scholar]
- 38.Schiffman, M., P. E. Castle, J. Jeronimo, A. C. Rodriguez, and S. Wacholder. 2007. Human papillomavirus and cervical cancer. Lancet 370890-907. [DOI] [PubMed] [Google Scholar]
- 39.Shimonovitz, S., A. Hurwitz, M. Dushnik, E. Anteby, T. Geva-Eldar, and S. Yagel. 1994. Developmental regulation of the expression of 72 and 92 kd type IV collagenases in human trophoblasts: a possible mechanism for control of trophoblast invasion. Am. J. Obstet. Gynecol. 171832-838. [DOI] [PubMed] [Google Scholar]
- 40.Sotlar, K., A. Stubner, D. Diemer, S. Menton, M. Menton, K. Dietz, D. Wallwiener, R. Kandolf, and B. Bültmann. 2004. Detection of high-risk human papillomavirus E6 and E7 oncogene transcripts in cervical scrapes by nested RT-polymerase chain reaction. J. Med. Virol. 74107-116. [DOI] [PubMed] [Google Scholar]
- 41.Sotlar, K., D. Diemer, A. Dethleffs, Y. Hack, A. Stubner, N. Vollmer, S. Menton, M. Menton, and K. Dietz. 2004. Detection and typing of human papillomavirus by E6 nested multiplex PCR. J. Clin. Microbiol. 423176-3184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.van den Brule, A. J., C. J. Meijer, V. Bakels, P. Kenemans, and J. M. Walboomers. 1990. Rapid detection of human papillomavirus in cervical scrapes by combined general primer-mediated and type-specific polymerase chain reaction. J. Clin. Microbiol. 282739-2743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Walboomers, J. M., M. V. Jacobos, M. M. Manos, F. X. Bosh, J. A. Kummer, K. S. Shah, P. J. Snijders, J. Peto, C. J. Meijer, and N. Munoz. 1999. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J. Pathol. 18912-19. [DOI] [PubMed] [Google Scholar]
- 44.Wentzensen, N., and M. von Knebel Doeberitz. 2007. Biomarkers in cervical cancer screening. Dis. Markers 23315-330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Woodman, C. B., S. I. Collins, and L. S. Young. 2007. The natural history of cervical HPV infection: unresolved issues. Nat. Rev. Cancer 711-22. [DOI] [PubMed] [Google Scholar]
- 46.Zur Hausen, H. 1996. Papillomavirus infections—a major cause of human cancer. Biochim. Biophys. Acta 1288F55-F78. [DOI] [PubMed] [Google Scholar]
- 47.Zur Hausen, H. 2000. Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. J. Natl. Cancer Inst. 92690-698. [DOI] [PubMed] [Google Scholar]
- 48.Zur Hausen, H. 2002. Papillomavirus and cancer: from basic studies to clinical application. Nat. Rev. 2342-350. [DOI] [PubMed] [Google Scholar]
