Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2009 Apr 13;77(7):2602–2611. doi: 10.1128/IAI.00033-09

Identification of a Novel Lipopolysaccharide Core Biosynthesis Gene Cluster in Bordetella pertussis, and Influence of Core Structure and Lipid A Glucosamine Substitution on Endotoxic Activity▿

Jeroen Geurtsen 1,3, Monika Dzieciatkowska 4, Liana Steeghs 2, Hendrik-Jan Hamstra 3, Johanna Boleij 3, Kelly Broen 3, Grietsje Akkerman 3, Hassan el Hassan 3, Jianjun Li 4, James C Richards 4, Jan Tommassen 1, Peter van der Ley 3,*
PMCID: PMC2708539  PMID: 19364841

Abstract

Lipopolysaccharide (LPS), also known as endotoxin, is one of the main constituents of the gram-negative bacterial outer membrane. Whereas the lipid A portion of LPS is generally considered the main determinant for endotoxic activity, the oligosaccharide moiety plays an important role in immune evasion and the interaction with professional antigen-presenting cells. Here we describe a novel four-gene cluster involved in the biosynthesis of the Bordetella pertussis core oligosaccharide. By insertionally inactivating these genes and studying the resulting LPS structures, we show that at least two of the genes encode active glycosyltransferases, while a third gene encodes a deacetylase also required for biosynthesis of full-length oligosaccharide. In addition, we demonstrate that mutations in the locus differentially affect LPS and whole-cell endotoxic activities. Furthermore, while analyzing the mutant LPS structures, we confirmed a novel modification of the lipid A phosphate with glucosamine and found that inactivation of the responsible glycosyltransferase reduces the endotoxic activity of the LPS.


Lipopolysaccharide (LPS) is an amphiphilic molecule located in the outer leaflet of the outer membrane of gram-negative bacteria. LPS possesses both endotoxic and adjuvant activities. Both these properties are based upon its recognition by the host Toll-like receptor 4 (TLR4)-MD-2 receptor complex (for reviews, see references 21 and 22). LPS usually consists of three distinct structural domains: lipid A, the core, and the O antigen. Lipid A functions as a hydrophobic membrane anchor and forms the bioactive component of the molecule (25, 29). The core region consists of a complex oligosaccharide, which, compared to the O antigen, shows only limited structural variability. In some bacteria (e.g., Enterobacteriaceae) the core oligosaccharide (core OS) can be divided into an inner core and an outer core. The outer core consists primarily of pyranosidic hexoses (e.g., d-glucose, d-galactose, and d-glucosamine [GlcN]), whereas the inner core consists primarily of octulosonic acids and heptopyranoses. In the vast majority of gram-negative bacteria, the core domain is connected to the lipid A domain by a specific carbohydrate, 2-keto-3-deoxyoctulosonic acid (Kdo) (25). The O antigen, which is not present in the LPS of some bacterial species, comprises the most variable part of the LPS and confers bacterial serotype specificity. It is composed of repeating sugar subunits containing one to eight sugars. Each O chain can contain up to 50 of these subunits. The O antigen has been implicated in bacterial immune escape, especially escape from serum complement-mediated lysis (25).

In contrast to the LPS of Bordetella bronchiseptica and Bordetella parapertussis, the LPS of Bordetella pertussis never contains an O-antigen domain (6, 23). Therefore, B. pertussis LPS is often referred to as lipooligosaccharide. B. pertussis produces two dominant LPS forms, band A LPS and band B LPS (23). Band B LPS is composed of lipid A and a core OS consisting of nine carbohydrates (5). Addition of a terminal trisaccharide, consisting of N-acetylglucosamine, 2,3-diacetamido-2,3-dideoxy-mannuronic acid, and 2-acetamido-4-N-methyl-2,4-dideoxy-fucose, to band B LPS forms the LPS referred to as band A LPS (Fig. 1A).

FIG. 1.

FIG. 1.

(A) Structure of B. pertussis LPS (adapted from the study of Caroff et al. [5]). Proposed truncated core OS structures of the BP2328 and BP2329 mutant strains are indicated by arrows. (B) Schematic diagram of the identified core OS biosynthesis locus. The dark gray arrows indicate the genes that encode putative glycosyltransferases, whereas the light gray and open arrows indicate the gene encoding a putative monosaccharide deacetylase and the flanking ORFs, respectively. (C) Analysis of LPS profiles for the wild-type B. pertussis strain (WT) and the BP2329, BP2328, BP2330, and BP2331 mutant strains by Tricine-SDS-PAGE.

Although the Bordetella and Escherichia coli core OS show some resemblance, the exact compositions and configurations of residues have marked differences. For example, the Bordetella core OS contains only one Kdo residue, instead of the two or three residues that are found in most other gram-negative bacteria, including E. coli. This was shown to be due to Bordetella KdtA functioning as a monofunctional Kdo transferase rather than a bifunctional Kdo transferase (14). Like the E. coli core OS, the Bordetella core OS starts with two heptose residues attached to Kdo (Fig. 1A). The responsible glycosyltransferases were identified and shown to be homologues of the WaaC and WaaF enzymes (1, 27). Additionally, the wlb locus containing the genes responsible for addition of the terminal trisaccharide in band A LPS has been identified (2, 3). The enzymes responsible for the synthesis of the remaining portion of the Bordetella core OS are currently unknown and await identification.

As the core biosynthesis pathway has been determined in considerable detail for other mucosal pathogens, particularly Neisseria meningitidis (15, 35), we used genetic information obtained for these pathogens as a starting point for identification of additional Bordetella core OS biosynthesis genes. A gene cluster involved in extension of the inner core from the heptose residues has been identified in N. meningitidis as icsBA, also known as lgtF and rfaK, respectively (16, 32). Since the inner core in both organisms contains a glucose β1,4 linked to heptose, this gene cluster is an obvious first lead for identification of putative B. pertussis LPS glycosyltransferases.

Here we identified a novel four-gene cluster involved in the biosynthesis of B. pertussis core OS. Structural analysis of the LPS from knockout mutants revealed that at least two of the genes encode functional glycosyltransferases, whereas a third gene encodes a molecule that functions as a sugar deacetylase also needed for biosynthesis of full-length core OS. Interestingly, during our analysis, we confirmed the presence of the recently identified GlcN modification of Bordetella lipid A and showed that this modification is involved in modulation of LPS endotoxic activity.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

All bacterial strains used are described in Table 1. Typically, the E. coli strains were grown at 37°C in Luria-Bertani broth with shaking at 150 rpm. When appropriate, bacteria were grown in the presence of 100 μg/ml ampicillin, 50 μg/ml kanamycin, or 10 μg/ml gentamicin for plasmid maintenance or strain selection. B. pertussis was grown in synthetic THIJS medium (30) or on Bordet-Gengou agar supplemented with 15% defibrinated sheep blood (Tritium) at 35°C.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Description or genotype Reference or source
B. pertussis strains
    B213 Streptomycin-resistant derivative of B. pertussis strain Tohama 17
    B213 ΔBP2328 BP2328 mutant of strain B213, Strr Kmr This study
    B213 ΔBP2329 BP2329 mutant of strain B213, Strr Kmr This study
    B213 ΔBP2330 BP2330 mutant of strain B213, Strr Kmr This study
    B213 ΔBP2331 BP2331 mutant of strain B213, Strr Kmr This study
    B213 ΔBP0398 BP0398 (arnT) mutant of strain B213, Strr Kmr This study
B. parapertussis strains
    BPP535 Streptomycin-resistant B. parapertussis strain NVIa
    BPP535 ΔBPP3824 BP3824 (arnT) mutant of strain BPP535, Strr Kmr This study
E. coli strains
    TOP10F′ F′[lacIq Tn10(Tetr)] mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 deoR recA1 araD139 Δ(ara-leu)7697 galU galK rpsL endA1 nupG Invitrogen
    DH5α F− Δ(lacZYA-algF)U169 thi-1 hsdR17 gyrA96 recA1 endA1 supE44 relA1 phoA φ80dlacZΔM15 12
    SM10(λpir) thi thr leu fhyA lacY supE recA::RP4-2-Tc::Mu λ pir R6K Kmr NVI
Plasmids
    pGEM-T Easy E. coli cloning vector, Ampr Promega
    pUC4K E. coli vector harboring kanamycin resistance cassette, Ampr Kmr 34
    pSS1129 Allelic exchange vector, bla gen rpsL oriV ColE1 oriT λ cos 28
    pGEM-BP2328up pGEM-T Easy derivative harboring BP2328 upstream sequence This study
    pGEM-BP2328down pGEM-T Easy derivative harboring BP2328 downstream sequence This study
    pGEM-BP2329up pGEM-T Easy derivative harboring BP2329 upstream sequence This study
    pGEM-BP2329down pGEM-T Easy derivative harboring BP2329 downstream sequence This study
    pGEM-BP2330 pGEM-T Easy derivative harboring BP2330 sequence This study
    pGEM-BP2331 pGEM-T Easy derivative harboring BP2331 sequence This study
    pGEM-BP0398 pGEM-T Easy derivative harboring BP0398 sequence This study
    pSS1129-BP2328KO pSS1129 derivative harboring BP2328 knockout construct, Kmr This study
    pSS1129-BP2329KO pSS1129 derivative harboring BP2329 knockout construct, Kmr This study
    pSS1129-BP2330KO pSS1129 derivative harboring BP2330 knockout construct, Kmr This study
    pSS1129-BP2331KO pSS1129 derivative harboring BP2331 knockout construct, Kmr This study
    pSS1129-BP0398KO pSS1129 derivative harboring BP0398 (arnT) knockout construct, Kmr This study
a

NVI, Netherlands Vaccine Institute, Bilthoven, The Netherlands.

Recombinant DNA techniques.

All plasmids used are described in Table 1. Plasmid DNA was isolated using the Promega WizardPlus SV Minipreps system. Restriction endonucleases were used according to the instructions of the manufacturer (Roche). DNA fragments were isolated from agarose gels using the Promega Wizard SV gel and PCR clean-up system. Ligation was performed using a rapid DNA ligation kit (Roche).

All primers used are described in Table 2. Chromosomal template DNA for PCRs was prepared by resuspending ∼109 bacteria in 50 μl of distilled water (dH2O), after which the suspension was heated for 15 min at 95°C. The suspension was then centrifuged for 1 min at 16,100 × g, after which the supernatant was used as template DNA. To construct B. pertussis mutant strains B213 ΔBP2328 and B213 ΔBP2329, DNA segments encompassing the 5′ region and upstream sequences of the corresponding open reading frames (ORFs) were amplified by using primers BP2328_FWup and BP2329_FWup, and primers BP2328_REVup and BP2329_REVup, both of which contain a BamHI site. Additionally, DNA fragments containing the 3′ regions and downstream sequences of the ORFs were obtained by performing PCR with primers BP2328_FWdown, BP2329_FWdown, both containing a BamHI site, and primers BP2328_REVdown and BP2329_REVdown. To construct B. pertussis BP2330, BP2331, and BP0398 (arnT) mutant strains, the corresponding ORFs were amplified by using primers BP2330_FW and BP2330_REV, primers BP2331_FW and BP2331_REV, and primers BP0398_FW and BP0398_REV, respectively. The PCRs were performed using pure Taq Ready-to-go PCR beads (Amersham Biosciences) in a 25-μl (total volume) reaction mixture with 5 pmol of each primer. The temperature program was as follows: 95°C for 3 min, followed by 30 cycles of 15 s at 95°C, 30 s at 55°C, and 1 min at 72°C and then 7 min at 72°C and cooling to 4°C. The PCR products were purified from agarose gels and subsequently cloned into pGEM-T Easy, resulting in plasmids pGEM-BP2328up, pGEM-BP2328down, pGEM-BP2329up, pGEM-BP2329down, pGEM2330, pGEM-BP2331, and pGEM-BP0398. The BamHI-SpeI fragments of pGEM-BP2328down and pGEM-BP2329down were ligated into BamHI-SpeI-restricted pGEM-BP2328up and pGEM-BP2329up, respectively. The latter plasmids, plasmid pGEM-BP2331, and plasmid pGEMBP0398 were cut with BamHI, EcoRV, and NruI, respectively, to allow insertion of the kanamycin resistance cassette from plasmid pUC4K obtained by BamHI, HinDII, and NruI digestion, respectively. Finally, EcoRI fragments of the constructs obtained were ligated into the EcoRI-restricted suicide plasmid pSS1129. The final constructs, designated pSS1129-BP2328KO, pSS1129-BP2329KO, pSS1129-BP2330KO, pSS1129-BP2331KO, and pSS1129-BP0398KO, contained the kanamycin resistance cassette in the same orientation as the direction of transcription of the operon. The pSS1129-based plasmids were used to transform E. coli SM10(λpir), which allowed subsequent transfer of the plasmids to B. pertussis and construction of B. pertussis BP2328, BP2329, BP2330, BP2331, and BP0398 mutants by allelic exchange. In addition, the pSS1129-BP0398KO construct was used to create a BPP3824 (arnT) knockout in B. parapertussis strain 535. Transformants were screened by PCR using various primer sets.

TABLE 2.

Primers used in this study

Primer Sequence (5′-3′)a
BP2328_FWup TTCCGCACTTACTGGCTGAG
BP2328_FWdown GGATCCTCGCGGTACGACAGCACAT
BP2328_REVup GGATCCTGTTGCGCGAGATGCTGGAG
BP2328_REVdown CCTCATCGCCAAGGTCAATC
BP2329_FWup TCACCTTCGACGACGGATAC
BP2329_FWdown GGATCCGTGCGCATCTACCTGATCC
BP2329_REVup GGATCCGAATCGACCACGATGAAC
BP2329_REVdown GATCCAGCTTGGCCTGGTTG
BP2330_FW GGGCGATTTCGTAGCA
BP2330_REV CGACGGATACCTGAAC
BP2331_FW GTGACGTGGTGGTACATCAG
BP2331_REV TGGTCTACCGCAGGAACAAT
BP0398_FW TACCTGGTGGCCGACTATCT
BP0398_REV eGCTGTTGGCCTTCGTCGTAT
a

BamHI restriction sites are underlined.

LPS isolation and preparation of O-deacylated LPS.

LPS was isolated using the hot phenol-water extraction method (36), with slight modifications (10). O-deacylation of LPS was achieved by mild hydrazinolysis (13). Briefly, LPS was dissolved in anhydrous hydrazine (200 μl) and incubated at 37°C for 50 min with constant stirring to release the O-linked fatty acyl chains. The mixture was cooled, and 600 μl of cold acetone was added in small portions to convert hydrazine to acetone hydrazone. The precipitate containing the O-deacylated LPS was collected by centrifugation (4,000 × g at 7°C for 30 min). The pellet was washed twice with 600 μl of cold acetone, centrifuged, and dissolved in water before lyophilization.

Capillary electrophoresis-ESI-MS.

A Prince capillary electrophoresis system (Prince Technologies) was coupled to a 4000 QTRAP mass spectrometer (Applied Biosystems/MDS Sciex, Concord, Canada). A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1.0 μl/min. Prepared samples were separated by using a ∼90-cm bare fused-silica capillary and 15 mM ammonium acetate in deionized water (pH 9.0). The electrospray ionization (ESI) voltage applied to the sprayer was −5.2 kV in negative-ion detection mode. For all of the mass spectrometry (MS) experiments, nitrogen was used as the curtain and collision gas. In the tandem MS (MS-MS) (enhanced product ion scan) and triplicate MS (MS-MS-MS) experiments, the scan speed was set to 4,000 Da/s with Q0 trapping, the trap fill time was set to “dynamic,” and the resolution of Q1 was set to “unit.” For MS-MS-MS experiments, the excitation coefficient was set at a value to excite only the first isotope for a single charged precursor with the excitation time set to 100 ms.

LPS analysis by Tricine-SDS-PAGE.

Approximately 109 bacteria were suspended in 50 μl of sample buffer (18), and 0.5 mg/ml (final concentration) proteinase K was added. The samples were incubated for 60 min at 55°C and then for 10 min at 95°C to inactivate the proteinase K. The samples were then diluted 10-fold by adding sample buffer, after which 2 μl of each sample was applied to a Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) gel (19). Bromophenol blue was allowed to run into the separating gel at 35 V, after which the voltage was increased to 105 V. After the front reached the bottom of the gel, electrophoresis was continued for another 45 min. The gel was fixed overnight in water-ethanol-acetic acid (11:8:1, vol/vol/vol) and subsequently stained with silver as described previously (31).

Analysis of lipid A by ESI-MS.

The lipid A moiety of LPS was isolated from whole bacterial cells as described previously (7). Briefly, 4 mg lyophilized cells was washed two times with 400 μl chloroform-methanol-dH2O (3:2:0.25), after which the cell pellet was resuspended in a solution containing 150 μl dH2O and 650 μl isobutyric acid-ammonium hydroxide (2 M) (5:1.5, vol/vol). The resuspended cells were incubated for 2 h at 100°C, cooled to 4°C on ice, and centrifuged for 10 min at 20,000 × g. The supernatant was diluted with 2 ml dH2O and lyophilized. The lyophilized material was washed two times with 400 μl methanol, after which lipid A was extracted using 200 μl chloroform-methanol-dH2O (3:1.5:0.25). For structural analysis, the lipid A extract was analyzed by ESI-MS using a Finnigan LCQ in the negative-ion mode (8).

Monocyte stimulation assay.

The human monocyte cell line MonoMac-6 (MM6) (37) was stimulated with purified LPS or whole bacterial cells as described previously (10). Following stimulation, interleukin-6 (IL-6) concentrations in the culture supernatants were quantified with an enzyme-linked immunosorbent assay (ELISA) for human IL-6 performed according to the manufacturer's instructions (PeliKine Compact).

Statistical analysis.

Data were statistically analyzed using Student's t test (two-tailed, two-sample equal variance). Differences were considered significant if the P value was <0.05.

RESULTS

Identification of a novel LPS biosynthesis locus in B. pertussis.

As a glucose-β1,4-heptose linkage is a common feature of the LPS inner core in many bacteria, including B. pertussis, we used genes encoding glycosyltransferases with this specificity from N. meningitidis (lgtF, or icsB), among others, to identify homologous sequences in the B. pertussis Tohama genome sequence. In this way we found a cluster of four genes (BP2328 to BP2331; GenBank accession numbers NP_880966 to NP_880969), three of which encode enzymes showing sequence similarity to LPS glycosyltransferases from various bacteria (BP2328, BP2329, and BP2331). The BP2330 protein shows the highest level of similarity to a sugar deacetylase from Xylella fastidiosa. The four ORFs are close to each other and in some cases even overlap, suggesting that they constitute an operon (Fig. 1B). The genes upstream and, in the reverse orientation, downstream of the operon putatively encode homologues of the DNA polymerase III alpha subunit DnaE and of the putative alkaline phosphatase YhbX of E. coli, respectively. In order to study the role of the genes in LPS biosynthesis, we prepared constructs with suicide plasmid pSS1129 carrying the individual BP2328, BP2329, BP2330, and BP2331 genes interrupted by a kanamycin resistance cassette for insertional inactivation by allelic exchange. Using this approach, knockout mutants with mutations in all four genes could be readily obtained with B. pertussis strain B213. Analysis of the LPS by Tricine-SDS-PAGE showed that the BP2328, BP2329, and BP2330 mutant strains clearly expressed truncated LPS (Fig. 1C). In contrast, the LPS profile of the BP2331 mutant appeared to be normal and was indistinguishable from that of the wild-type strain.

LPS structural analysis.

To determine the structure of the core OS, LPS from the wild-type and BP2328, BP2329, BP2330, and BP2331 mutant strains were isolated, O deacylated, and analyzed by ESI-MS in the negative-ion mode (Fig. 2). The sugar abbreviations and proposed core OS compositions are summarized in Table 3. The spectrum of wild-type O-deacylated LPS (Fig. 2A) revealed a major triply charged ion at m/z 1,108.5 corresponding to full-length B. pertussis LPS with the composition GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA·Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A- OH. Additional ions were present at m/z 770.1 ([M-3H]3−), 811.1 ([M-4H]4−), 831.4 ([M-4H]4−), 888.3 ([M-3H]3−), 951.8 ([M-H]−), 987.1 ([M-2H]2−), 1,081.7 ([M-3H]3−), 1,155.0 ([M-2H]2−), and 1,162.1 ([M-3H]3−), together with corresponding sodium or potassium adducts at m/z 1,115.6 ([M-3H+Na]3−) and 1,121.1 ([M-3H+K]3−). Most of these ions corresponded to dephosphorylated or truncated glycoforms; however, the triply charged ion at m/z 1,162.1 corresponded to full-length B. pertussis LPS with an additional HexN moiety (Table 3). Recently, Marr and coworkers identified a novel GlcN modification of Bordetella lipid A (20). They showed that this modification can replace both lipid A phosphate groups and that it is dependent on the activity of an ortholog of the glycosyltransferase ArnT (20). To resolve the location of the additional HexN moiety in our wild-type O-deacylated LPS preparation, MS-MS studies in negative-ion mode were performed (Fig. 3). The product ion spectra obtained for the triply charged ions at m/z 1,108.3 (Fig. 3A) and 1,162.0 (Fig. 3B) both showed that there was a singly charged fragment ion at m/z 951.5, consistent with the notion that O-deacylated lipid A-OH, which resulted from cleavage between the Kdo-lipid A bond under collision-induced dissociation conditions, consisted of a β-(1→6)-linked disaccharide of N-acylated (3-OH C14) GlcN residues, with each residue having a phosphate group substitution. The spectrum for the ion at m/z 1,162.0 also showed an additional ion at m/z 1,112.6, which suggested that the extra HexN residue was directly attached to the O-deacylated lipid A. This conclusion was further confirmed by MS-MS-MS analysis of m/z 1,112.6 (Fig. 3C). These results confirm the results reported by Marr et al. (20) and indicate that B. pertussis is able to modify its lipid A by GlcN substitution. Since MS analysis cannot distinguish a lipid A-attached GlcN moiety from a core OS GlcN moiety, precursor ion scan experiments screening for the presence of regular (m/z 951.5) or GlcN-modified (m/z 1,112.6) O-deacylated lipid A were performed for all O-deacylated LPS preparations. This type of MS-MS experiment is particularly powerful for screening for the presence of specific glycoforms in a complex mixture. This analysis revealed that variation in GlcN substitution resulted in different glycoforms with the same composition (Table 3).

FIG. 2.

FIG. 2.

Negative-ion ESI-MS of O-deacylated LPS of wild-type B. pertussis (WT) (A) and B. pertussis mutant strains BP2328 (B), BP2329 (C), BP2330 (D), and BP2331 (E).

TABLE 3.

Negative-ion ESI-MS data and proposed compositions for O-deacylated LPS of wild-type B. pertussis and B. pertussis mutant strains BP2328, BP2329, BP2330, and BP2331

Sample Observed ions (m/z)
Molecular mass (Da)
Relative abundance (%) Proposed compositiona
[M-4H]4− [M-3H]3− [M-2H]2− Observed Calculated
Wild type 987.1 1,976.2 1,975.8 16.6 Glc·GlcA·Hep2·P·Kdo·lipid A-OH
770.1 1,155.0 2,312.7 2,312.1 12.8 GalNA·Glc·GlcN·GlcA·Hep2·P·Kdo·lipid A-OH
888.3 2,667.9 2,665.4 4.9 GalNA·Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH
811.1 1,081.7 3,248.3 3,246.9 11.8 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·Kdo·lipid A-OH
831.4 1,108.5 3,329.0 3,326.8 37.2 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH
GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN·GlcA·Hep3·P·Kdo·lipid A-OH·GlcN
1,162.1 3,489.3 3,488.0 16.7 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH·GlcN
BP2328 743.6 1,115.2 2,233.1 2,232.1 13.8 GalNA·Glc·GlcN·GlcA·Hep2·Kdo·lipid A-OH
770.0 1,155.1 2,312.6 2,312.1 61.8 GalNA·Glc·GlcN·GlcA·Hep2·P·Kdo·lipid A-OH
GalNA·Glc·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN
823.7 1,235.7 2,473.8 2,473.3 12.1 GalNA·Glc·GlcN·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN
1,034.6 2,071.2 2,070.8 6.7 GalNA·Glc·GlcA·Hep2·Kdo·lipid A-OH
1,074.6 2,151.2 2,150.8 5.6 GalNA·Glc·GlcA·Hep2·P·Kdo·lipid A-OH
BP2329 866.0 1,734.0 1,733.7 8.6 GlcA·Hep2·Kdo·lipid A-OH
603.9 906.0 1,814.4 1,813.6 36.8 GlcA·Hep2·P·Kdo·lipid A-OH
657.6 986.6 1,975.5 1,974.8 37.2 GlcN·GlcA·Hep2·P·Kdo·lipid A-OH
GlcA·Hep2·P·Kdo·lipid A-OH·GlcN
1,067.1 2,136.2 2,136.0 6.6 GlcN·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN
BP2330 783.9 1,175.9 2,354.3 2,354.0 24.5 Glc·GlcN·GlcA·HexNAcA·Hep2·P·Kdo·lipid A-OH
628.3 837.6 1,257.0 2,516.3 2,515.2 42.2 Glc·GlcN2·GlcA·HexNAcA·Hep2·P·Kdo·lipid A-OH
Glc·GlcN·GlcA·HexNAcA·Hep2·P·Kdo·lipid A-OH·GlcN
891.3 1,337.1 2,676.6 2,676.4 24.0 Glc·GlcN2·GlcA·HexNAcA·Hep2·P·Kdo·lipid A-OH·GlcN
BP2331 684.9 1,027.5 2,057.4 2,057.0 20.6 Glc·GlcN·GlcA·Hep2·Kdo·lipid A-OH
Glc·GlcA·Hep2·Kdo·lipid A-OH·GlcN
711.5 1,067.4 2,137.2 2,137.0 12.5 Glc·GlcN·GlcA·Hep2·P·Kdo·lipid A-OH
Glc·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN
738.5 2,218.5 2,218.2 3.7 Glc·GlcN·GlcA·Hep2·Kdo·lipid A-OH·GlcN
765.2 1,148.0 2,298.3 2,298.1 6.3 Glc·GlcN·GlcA·Hep2·P·Kdo· lipid A-OH·GlcN
1,291.6 2,585.2 2,585.5 9.0 GalNA·Glc·GlcN2·GlcA·Hep3·Kdo·lipid A-OH
GalNA·Glc·GlcN·GlcA·Hep3·Kdo·lipid A-OH·GlcN
887.8 1,332.0 2,666.2 2,665.4 9.8 GalNA·Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH
GalNA·Glc·GlcN·GlcA·Hep3·P·Kdo·lipid A-OH·GlcN
810.9 1,081.7 3,247.9 3,246.9 9.8 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·Kdo·lipid A-OH
831.1 1,108.3 3,328.2 3,326.8 19.0 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH
GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN·GlcA·Hep3·P·Kdo·lipid A-OH·GlcN
871.2 1,162.0 3,488.9 3,488.0 9.3 GlcNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA· Glc·GlcN2·GlcA·Hep3·P·Kdo·lipid A-OH·GlcN
a

Average mass units were used for calculation of the following molecular masses (in Da) based on proposed compositions, as follows: glucose (Glc), 162.14; heptose (Hep), 192.17; 2-keto-3-deoxyoctulosonic acid (Kdo), 220.18; phosphate (P), 79.98; glucosamine (GlcN), 161.17; hexosamine (HexN), 161.17; N-acetylhexosaminuronic acid (HexNAcA), 218.17; glucuronic acid (GlcA), 176.13; N-acetylglucosamine (GlcNAc), 203.19; 2-acetamido-4-N-methyl-2,4-dideoxy-fucose (Fuc2NAc4NMe), 200.12; 2,3-acetamido-2,3-dideoxy-mannuronic acid (Man2NAc3NAcA), 258.09; galactosaminuronic acid (GalNA),175.13; and lipid A-OH, 953.02. This table does not include sodium and potassium adducts and singly charged lipid A-OH ions (m/z 952, [M-H]−).

FIG. 3.

FIG. 3.

Negative-mode MS-MS analysis of O-deacylated LPS from the BP2331 mutant strain. (A) Extracted MS-MS spectrum of the ion at m/z 1,108.3; (B) extracted MS-MS spectrum of the ion at m/z 1,162.1; (C) extracted MS-MS-MS spectrum of the ion at m/z 1,112.6 from the ion at m/z 1,162.0.

The ESI-MS spectrum of the BP2328 mutant O-deacylated LPS (Fig. 2B) showed triply charged ions at m/z 743.6, 770.0, and 823.7, together with corresponding doubly charged ions at m/z 1,115.2, 1,155.1, and 1,235.7. Additional peaks were present at m/z 777.3 ([M-4H+Na]3−), 952.1 ([M-H]−), 1,034.6 ([M-2H]2−), 1,074.6 ([M-2H]2−), and 1,166.1 ([M-3H+Na]2−). Assignment of the peaks revealed that the most complete core OS structure was represented by the ions at m/z 823.7 and 1,235.7, corresponding to the LPS composition GalNA·Glc·GlcN·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN. Analysis of BP2329 mutant O-deacylated LPS (Fig. 2C) showed triply charged ions at m/z 603.9 and 657.6, together with corresponding doubly charged ions at m/z 906.0 and 986.6. In addition, sodium and potassium adducts of these ions were present at m/z 917.4 and 997.6 and at m/z 925.0 and 1,005.6, respectively. Additional peaks were present at m/z 866.0 ([M-2H]2−) and 1,067.1 ([M-2H]2−). In this case, the most complete core structure was represented by the doubly charged ion at m/z 1,067.1, corresponding to the LPS composition GlcN·GlcA·Hep2·P·Kdo·lipid A-OH·GlcN. Analysis of BP2330 mutant O-deacylated LPS (Fig. 2D) showed triply charged ions at m/z 783.9, 837.6, and 891.3, together with corresponding doubly charged ions at m/z 1,175.9, 1,257.0, and 1,337.1 and a quadruply charged ion at m/z 628.3. The most complete core structure was represented by the doubly and triply charged ions at m/z 1,337.1 and 891.3, corresponding to the LPS composition Glc·GlcN2·GlcA·HexNAcA·Hep2·P·Kdo·lipid A-OH·GlcN. Analysis of BP2331 mutant O-deacylated LPS (Fig. 2E) showed a large number of peaks, including triply charged ions at m/z 1,108.3 and 1,162.0 corresponding to full-length B. pertussis LPS and full-length B. pertussis LPS with an additional GlcN moiety, respectively.

Endotoxic activity of B. pertussis LPS mutants.

To assess the consequences of the mutations for the endotoxic activity of LPS, the ability of purified LPS to activate NFκB, as measured by the ability to stimulate IL-6 production in human monocytes, was tested. Compared to wild-type LPS, LPS from the BP2331 mutant strain had a modest but significantly greater ability to stimulate IL-6 production (P = 0.023) (Fig. 4A). In contrast, the activities of the BP2328, BP2329, and BP2330 mutant LPS were significantly reduced (P < 0.05) (Fig. 4A). The same assay was performed with whole bacterial cells (Fig. 4B). In this case, the BP2331 mutant cells showed activity similar to that of wild-type cells (Fig. 4B). Interestingly, the BP2328 mutant cells were as active as wild-type cells in spite of their less active LPS (Fig. 4A). Consistent with the lower activity of their LPS, the BP2329 and BP2330 mutant strains showed significantly reduced capacities to induce IL-6 production (P < 0.05). Overall, these data suggest that the mutations in the locus containing BP2328 to BP2331 differentially affected the endotoxic activities of the LPS and whole bacterial cells. Furthermore, it appears that components other than LPS contribute to whole-cell toxicity, which is consistent with our previous results (9).

FIG. 4.

FIG. 4.

Induction of IL-6 production by purified B. pertussis LPS and whole bacterial cells. The production of IL-6 by the human monocyte cell line MM6 was stimulated with 1 μg/ml purified LPS(A) or with whole bacterial cells at a multiplicity of infection of 5 (B). The strains used were a B. pertussis wild-type strain (WT) and the BP2328, BP2329, BP2330, and BP2331 mutant strains. The IL-6 concentrations in culture supernatants were quantified by an ELISA for human IL-6. The bars and error bars indicate the averages and standard deviations for three individual experiments. Significant differences (P < 0.05) are indicated by an asterisk.

Lipid A GlcN modification increases the endotoxic activity of LPS.

As demonstrated above, BP2331 LPS exhibited a modest but significantly increased ability to stimulate IL-6 production in monocytes. With the knowledge that full-length core OS was present in both wild-type and BP2331 LPS (Table 3) and that the lipid A domain of LPS is mainly responsible for its endotoxic activity (29), we set out to further analyze possible variations in lipid A. For this, lipid A was released from whole bacterial cells using isobutyric acid, after which the structure was analyzed by ESI-MS. As indicated in Table 4, the lipid A molecules of the wild-type and mutant strains were all primarily penta-acylated (>90%). Yet compared to wild-type lipid A, lipid A from the BP2331 mutant strain had a low but consistently higher level of GlcN modification (Table 4). In addition, the BP2331 lipid A was the only lipid A in which a double GlcN substitution could be detected (Table 4). The lipid A molecules from the BP2328, BP2329, and BP2330 mutants had lower levels of substitution with GlcN and phosphate, but otherwise they were similar to wild-type lipid A. Interestingly, the lower level of GlcN substitution correlated with the reduced endotoxic activity of the mutant LPS (Fig. 4A). To further address the potential importance of the GlcN modification for the activity of the LPSs, a B. pertussis mutant strain in which the arnT gene (BP0398) (the gene encoding the glycosyltransferase responsible for the GlcN modification [20]) was insertionally inactivated was created. ESI-MS analysis of the lipid A portion of this strain confirmed the absence of the GlcN modification (data not shown). Analysis of the ability to activate monocytes revealed that compared to wild-type LPS, the ArnT mutant LPS displayed significantly decreased activity (Fig. 5A). Similar results were obtained for whole B. pertussis cells (Fig. 5B). Although evident, the reduction in the endotoxic activity of the mutant LPS was not very dramatic. This may be explained by the relatively low percentage of GlcN-modified lipid A in our wild-type B. pertussis strain (Table 4). Furthermore, wild-type B. pertussis LPS is known to have low intrinsic endotoxic activity, which may result in differences that are relatively small. For this reason, we analyzed lipid A molecules of different B. pertussis strains, as well as other Bordetella species, and found that a close relative of B. pertussis, B. parapertussis, expressed a particularly large amount of GlcN-modified lipid A (∼52% of all lipid A species). Subsequently, a B. parapertussis arnT (BPP3824) knockout mutant was constructed and found to lack the GlcN modification as the only alteration in its lipid A (data not shown). Comparison of the activities of the LPS (Fig. 5A) and whole bacterial cells (Fig. 5B) of this mutant strain to those of the wild-type strain revealed that the toxicity was dramatically decreased (P < 0.001). This observation indicates that the lipid A-GlcN modification modulates the endotoxicity of the B. parapertussis LPS by augmenting its activity.

TABLE 4.

Relative abundance of lipid A molecular ions as determined by ESI-MS

Strain Relative abundance
% with HexN
m/z 1,348 (−C14) m/z 1,477 (−PO4) m/z 1,557 m/z 1,586 (−3OH C10, +3OH C12) m/z 1,719 (+HexN) m/z 1,880 (+2HexN)
Wild type 6.7 55.9 6.7 30.7 30.7
BP2328 13.4 70.4 4.9 11.3 11.3
BP2329 7.9 15.2 66.2 4.0 6.6 6.6
BP2330 9.8 10.3 54.3 7.6 17.4 17.4
BP2331 5.7 52.1 3.1 33.3 5.7 39

FIG. 5.

FIG. 5.

Induction of IL-6 production by B. pertussis and B. parapertussis wild-type and arnT knockout cells and by purified LPS. IL-6 production by the human monocytic cell line MM6 was stimulated with 10 μg/ml purified LPS (A) or with whole bacterial cells at a multiplicity of infection of 5 (B). The strains used were the wild-type strains (WT) and the arnT mutant strains (ArnT KO). The IL-6 concentrations in the culture supernatants were quantified by an ELISA for human IL-6 The bars and error bars indicate the averages and standard deviations for three individual experiments. Significant (P < 0.05) and highly significant (P < 0.001) differences are indicated by one and two asterisks, respectively.

DISCUSSION

The goal of the present study was to identify novel genes involved in core OS biosynthesis in the genome of B. pertussis. By using sequences of known LPS glycosyltransferases, we identified a four-gene operon. In a previous study, in which the genome sequence of the poultry pathogen Bordetella avium was compared to the genome sequences of other bordetellae, a gene cluster homologous to the cluster identified here was described as a gene cluster involved in LPS biosynthesis (26). However, no functional studies which could confirm this assignment were described.

To study the putative role of the operon in B. pertussis LPS biosynthesis, we inactivated the genes individually by allelic exchange and compared the LPS profiles of the wild-type and mutant strains using Tricine-SDS-PAGE and ESI-MS. We found that the wild-type strain not only contained full-length B. pertussis LPS but also harbored species with an additional HexN (GlcN) moiety, which, as we showed, was directly attached to lipid A (Fig. 3). The proposed truncated oligosaccharide structures for the BP2328 and BP2329 mutant strains are indicated in Fig. 1A. The most complete core OS structure in the BP2328 mutant strain was GalNA·Glc·GlcN·GlcA·Hep2·P·Kdo, indicating that the BP2328 mutant strain lacks the terminal trisaccharide, a heptose residue, and one of the GlcN residues. This composition suggests that the BP2328-encoded protein functions as a GlcN:glucose-α1,4-glucosaminyltransferase (Fig. 1A). Analysis of the BP2329 mutant LPS showed that its core OS was further truncated and that the most complete structure was GlcN·GlcA·Hep2·P·Kdo. Since this structure lacks the Glc to which the second GlcN of the core OS should be connected, the remaining GlcN residue must be attached to the second heptose. Therefore, this composition suggests that the BP2329-encoded protein functions as a glucose:heptose-β1,4-glucosyltransferase that attaches Glc to the first heptose subunit (Fig. 1A). This suggestion is consistent with the high level of homology of this gene product with other glucose:heptose-β1,4-glucosyltransferases, such as the lgtF (icsB) gene product, which was used to identify the gene in the first place. For BP2330 LPS, the most complete core OS structure was Glc·GlcN2·GlcA·HexNAcA·Hep2·P·Kdo. This structure lacks the terminal trisaccharide, a heptose residue, and the GalNA residue. Yet it has an additional HexNAcA, which most likely corresponds to an acetylated GalNA precursor. Since BP2330 shows the highest levels of homology to sugar deacetylases, we propose that BP2330 is responsible for the deacetylation of GalNAcA, leading to the GalNA residue that is normally present in the core OS. Since this structure also lacks the terminal trisaccharide and heptose residues, addition of these residues seems to be dependent on GalNA deacetylation. The most complicated phenotype was that observed for the BP2331 mutant. Although the BP2331 protein shows high levels of sequence similarity to various LPS glycosyltransferases, full-length B. pertussis LPS was still present in the mutant strain. This observation suggests either that the BP2331 gene does not encode a functional LPS glycosyltransferase, that the enzyme is not expressed under the growth conditions used, or that the encoded enzyme shows redundancy. Consistent with the last possibility, we identified a gene, BP3671 (GenBank accession number CAE43928), in the genome of B. pertussis which encodes a protein that shows 69% identity to the BP2331 protein.

After the structure of the LPS was analyzed, purified LPS and whole bacterial cells were tested to determine their abilities to stimulate IL-6 production. The results showed that the BP2331 mutant strain had a capacity to induce IL-6 production comparable to that of the wild-type strain (Fig. 4B). Yet purified LPS from the mutant strain was more active than wild-type LPS, as demonstrated by its significantly increased ability to stimulate IL-6 production (Fig. 4A). ESI-MS analysis of the corresponding lipid A moieties indicated that compared to wild-type LPS, the BP2331 LPS was more heterogeneous and had a higher degree of GlcN modification. How inactivation of the BP2331 gene led to increased heterogeneity and more GlcN substitution is not clear. However, since BP2331 is the first gene in the operon, insertion of the kanamycin resistance cassette may have had polar effects on nearby genes. The altered expression of these genes might explain the increased heterogeneity of the BP2331 LPS and perhaps also the increased level of GlcN substitution as a pleiotropic effect.

Lipid A-GlcN modification was recently described for Bordetella (20). This modification is reminiscent of the lipid A-4-amino-4-deoxy-l-arabinose (l-Ara4N) and lipid A-galactosamine modifications described for other bacteria (24). Increasing the positive charge of lipid A protects the bacteria against killing by cationic antimicrobial peptides, such as polymyxin B (11). Here we showed that besides this protective function, lipid A-GlcN modification and thus potentially also l-Ara4N and galactosamine modifications modulate the toxicity of the LPS. While the importance of lipid A acylation and phosphorylation for LPS toxicity is well established, to our knowledge no such effect has previously been described for modification with amino sugars. However, in retrospect, results of previous studies may have pointed in this direction. For instance, the LPS of Burkholderia mallei, although devoid of hexa-acylated forms, is a very potent activator of human TLR4 (4). It was shown to consist of a mixture of tetra- and penta-acylated species nonstoichiometrically substituted with l-Ara4N residues and to be able to stimulate human macrophages to the same degree as E. coli LPS. The high activity may have been caused by the aminoarabinose substitution, although this was not directly demonstrated.

Compared to the wild-type cells and LPS, cells and purified LPS of the BP2329 and BP2330 mutant strains displayed decreased abilities to stimulate IL-6 production. This result is consistent with a role for lipid A-GlcN modification in biological activity, as these mutant strains displayed a relatively low degree of GlcN substitution (Table 4). However, the core truncations may have also affected the physical behavior of the LPS and thereby its activity. Another possibility is that the core OS is involved in interactions with additional receptors (e.g., C-type lectins), which may influence its ability to activate NFκB (33). The results for the BP2328 mutant strain were more complex. Whereas the BP2328 mutant LPS was less active, the whole bacterial cells displayed an activity similar to that of wild-type cells. As whole cells contain many cytokine-inducing components in addition to LPS and synergy between different TLR agonists is a well-known phenomenon, interpretation of these results is rather complex.

Overall, we have demonstrated that the locus containing BP2328 to BP2331 is involved in the biosynthesis of the B. pertussis core OS. Mutations in this locus not only altered the structure of the core OS but also differentially affected the endotoxic activity of the LPS and whole bacterial cells. Whether the differences are directly related to the alterations in the core OS or the result of secondary alterations in lipid A GlcN substitution remains to be determined. Nevertheless, these findings may be interesting from the perspective of vaccine development, as they may allow development of strains that more efficiently prime an immune response when they are used in a whole-cell pertussis vaccine. Therefore, our next goals are to study the effects of the mutations on induction of an immune response and to test the vaccine potency and toxicity of the mutants in in vivo protection assays.

Editor: A. Camilli

Footnotes

▿

Published ahead of print on 13 April 2009.

REFERENCES

  • 1.Allen, A. G., T. Isobe, and D. J. Maskell. 1998. Identification and cloning of waaF (rfaF) from Bordetella pertussis and use to generate mutants of Bordetella spp. with deep rough lipopolysaccharide. J. Bacteriol. 18035-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Allen, A., and D. J. Maskell. 1996. The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol. Microbiol. 1937-52. [DOI] [PubMed] [Google Scholar]
  • 3.Allen, A. G., R. M. Thomas, J. T. Cadisch, and D. J. Maskell. 1998. Molecular and functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol. Microbiol. 2927-38. [DOI] [PubMed] [Google Scholar]
  • 4.Brett, P. J., M. N. Burtnick, D. S. Snyder, J. G. Shannon, P. Azadi, and F. C. Gherardini. 2007. Burkholderia mallei expresses a unique lipopolysaccharide mixture that is a potent activator of human Toll-like receptor 4 complexes. Mol. Microbiol. 63379-390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Caroff, M., J. Brisson, A. Martin, and D. Karibian. 2000. Structure of the Bordetella pertussis 1414 endotoxin. FEBS Lett. 4778-14. [DOI] [PubMed] [Google Scholar]
  • 6.Di Fabio, J. L., M. Caroff, D. Karibian, J. C. Richards, and M. B. Perry. 1992. Characterisation of the common antigenic lipopolysaccharide O-chains produced by Bordetella bronchiseptica and Bordetella parapertussis. FEMS Microbiol. Lett. 76275-281. [DOI] [PubMed] [Google Scholar]
  • 7.El Hamidi, A., A. Tirsoaga, A. Novikov, A. Hussein, and M. Caroff. 2005. Microextraction of bacterial lipid A: easy and rapid method for mass spectrometric characterization. J. Lipid Res. 461773-1778. [DOI] [PubMed] [Google Scholar]
  • 8.Geurtsen, J., E. Angevaare, M. Janssen, H.-J. Hamstra, J. ten Hove, A. de Haan, B. Kuipers, J. Tommassen, and P. van der Ley. 2007. A novel secondary acyl chain in the lipopolysaccharide of Bordetella pertussis required for efficient infection of human macrophages. J. Biol. Chem. 28237875-37884. [DOI] [PubMed] [Google Scholar]
  • 9.Geurtsen, J., F. Fransen, R. J. Vandebriel, E. R. Gremmer, L. J. de la Fonteyne-Blankestijn, B. Kuipers, J. Tommassen, and P. van der Ley. 2008. Supplementation of whole-cell pertussis vaccines with lipopolysaccharide analogs: modification of vaccine-induced immune responses. Vaccine 26899-906. [DOI] [PubMed] [Google Scholar]
  • 10.Geurtsen, J., L. Steeghs, H.-J. Hamstra, J. ten Hove, A. de Haan, B. Kuipers, J. Tommassen, and P. van der Ley. 2006. Expression of the lipopolysaccharide-modifying enzymes PagP and PagL modulates the endotoxic activity of Bordetella pertussis. Infect. Immun. 745574-5585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol. Microbiol. 271171-1182. [DOI] [PubMed] [Google Scholar]
  • 12.Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166557-580. [DOI] [PubMed] [Google Scholar]
  • 13.Holst, O. 2000. Deacylation of lipopolysaccharides and isolation of oligosaccharides phosphates, p. 345-353. In O. Holst (ed.), Methods in molecular biology. Bacterial toxins: methods and protocols. Humana Press, Totowa, NJ. [DOI] [PubMed]
  • 14.Isobe, T., K. A. White, A. G. Allen, M. Peacock, C. R. H. Raetz, and D. J. Maskell. 1999. Bordetella pertussis waaA encodes a monofunctional 2-keto-3-deoxy-d-manno-octulosonic acid transferase that can complement an Escherichia coli waaA mutation. J. Bacteriol. 1812648-2651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jennings, M. P., Y. N. Srikhanta, E. R. Moxon, M. Kramer, J. T. Poolman, B. Kuipers, and P. van der Ley. 1999. The genetic basis of the phase variation repertoire of lipopolysaccharide immunotypes in Neisseria meningitidis. Microbiology 1453013-3021. [DOI] [PubMed] [Google Scholar]
  • 16.Kahler, C. M., R. W. Carlson, M. M. Rahman, L. E. Martin, and D. S. Stephens. 1996. Two glycosyltransferase genes, lgtF and rfaK, constitute the lipooligosaccharide ice (inner core extension) biosynthesis operon of Neisseria meningitidis. J. Bacteriol. 1786677-6684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kasuga, B., Y. Nakase, K. Ukishima, and K. Takatsu. 1953. Studies on Haemophilus pertussis. Kitasato Arch. Exp. Med. 2721-28. [PubMed] [Google Scholar]
  • 18.Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227680-685. [DOI] [PubMed] [Google Scholar]
  • 19.Lesse, A. J., A. A. Campagnari, W. E. Bittner, and M. A. Apicella. 1990. Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J. Immunol. Methods 126109-117. [DOI] [PubMed] [Google Scholar]
  • 20.Marr, N., A. Tirsoaga, D. Blanot, R. Fernandez, and M. Caroff. 2008. Glucosamine found as a substituent of both phosphate groups in Bordetella lipid A backbones: role of a BvgAS-activated ArnT ortholog. J. Bacteriol. 1904281-4290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.O'Neill, L. A. J. 2006. How Toll-like receptors signal: what we know and what we don't know. Curr. Opin. Immunol. 183-9. [DOI] [PubMed] [Google Scholar]
  • 22.Pålsson-McDermott, E. M., and L. A. J. O'Neill. 2004. Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology 113153-162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Peppler, M. S. 1984. Two physically and serologically distinct lipopolysaccharide profiles in strains of Bordetella pertussis and their phenotype variants. Infect. Immun. 43224-232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Raetz, C. R. H., C. M. Reynolds, M. S. Trent, and R. E. Bishop. 2007. Lipid A modification systems in gram-negative bacteria. Annu. Rev. Biochem. 76295-329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Raetz, C. R. H., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71635-700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sebaihia, M., A. Preston, D. J. Maskell, H. Kuzmiak, T. D. Connell, N. D. King, P. E. Orndorff, D. M. Miyamoto, N. R. Thomson, D. Harris, A. Goble, A. Lord, L. Murphy, M. A. Quail, S. Rutter, R. Squares, S. Squares, J. Woodward, J. Parkhill, and L. M. Temple. 2006. Comparison of the genome sequence of the poultry pathogen Bordetella avium with those of B. bronchiseptica, B. pertussis, and B. parapertussis reveals extensive diversity in surface structures associated with host interaction. J. Bacteriol. 1886002-6015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sisti, F., J. Fernández, M. E. Rodríguez, A. Lagares, N. Guiso, and D. F. Hozbor. 2002. In vitro and in vivo characterization of a Bordetella bronchiseptica mutant strain with a deep rough lipopolysaccharide structure. Infect. Immun. 701791-1798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Stibitz, S. 1994. Use of conditionally counterselectable suicide vectors for allelic exchange. Methods Enzymol. 235458-465. [DOI] [PubMed] [Google Scholar]
  • 29.Takada, H., and S. Kotani. 1989. Structural requirements of lipid A for endotoxicity and other biological activities. Crit. Rev. Microbiol. 16477-523. [DOI] [PubMed] [Google Scholar]
  • 30.Thalen, M., J. van den Ijssel, W. Jiskoot, B. Zomer, P. Roholl, C. de Gooijer, C. Beuvery, and J. Tramper. 1999. Rational medium design for Bordetella pertussis: basic metabolism. J. Biotechnol. 75147-159. [DOI] [PubMed] [Google Scholar]
  • 31.Tsai, C. M., and C. E. Frasch. 1982. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119115-119. [DOI] [PubMed] [Google Scholar]
  • 32.van der Ley, P., M. Kramer, A. Martin, J. C. Richards, and J. T. Poolman. 1997. Analysis of the icsBA locus required for biosynthesis of the inner core region from Neisseria meningitidis lipopolysaccharide. FEMS Microbiol. Lett. 146247-253. [DOI] [PubMed] [Google Scholar]
  • 33.van Vliet, S. J., J. den Dunnen, S. I. Gringhuis, T. B. Geijtenbeek, and Y. van Kooyk. 2007. Innate signaling and regulation of dendritic cell immunity. Curr. Opin. Immunol. 19435-440. [DOI] [PubMed] [Google Scholar]
  • 34.Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19259-268. [DOI] [PubMed] [Google Scholar]
  • 35.Wakarchuk, W., A. Martin, M. P. Jennings, E. R. Moxon, and J. C. Richards. 1996. Functional relationships of the genetic locus encoding the glycosyltransferase enzymes involved in expression of the lacto-N-neotetraose terminal lipopolysaccharide structure in Neisseria meningitidis. J. Biol. Chem. 27119166-19173. [DOI] [PubMed] [Google Scholar]
  • 36.Westphal, O., and J. K. Jann. 1965. Bacterial lipopolysaccharides, extraction with phenol-water and further applications of the procedure. Methods Carbohydr. Chem. 583-91. [Google Scholar]
  • 37.Ziegler-Heitbrock, H. W. L., E. Thiel, A. Futterer, V. Herzog, A. Wirtz, and G. Riethmüller. 1988. Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int. J. Cancer 41456-461. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES