Abstract
A step toward the molecular classification of prostate cancer was the discovery of recurrent erythroblast transformation-specific rearrangements, most commonly fusing the androgen-regulated TMPRSS2 promoter to ERG. The TMPRSS2-ERG fusion is observed in around 90% of tumors that overexpress the oncogene ERG. The goal of the current study was to complete the characterization of these ERG-overexpressing prostate cancers. Using fluorescence in situ hybridization and reverse transcription-polymerase chain reaction assays, we screened 101 prostate cancers, identifying 34 cases (34%) with the TMPRSS2-ERG fusion. Seven cases demonstrated ERG rearrangement by fluorescence in situ hybridization without the presence of TMPRSS2-ERG fusion messenger RNA transcripts. Screening for known 5′ partners, we determined that three cases harbored the SLC45A3-ERG fusion. To discover novel 5′ partners in these ERG-overexpressing and ERG-rearranged cases, we used paired-end RNA sequencing. We first confirmed the utility of this approach by identifying the TMPRSS2-ERG fusion in a known positive prostate cancer case and then discovered a novel fusion involving the androgen-inducible tumor suppressor, NDRG1 (N-myc downstream regulated gene 1), and ERG in two cases. Unlike TMPRSS2-ERG and SCL45A3-ERG fusions, the NDRG1-ERG fusion is predicted to encode a chimeric protein. Like TMPRSS2, SCL45A3 and NDRG1 are inducible not only by androgen but also by estrogen. This study demonstrates that most ERG-overexpressing prostate cancers harbor hormonally regulated TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG fusions. Broader implications of this study support the use of RNA sequencing to discover novel cancer translocations.
Introduction
Most prostate cancers detected through prostate-specific antigen (PSA) screening harbor an acquired recurrent chromosomal rearrangement [1]. The promoter region of the androgen-regulated transmembrane protease, serine 2 (TMPRSS2) gene, is most often fused to the coding region of members of the erythroblast transformation-specific (ETS) family of transcription factors, most commonly v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG). Other, less common, fusion events occur involving ETS family members (ETV1, ETV4, and ETV5) fused to TMPRSS2 or other 5′ partners that differ in their prostate specificity and response to androgen (SLC45A3, HERV-K, C15orf21, HNRPA2B1, FLJ35294, DDX5, CANT1, and KLK2, reviewed by Kumar-Sinha et al. [2] and more recently, ACSL3 [3]). Moreover, variations in the structure of the gene fusions in prostate cancer yielding different fusion transcript isoforms have been reported [4].
Emerging data suggest that ETS-rearranged prostate cancer, similar to other translocation tumors, represent a distinct molecular subclass of prostate cancer based on studies demonstrating characteristic morphologic features [5], natural history [6,7], and specific genomic [8] and expression profiles [9]. Herein, we report a comprehensive characterization for ERG gene rearrangements in prostate cancer including the identification of a novel hormone-regulated 5′ fusion partner using paired-end RNA sequencing (RNA-seq).
Materials and Methods
Patient Population
The study is composed of 101 men with localized and locally advanced prostate cancer who underwent radical prostatectomy as a monotherapy. All prostate cancer cases were collected as part of institutional review board-approved research protocols.
Sample Processing for RNA Analyses
Hematoxylin and eosin slides were prepared from formalin-fixed paraffin-embedded material and evaluated for cancer extent and tumor grade (Gleason score). Hematoxylin and eosin slides were prepared from the corresponding frozen tissue block and evaluated for the extent of cancer involvement. To ensure for a high concentration of cancer cells and minimized benign tissue, tumor isolation was performed by first selecting for high-density cancer foci (<10% stromal and other nontumor tissue contamination) and then taking 1.5-mm biopsy cores from the frozen tissue block for RNA extraction. Sections for fluorescence in situ hybridization (FISH) evaluation were taken from the frozen tissue block used for molecular analysis. The cancer foci selected for RNA extraction were well characterized by FISH to evaluate the ERG rearrangement status throughout the entire focus. We took special care to extract the RNA from a single cancer focus to exclude the problem of heterogeneity when looking for putative fusion transcripts. RNA was isolated from frozen tissue using TRIzol LS reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. After DNase treatment (Invitrogen), RNA concentration was measured using a NanoDrop 8000 spectrophotometer (Thermo Scientific, Wilmington, DE). Quality was assessed using the Bioanalyzer 2100 (Agilent Technologies, Inc, Santa Clara, CA). The qualitative detection of fusion transcripts in the cases was performed using conventional reverse transcription-polymerase chain reaction (RT-PCR), agarose gel fractionation/purification, and subsequent complementary DNA (cDNA) sequencing. For this, amplified DNA fragments corresponding to the expected sizes of fusion transcripts were gel-extracted using the MinElute Gel Extraction Kit (Qiagen, Valencia, CA) and sequenced at the Life Sciences Core Laboratories Center's DNA sequencing facility of Cornell University (Ithaca, NY). Quantitative ERG and TMPRSS2-ERG RT-PCR was performed using QuantiTect SYBRGreen PCR Kit (Qiagen). Each sample was run in duplicate. The amount of each target gene relative to a control gene was determined using the comparative Ct method (ABI Bulletin 2; Applied Biosystems, Foster City, CA). Ct values for ERG were first normalized using the average Ct values obtained for SART3 and TCFL1/VPS72 and then calibrated using normalized Ct values obtained from benign prostate. Protocols and primers are shown in Table W2.
Assessment of ERG, TMPRSS2, SLC45A3, and NDRG1 Rearrangements Using Two-color FISH Assays
To assess for rearrangement of ERG, TMPRSS2, SLC45A3, and NDRG1, we used break-apart (b/a) FISH assays for each gene and fusion assays for SLC45A3-ERG or NDRG1-ERG on sections from the corresponding frozen tissue blocks. The centromeric probes for ERG, TMPRSS2, SLC45A3, and NDRG1 were RP11-24A11, RP11-354C5, RP11-249H15, and RP11-185E14, respectively. The telomeric probes for ERG, TMPRSS2, SLC45A3, and NDRG1 were RP11-372O17, RP11-891L10, RP11-131E5, and RP11-1145H17, respectively. We used probes RP11-131E5 (SLC45A3), RP11-1145H17 (NDRG1), and RP11-24A11 (ERG) for the SLC45A3-ERG and NDRG1-ERG fusion assays. Correct chromosomal probe localization was confirmed on normal lymphocyte metaphase preparations (see Figure W4 for metaphase results for bacterial artificial chromosomes (BACs) targeting NDRG1 locus). For each sample, a minimum of 100 nuclei were analyzed.
RNA-seq and Data Analysis
We used the Illumina Genome Analyzer II for paired-end RNA-sequencing. This provided a pair of approximately 30 to 36 base reads, from each end of a transcript fragment of relatively well-defined length (approximately 330 nucleotides). The paired reads were aligned independently to the human genome (hg18 assembly in the UCSC genome browser1: Homo_Sapiens March 2006) using “eland,” a short-read alignment tool included in the Genome Analyzer software suite. For each read, eland provides the coordinate(s) of the alignment to the reference genome, allowing for up to two mismatches in the sequence. We kept only the reads that are mapped uniquely to the genome, although they might have up to two mismatches. To search for novel translocations involving ERG, two strategies were applied. First, we selected for mapped paired reads that are more than 2 Mb apart. This allows us to identify translocations similar to TMPRSS2-ERG messenger RNA (mRNA). Indeed, the two genes are approximately 3 Mb apart. Second, paired reads mapping to different chromosomes were also selected as potential candidates. Because we focused on novel ERG partners, we selected for paired reads where one of the reads lies within ERG. This allowed us to identify several candidate fusion transcripts spanning all chromosomes.We finally selected the chromosome with the highest number of reads and checked if those reads lie within a gene. This approach yielded numerous leads, which, because of the low number of copies (from one to three reads), were considered background. We also identified numerous examples of putative fusions that ambiguously mapped to multiple sites along the reference genome probably because of the small size of the paired reads (between 30 and 36 bp). Sequences for NDRG1-ERG v1 and v2 have been submitted to GenBank (Accession Nos. FJ627786 and FJ627787, respectively).
Hormone Treatment of LNCaP Cells
The prostate cancer cell line LNCaP was obtained from ATCC (Manassas, VA; catalog No. CRL-1740) and maintained according to the supplier's instructions. For hormonal treatment, cells were plated (500,000 cells/10 cm2) in the presence of complete growth medium supplemented with 1% penicillin/streptomycin. Cells were starved for 48 hours in charcoal-stripped medium (RPMI-1640 1x, 5% charcoal-stripped FBS, 1% penicillin/streptomycin) and then treated with R1881 (1 nM), 17β-estradiol (10 nM), diarylpropionitrile (DPN, 10 nM) or ethanol vehicle for 3, 12, and 24 hours. RNA was extracted using the TRIzol reagent (Invitrogen), subjected to DNase treatment (DNA-free Kit; Applied Biosystems) according to the manufacturer's instructions. To test for the specificity of androgen stimulation, cells were treated with 10 µM flutamide for 2 hours and then treated with R1881 as described previously. TaqMan assays (Table W3) were used to quantify relative levels of SLC45A3, NDRG1, PSA (KLK3), and IGF1R.
Results
TMPRSS2-ERG and SLC45A3-ERG Account for 84% of ERG Overexpression in Prostate Cancer
We screened prostate cancer cases from 101 men with localized and locally advanced prostate cancer who underwent radical prostatectomy for ERG gene rearrangement using a FISH b/a assay. In total, 44 cases were positive for ERG rearrangement. Given the heterogeneity of TMPRSS2-ERG mRNA expression level [4] in prostate cancer, we screened for TMPRSS2-ERG mRNA variant expression using conventional RT-PCR and cDNA sequencing. Of the 44, 34 (77%) expressed seven different variants of TMPRSS2-ERG mRNA described by Wang et al. [4]. To determine the level of ERG mRNA overexpression, we performed quantitative PCR using cDNA from 29 cases (19 that were TMPRSS2-ERG mRNA-positive and 10 TMPRSS2-ERG mRNA-negative), 15 cases that did not show ERG rearrangement and 6 benign prostate tissue samples (Figure 1A). ERG mRNA was overexpressed up to 75 times (median, 27) in ERG-rearranged cases compared with baseline levels in benign prostate tissue and cases negative for both ERG rearrangement and TMPRSS2-ERG mRNA. Contrary to findings by Wang et al., TMPRSS2-ERG mRNA isoform expression was not associated with ERG overexpression or with prostate cancer progression (Gleason score, pathologic stage, or surgical margin status; Table W1).
Figure 1.
ERG mRNA expression in prostate cancer and benign tissue. (A) Quantitative RT-PCR of ERG expression in 29 ERG rearranged (including 19 TMPRSS2-ERG mRNA-positive (orange) and unknown mechanism-ERG (?-ERG, green)), 15 ERG nonrearranged (blue), and 6 benign prostate tissue samples (gray). (B) Exon composition and sequence covering the fusion junction of SLC45A3-ERG transcript. (C) FISH images of nuclei with SLC45A3 rearrangement (upper) and SLC45A3-ERG fusion (lower) nucleus with yellow fusion signal.
TMPRSS2-ERG mRNA was absent in 10 (23% of 44) ERG-rearranged cases, of which 7 expressed high ERG mRNA levels (5–38 times). To confirm the absence of TMPRSS2 rearrangement in these cases, we performed FISH using a TMPRSS2 b/a assay. We observed TMPRSS2 rearrangement in 2 of 10 cases (60T and 51T) suggesting a novel TMPRSS2-ERG fusion that was not detected using standard RT-PCR approaches. Targeting the exon boundary of exons 1 and 2 in TMPRSS2, we detected a TMPRSS2-ERG fusion transcript in sample 60T that lacks the 5′ end of TMPRSS2 exon 1. This isoform (isoform VII) has been previously reported [4]. To screen for other possible fusion events with ERG, we performed RT-PCR analysis targeting known ETS family fusion partners (SLC45A3, HERV-K, C15ORF21, HNRPA2B1, DDX5, CANT1, KLK2, and ACSL3). This screening revealed that exon 4 of ERG was fused to exon 1 of SLC45A3 in three ERG mRNA-overexpressed cases (34T, 150B_M, and 145C_M; Figure 1B). This is consistent with the recent report from Han et al. [10]. The predicted open reading frame is identical to what is encoded by themost commonTMPRSS2 (exon 1)-ERG (exon 4) mRNA transcript.We confirmed this fusion in situ using an SLC45A3 b/a assay and SLC45A3-ERG fusion assay (Figure 1C).
Massively Parallel RNA-seq Discovers NDRG1-ERG Fusion Prostate Cancer
Having characterized all but two ERG-overexpressing/ERG-rearranged cases (509B and 99T), we used paired-end RNA-seq to identify potential 5′ partners (Table W4). Initially, we explored for fusion transcripts by looking for paired reads where each pair mapped to regions that were either greater than 2 Mb and less than 5 Mb, greater than 5 Mb and less than 10 Mb, or greater than 10 Mb apart from each other on chromosome 21. We also explored for fusion transcripts between ERG and reads that mapped to different chromosomes. Spurious fusion candidates occur for a few reasons. The main reason is the misalignment of the short-read sequences against the reference genome. Another source of potential error is the creation of random chimeric fragments during sample preparation. Therefore, to reduce these false fusion reads, we required that the fusion candidate have several supporting paired reads. First, in prostate cancer cases known to harbor the TMPRSS2-ERG fusion (e.g., case 1701A), we detected numerous TMPRSS2-ERG transcripts as the only fusion transcript arising within chromosome 21 as demonstrated in Figure 2. Second, SLC45A3-ELK4 transcripts were also detected in case 1701A as we have previously observed [11]. There were a few potential ERG fusion transcripts with paired reads to different chromosomes with less than four supporting reads suggesting that they are artificial. Finally, in one case (99T) with ERG overexpression but no SLC45A3 or TMPRSS2 rearrangement as determined by RT-PCR and FISH, RNA-seq demonstrated 17 copies of a fusion transcript that mapped paired reads to ERG and to exons of NDRG1 (Figure 3A). This was confirmed by conventional RT-PCR (Figure 3B). Screening other TMPRSS2-ERG, SLC45A3-ERG mRNA-negative cases revealed another, slightly different, NDRG1-ERG transcript variant (variant 2) in 509B. We confirmed this translocation at the genome level using NDRG1 b/a and NDRG1-ERG fusion FISH assays (Figure 3, C and D).
Figure 2.
Identification of TMPRSS2-ERG fusion transcript using RNA-seq. (A) For wild-type alleles, the two paired-end reads will map to the exons of each gene, whereas in the presence of the fusion, one read will map to exons of TMPRSS2 and the other read will map to exons of ERG, at a much bigger distance on the genome. (B) Read pairs (<2 Mb apart) are shown as connected segments (top). TMPRSS2 and ERG RefSeq gene annotations/locations are given (bottom). Reads of a TMPRSS2-ERG fusion-negative sample (blue) are trimmed at the top for demonstration purposes.
Figure 3.
Identification of NDRG1-ERG fusion by RNA-seq. (A) The schematic shows the linear structure of NDRG1 and ERG. The gene representation shows the “union” transcripts, that is, the exons of all isoforms are reported, and in the case of overlapping exons, the longest one is shown. Each arc represents one instance of paired reads where one read is mapped to NDRG1 and the other to ERG. The regions of the genes involved in the fusion transcript are highlighted and numbered. (B) Reverse transcription-PCR products obtained using a forward primer targeting exon 1 of NDRG1 and a reverse primer targeting exon 6 of ERG (positive control: β-actin). Arrows indicate the DNA fragments that were isolated and sequenced. Bottom panel shows sequence data from this analysis showing the NDRG1-ERG transcript exon composition and sequence covering the fusion junction for the two variant mRNA (shown schematically) identified in samples 99_T (top) and 509_B (bottom). (C) Schematic of the FISH NDRG1 b/a and NDRG1-ERG fusion assays. (D) NDRG1 rearrangement (upper) indicated by separated red and green signals and NDRG1-ERG fusion (lower) indicated by an overlap of the red ERG and the green NDRG1 signal in a representative nucleus from case 99_T.
TMPRSS2-, SLC45A3-, and NDRG1-ERG Are Regulated by Androgen and Estrogen
ERG mRNA expression in cases positive for SLC45A3-ERG or NDRG1-ERG is similar in magnitude to those measured for TMPRSS2-ERG-positive cases. TMPRSS2 [12], SLC45A3 [13], and NDRG1 [14–16] are all known androgen-induced genes. This was confirmed by treating LNCaP with a synthetic androgen (R1881, 1 nM; Figure 4, A and B). Androgen regulation of NDRG1 is supported by the observation of an AR binding site ∼30 kb upstream of the start site (chr8:134407748-134408779) in LNCaP cells (Figure W3). The induction of gene expression was abrogated in the presence of flutamide. If we consider KLK3 (PSA) mRNA a surrogate read-out of androgen signaling, we might expect to find similar profiles between PSA and ERG mRNA levels in TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG mRNA-positive prostate cancer cases. PSA mRNA levels, however, did not mimic the pattern of ERG mRNA levels in TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG mRNA-positive cases, suggesting an additional mechanism for the regulation of the fusion transcripts (Figure W2).
Figure 4.
Hormone treatment of LNCaP cells induces SLC45A3 and NDRG1 mRNA expression. SLC45A3 (A and C) or NDRG1 (B and D) mRNA expression is induced upon stimulation with synthetic androgen (R1881) and 17β-estradiol (E2). Serum-starved LNCaP cells have been stimulated with 1 nM R1881, 1 nM R1881 in combination with 10 µM flutamide (A and B), 10 nM E2, or 10 nM DPN (C and D) for 3, 12, and 24 hours. Samples were run in triplicate and normalized against TCFL1. Columns indicate the mean fold change of induction of three biologic replicates against vehicle (ethanol)-only treated cells for the respective time points ± SEM.
We have previously shown that TMPRSS2-ERG is regulated by estrogen [9]. SLC45A3 may also be similarly regulated by estrogen because the chromosome immunoprecipitation data generated by Brown et al. indicate the presence of an estrogen receptor (ER) binding site within the SLC45A3 gene (referenced in [11]). In addition, their data also show that there is an ER binding site in the first intron of NDRG1 (chr8:134373799-134375086) and another ER binding site (chr8:134441414-134442401) ∼60 kb upstream of the start site (Figure W3). Interestingly, similar data show that FoxA1, a known ER cofactor, binding sites overlap with the ER binding sites. To test if estrogen regulates gene expression, wemeasured the levels of SLC45A3 or NDRG1 mRNA in LNCaP cells at different time points as a function of estrogen treatment. We observed induction of SLC45A3 mRNA 3 hours (Figure 4C) and that of NDRG1 mRNA 12 hours (Figure 4D) after 17β-estradiol treatment but not with the ERβ receptor agonist DPN similar to IGF1R mRNA, a known estrogen-induced gene in LNCaP cells [17] (Figure W1). These data suggest that, like TMPRSS2-ERG, SLC45A3-ERG and NDRG1-ERG fusion genes might also be estrogen-regulated through ERα. This would provide another mechanism for ERG overexpression when fused to SLC45A3 or NDRG1, particularly in the case of castration-resistant prostate cancer.
Discussion
The results presented here provide further evidence of the expanding variety and importance of gene fusion events in prostate cancer. Using approaches that require a priori selection of candidate genes (RT-PCR and FISH) and an approach that does not require a priori gene selection (RNA-seq), we found that there are three main gene fusions that account for ERG-overexpressing prostate cancer. Common to all three gene fusions is a hormonally regulated promoter. The novel NDRG1-ERG fusion is unique in that computational sequence analysis of NDRG1-ERG variant 1 cDNA suggests that this fusion, as with BCR-ABL1 fusion gene in patients with chronic myeloid leukemia, could encode a chimeric protein containing 33 amino acids from NDRG1 as well as the conserved protein domains of wild-type ERG (Sterile alpha motif/Pointed domain and ETS domain). NDRG1-ERG variant 2 mRNA is also predicted to encode a chimeric protein including the first 21 amino acids of NDRG1 and the same conserved domains of ERG as in the putative protein encoded by NDRG1-ERG variant 1. A cell line model could be used to elucidate the functional role of the NDRG1-ERG fusion. We screened but did not find NDRG1-ERG mRNA in six widely used, commercially available prostate cancer cell lines (LNCaP, VCaP, 22Rv1, PC-3, NCI-H660, and DU145). We succeeded in transiently transfecting a NDRG1-ERG variant 1 construct into HEK-293 and BPH cells and monitored the ERG expression levels by means of quantitative RT-PCR (qRT-PCR) and fluorescent immunostaining (Figure W5). Using a commercially available antibody directed against ERG, we were able to show increased ERG expression in the transfected cells suggesting that the NDRG1-ERG fusion gives rise to a protein that shares downstream sequences with wild-type ERG (data not shown). An antibody specifically targeting the fusion protein would have to be developed. Our study differs from two recent RNA-seq studies that used either long reads alone [18] or long and short reads [19] to identify multiple non-ERG chimeric mRNA in a breast cancer line or prostate cell lines and metastatic tumor samples, respectively. Here, we relied on 30 to 36 nucleotides paired-end reads from 330 nucleotides mRNA fragments that have the advantage of directly identifying chimeric transcripts. However, short reads cannot always be mapped uniquely to the genome, making it impossible to unambiguously assign a location. As the technology advances, longer paired-end RNA-seq reads will be available, and the discovery of new and clinically relevant fusion transcripts will become more efficient and affordable. Although this is not the first RNA-seq paper to propose exploring for gene fusions, we were able to exploit paired-end sequencing to discover a novel 5′ fusion partner for ERG. This is significant because, unlike some of the other fusions identified to date, we believe that this is recurrent and may represent up to 5% of all ERG-rearranged prostate cancers. The approach used to make this discovery is being developed so that we can apply this as a pipeline for other platforms and tumor types. In conclusion, the confirmation of the TMPRSS2-ERG and discovery of the NDRG1-ERG fusion using paired-end RNA-seq provide the first proof-of-principle that this methodology can reliably discover novel gene fusions in prostate cancer tissue. Alternatively, we could have used 5′RACE as an established way of discovering gene fusions. However, this method requires the knowledge of one partner. Although the RNA-seq analysis approach that was developed can be directly applied to a number of defined regions, such as ERG, we can extend to a genome-wide search of fusions starting from paired-end reads.
The identification of NDRG1-ERG fusion prostate cancer has potential clinical and biologic implications. NDRG1 is involved in cellular differentiation, repressed by the oncogenes N-myc and c-myc and is thus typically downregulated in cancer cells. Overexpression of NDRG1 has also been associated with reduced metastatic potential [20]. Therefore, hormone-induced overexpression of NDRG1-ERG fusion leads to high levels of the functional domains of ERG but could potentially also lead to an increased risk of metastasis due to the disruption of NDRG1. The occurrence of metastasis would have to be correlated with differential expression of NDRG1 protein in a larger cohort of NDRG1-ERG fusion-positive samples to be statistically reliable. Using only qRT-PCR techniques to indirectly monitor NDRG1 protein levels is not applicable because NDRG1 transcript levels do not necessarily reflect NDRG1 protein levels. There are more immediate clinical implications to our findings. Emerging data suggest that ERG rearrangement-positive prostate cancer characterizes a subclass of prostate cancers that have an aggressive natural history when left untreated. The high levels of the unique chimeric transcripts caused by the ETS rearrangements are only found in the disease state and not in a benign prostate gland. Thus, the detection of fusion transcripts is a logical approach to diagnose prostate cancer harboring the ETS fusions. Several recent studies have demonstrated the ability to detect ETS fusion transcripts as well as PSA, PCA3, GOLPH2, and SPINK1 in urine samples [21–23]. We believe that the addition of TMPRSS2-ERG, SCL45A3-ERG, and NDRG1-ERG as part of a multiplex panel would have high specificity and improved sensitivity over current assays.
Supplemental Material: NDRG1-ERG Nucleic Acid and Amino Acid Sequence
Nucleic Acid Sequence Analysis of NDRG1-ERG Fusion Transcript Variant 1
This sequence has been deposited in GenBank (Accession No. FJ627786).
NDRG1 ex 1–3 - ERG ex 4–12
aacaaacctcgcctggctcccagctggtgctgaagctcgtcagttcaccatccgccctcggcttccgcggggcgctgggccgccagcctcggcaccgtcctttcctttctccctcgcgttaggcagtgacagcagggacatgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggagaccatcaccggcctcctgcaagagtttgatgtccaggaagccttatcagtgtgagtgaggaccagtcgttgtttgagtgtgcctacggaacgccacacctggctaagacagagatgaccgcgtcctcctccagcgactatggacagacttccaagatgagcccacgcgtccctcgcaggattggctgtctcaacccccagccagggtcaccatcaaaatggaatgtaaccctagccaggtgaatggctcaaggaactctcctgatgaatgcagtgtggccaaaggcgggaagatggtggcagcccagacaccgttgggatgaactacggcagctacatggaggagaagcacatgccacccccaaacatgaccacgaacgagcgcagagttatcgtgccagcagatcctacgctatggagtacagccatgtgcggcagtggctggagtgggcggtgaaagaatatggccttccagacgtcaacatcttgttattccagaacatcgatgggaaggaactgtgcaagatgaccaaggacgacttccagaggtcacccccagctacaacgccgacatccttctctcacatctccactacctcagagagactcctcttccacatttgacttcagatgatgttgataaagccttacaaaactctccacggttaatgcatctagaaacacagggggtgcagcttttattttcccaaatacttcagtatatcctgaagctacgcaaagaattacaactaggccagatttaccatatgagccccccaggagatcagcctggaccggtacggccaccccacgccccagtcgaaagctgctcaaccatctccttccacagtgcccaaaactgaagaccagcgtcctcagttagatccttatcagattcttggaccaacaagtagccgccttgcaatccaggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgagtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctaaagttcgacttccacgggatcgcccaggccctccagccccaccccccggagtcatctctgtacaagtacccctcagacctcccgtacatgggctcctatcacgcccacccacagaagatgaacttgtggcgccccaccctccagccctccccgtgacatcttccagtttttttgctgccccaaacccatactggaattcaccaactgggggtatataccccaacactaggctccccaccagccatatgcttctcatctgggcacttactactaaagacctggcggaggcttttcccatcagcgtgcattcaccagcccatcgccacaaactctatcggagaacatgaatcaaaagtgcctcaagaggaatgaaaaagctttactggggctggggaaggaagccggggaagagatccaaagactcttgggagggagttactgaagtcttactacagaaatgaggaggatgctaaaaatgtcacgaatatggacatatcattgtggactgaccttgtaaaagacagtgtatgtagaagcatgaagtcttaaggacaaagtgccaaagaaagtggtcttaagaaatgtataaactttagagtagagtttggaatcccactaatgcaactgggatgaaactaaagcaatagaaacaacacagttttgacctaacataccgtttataatgccattttaaggaaaactacctgtatttaaaaatagaaacatatcaaaaacaagagaaaagacagagagagactgtggcccatcaacagacgttgatatgcaactgcatggcatgtgctgttttggttgaaatcaaatacattccgtttgatggacagctgtcagctttctcaaactgtgaagatgaccaaagtttccaactcctttacagtattaccgggactatgaactaaaaggtgggactgaggatgtgtatagagtgagcgtgtgattgtagacagaggggtgaagaaggaggaggaagaggcagagaagaggagaccaggctgggaaagaaacttctcaagcaatgaagactggactcaggacatttggggactgtgtacaatgagttatggagactcgagggttcatgcagtcagtgttataccaaacccaggttaggagaaaggacacagcgtaatggagaaagggaagtagtagaattcagaaacaaaaatgcgcatctctttctttgtttgtcaaatgaaaattttaactggaattgtctgatatttaagagaacattcaggacctcatcattatgtgggggctttgttctccacagggtcaggtaagagatggccttcttggctgccacaatcagaaatcacgcaggcattttgggtaggcggcctccagttttccttgagtcgcgaacgctgtgcgtttgtcagaatgaagtatacaagtcaatgtttttccccctttttatataataattatataacttatgcatttatacactacgagttgatctcggccagccaaagaacacgacaaaagagacaatcgatataatgtggccttgaattttaactctgtatgcttaatgtttacaatatgaagttattagttcttagaatgcagaatgtatgtaataaaataagcttggcctacatggcaaatcagatttatacaggagtctgcatttgcactttttttagtgactaaagttgcttaatgaaaacatgtgctgaatgttgtggattttgtgttataatttactttgtccaggaacttggcaagggagagccaaggaaataggatgtttggcaccc
Protein Sequence Analysis of NDRG1-ERG Fusion Transcript Variant 1
The longest chimeric sequence is analyzed by InterProScan to search for protein domains.
Variant 1: NDRG1 ex 1–3 - ERG ex 4–12
MSREMQDVDLAEVKPLVEKGETITGLLQEFDVQEALSVVSEDQSLFECAYGTPHLAKTEMTASSSSDYGQTSKMSPRVPQQDWLSQPPARVTIKMECNPSQVNGSRNSPDECSVAKGGKMVGSPTVGMNYGSYMEEKHMPPPNMTTNERRVIVPADPTLWSTDHVRQWLEWAVKEYGLPDVNILLFQNIDGKELCKMTKDDFQRLTPSYNADILLSHLHYLRETPLPHLTSDDVDKALQNSPRLMHARTGGAAFIFPNTSVYPEATQRITTRPDLPYEPPRRSAWTGHGHPTPQSKAAQPSPSTVPKTEDQRPQLDPYQILGPTSSRLANPGSGQIQLWQFLLELLSDSSNSSCITWEGTNGEFKMTDPDEVRRWGERKSKPNMNYDKLSRALRYYYDKNIMTKVHGKRYAYKFDFHGIAQALQPHPPESSLYKYPSDLPYMGSYHAHPQKMNFVAPHPPALPVTSSSFFAAPNPYWNSPTGGIYPNTRLPTSHMSHLGTYY
Nucleic Acid Sequence Analysis of NDRG1-ERG Fusion Transcript Variant 2
This sequence has been deposited in GenBank (Accession No. FJ627787).
Variant 2: NDRG1 ex 1–2 - ERG ex 4–12
aacaaacctcgcctggctcccagctggtgctgaagctcgtcagttcaccatccgccctcggcttccgcggggcgctgggccgccagcctcggcaccgtcctttcctttctccctcgcgttaggcagtgacagcagggacatgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggaggaagccttatcagttgtgagtgaggaccagtcgttgtttgagtgtgcctcggaacgccacacctggctaagacagagatgaccgcgtcctcctccagcgactatggacagacttccaagatgagcccacgcgtccctcagcaggattggctgtctcaacccccagccagggtcacatcaaaatggaatgtaaccctagccaggtgaatggctcaaggaactctcctgatgaatgcagtgtggccaaaggcgggaagatggtgggcagcccagacaccgttgggatgaactacggcagctcatggaggagaagcacatgccacccccaaacatgaccacgaacgagcgcagagttatcgtgccagcagatcctacgctatggagtacagaccatgtgcggcagtggctggagtgggcggtgaaaaatatggccttccagacgtcaacatcttgttattccagaacatcgatgggaaggaactgtgcaagatgaccaaggacgacttccagaggctcacccccagctacaacgccgacatccttctctcaatctccactacctcagagagactcctcttccacatttgacttcagatgatgttgataaagccttacaaaactctccacggttaatgcatgctagaaacacagggggtgcagcttttattttcccaatacttcagtatatcctgaagctacgcaaagaattacaactaggccagatttaccatatgagccccccaggagatcagcctggaccggtcacggccaccccacgccccagtcgaaagctgctcaacatctccttccacagtgcccaaaactgaagaccagcgtcctcagttagatccttatcagattcttggaccaacaagtagccgccttgcaaatccaggcagtggccagatccagctttggcagttctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgattccacgggatcgcccaggccctccagccccaccccccggagtcatctctgtacaagtacccctcagacctcccgtacatgggctcctatcacgcccacccacagaagatgaactttgtggcgcccaccctccagccctccccgtgacatcttccagtttttttgctgccccaaacccatactggaattcaccaactgggggtatataccccaacactaggctccccaccagccatatgccttctcatcgggcacttactactaaagacctggcggaggcttttcccatcagcgtgcattcaccagcccatcgccacaaactctatcggagaacatgaatcaaaagtgcctcaagaggaatgaaaaaagctttactggggctggggaaggaagccggggaagagatccaaaactcttgggagggagttactgaagtcttactacagaaatgaggaggatgctaaaaatgtcacgaatatggacatatcatctgtggactgaccttgtaaaagacagtgtatgtagaagcatgaagtttaaggacaaagtgccaaagaaagtggtcttaagaaatgtataaactttagagtagagtttggaatcccactaatgcaaactgggatgaaactaaagcaatagaaacaacacagttttgacctaaataccgtttataatgccattttaaggaaaactacctgtatttaaaaatagaaacatatcaaaaacaagagaaaagacacgagagagactgtggcccatcaacagacgttgatatgcaactgcatgcatgtgctgttttggttgaaatcaaatacattccgtttgatggacagctgtcagctttctcaaactgtgaagatgacccaaagtttccaactcctttacagtattaccgggactatgaactaaaggtgggactgaggatgtgtatagagtgagcgtgtgattgtagacagaggggtgaagaaggaggaggaagaggcagagaaggaggagaccaggctgggaaagaaacttctcaagcaatgaagactgactcaggacatttggggactgtgtacaatgagttatggagactcgagggttcatgcagtcagtgttataccaaacccagtgttaggagaaaggacacagcgtaatggagaaagggaagtagtagattcagaaacaaaaatgcgcatctctttctttgtttgtcaaatgaaaattttaactggaattgtctgatatttaagagaaacattcaggacctcatcattatgtgggggctttgttctccacagggcaggtaagagatggccttcttggctgccacaatcagaaatcacgcaggcattttgggtaggcggcctccagttttcctttgagtcgcgaacgctgtgcgtttgtcagaatgaagtatacaagtcatgtttttccccctttttatataataattatataacttatgcatttatacactacgagttgatctcggccagccaaagacacacgacaaaagagacaatcgatataatgtggccttgaattttaacctgtatgcttaatgtttacaatatgaagttattagttcttagaatgcagaatgtatgtaataaaataagcttggcctagcatggcaaatcagatttatacaggagtctgcatttgcactttttttgtgactaaagttgcttaatgaaaacatgtgctgaatgttgtggattttgtgttataatttactttgtccaggaacttgtgcaagggagagccaaggaaataggatgtttggcaccc
Protein Sequence Analysis of NDRG1-ERG Fusion Transcript Variant 2
The longest chimeric sequence is analyzed by InterProScan to search for protein domains.
Variant 2: NDRG1 ex 1–2 - ERG ex 4–12
MSREMQDVDLAEVKPLVEKGEEALSVVSEDQSLFECAYGTPHLAKTEMTASSSSDYGQTSKMSPRVPQQDWLSQPPARVTIKMECNPSQVNGSRNSPDECSVAKGGKMVGSPDTVGMNYGSYMEKHMPPPNMTTNERRVIVPADPTLWSTDHVRQWLEWAVKEYGLPDVNILLFQNIDGKELCKMTKDDFQRLTPSYNADILLSHLHYLRETPLPHLTSDDVDKALQNSPRLMHARNTGGAAFIFPNTVYPEATQRITTRPDLPYEPPRRSAWTGHGHPTPQSKAAQPSPSTVPKTEDQRPQLDPYQILGPTSSRLANPGSGQIQLWQFLLELLSDSSNSSCITWEGTNGEFKMTDPDEVARRWGERKSKPNMNYDKLSRALRYYYDKNIMTKVHGKRYAYKFDFHGAQALQPHPPESSLYKYPSDLPYMGSYHAHPQKMNFVAPHPPALPVTSSSFFAAPNPYWNSPTGGIYPNTRLPTSHMPSHLGTYY
Acknowledgments
The authors thank Scott Tomlins and Arul M. Chinnaiyan for BAC probes to SLC45A3.
Abbreviations
- RT-PCR
reverse transcription-polymerase chain reaction
- FISH
fluorescence in situ hybridization
- RNA-seq
RNA sequencing
- (b/a)
break-apart
Footnotes
This work was supported by National Institutes of Health (NIH)/National Cancer Institute grant R01 CA125612 (M.A.R. and F.D.), Heinrich Warner Foundation (D.P.), Department of Defense grant PC61474 (S.P.), and NIH/National Human Genome Research Institute (NHGRI) grant R44HG004237 (M.S.C.). The authors thank the support of the “Yale University Biomedical High Performance Computing Center” and NIH grant no. RR19895 that funded the computer cluster instrumentation.
This article refers to supplementary materials, which are designated by Tables W1 to W4 and Figures W1 to W5 and are available online at www.neoplasia.com.
Conflicts of Interest
S. Perner, F. Demichelis, and M. A. Rubin are coinventors on a patent filed by The University of Michigan and The Brigham and Women's Hospital covering the diagnostic and therapeutic fields for ETS fusions in prostate cancer. The diagnostic field has been licensed to Gen-Probe, Inc. Gen-Probe has not played a role in the design and conduct of the study, in the collection, analysis or interpretation of the data, or in the preparation, review, or approval of the article. The authors mentioned disclose any financial interest.
References
- 1.Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005;310:644–648. doi: 10.1126/science.1117679. [DOI] [PubMed] [Google Scholar]
- 2.Kumar-Sinha C, Tomlins SA, Chinnaiyan AM. Recurrent gene fusions in prostate cancer. Nat Rev Cancer. 2008;8:497–511. doi: 10.1038/nrc2402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Attard G, Clark J, Ambroisine L, Mills IG, Fisher G, Flohr P, Reid A, Edwards S, Kovacs G, Berney D, et al. Heterogeneity and clinical significance of ETV1 translocations in human prostate cancer. Br J Cancer. 2008;99:314–320. doi: 10.1038/sj.bjc.6604472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wang J, Cai Y, Ren C, Ittmann M. Expression of variant TMPRSS2/ERG fusion messenger RNAs is associated with aggressive prostate cancer. Cancer Res. 2006;66:8347–8351. doi: 10.1158/0008-5472.CAN-06-1966. [DOI] [PubMed] [Google Scholar]
- 5.Mosquera JM, Perner S, Demichelis F, Kim R, Hofer MD, Mertz KD, Paris PL, Simko J, Collins C, Bismar TA, et al. Morphological features of TMPRSS2-ERG gene fusion prostate cancer. J Pathol. 2007;212:91–101. doi: 10.1002/path.2154. [DOI] [PubMed] [Google Scholar]
- 6.Attard G, Clark J, Ambroisine L, Fisher G, Kovacs G, Flohr P, Berney D, Foster CS, Fletcher A, Gerald WL, et al. Duplication of the fusion of TMPRSS2 to ERG sequences identifies fatal human prostate cancer. Oncogene. 2008;27:253–263. doi: 10.1038/sj.onc.1210640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Demichelis F, Fall K, Perner S, Andren O, Schmidt F, Setlur SR, Hoshida Y, Mosquera JM, Pawitan Y, Lee C, et al. TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene. 2007;26:4596–4599. doi: 10.1038/sj.onc.1210237. [DOI] [PubMed] [Google Scholar]
- 8.Demichelis F, Setlur SR, Beroukhim R, Perner S, Korbel JO, Lafargue CJ, Pflueger D, Pina C, Hofer MD, Sboner A, et al. Distinct genomic aberrations associated with ERG rearranged prostate cancer. Genes Chromosomes Cancer. 2009;48:366–380. doi: 10.1002/gcc.20647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Setlur SR, Mertz KD, Hoshida Y, Demichelis F, Lupien M, Perner S, Sboner A, Pawitan Y, Andren O, Johnson LA, et al. Estrogen-dependent signaling in a molecularly distinct subclass of aggressive prostate cancer. J Natl Cancer Inst. 2008;100:815–825. doi: 10.1093/jnci/djn150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Han B, Mehra R, Dhanasekaran SM, Yu J, Menon A, Lonigro RJ, Wang X, Gong Y, Wang L, Shankar S, et al. A fluorescence in situ hybridization screen for E26 transformation-specific aberrations: identification of DDX5-ETV4 fusion protein in prostate cancer. Cancer Res. 2008;68:7629–7637. doi: 10.1158/0008-5472.CAN-08-2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Rickman DS, Pflueger D, Moss B, VanDoren VE, Chen CX, de la Taille A, Kuefer R, Tewari AK, Setlur SR, Demichelis F, et al. SLC45A3-ELK4 is a novel and frequent erythroblast transformation-specific fusion transcript in prostate cancer. Cancer Res. 2009;69:2734–2738. doi: 10.1158/0008-5472.CAN-08-4926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Lin B, Ferguson C, White JT, Wang S, Vessella R, True LD, Hood L, Nelson PS. Prostate-localized and androgen-regulated expression of the membrane-bound serine protease TMPRSS2. Cancer Res. 1999;59:4180–4184. [PubMed] [Google Scholar]
- 13.Xu J, Kalos M, Stolk JA, Zasloff EJ, Zhang X, Houghton RL, Filho AM, Nolasco M, Badaro R, Reed SG. Identification and characterization of prostein, a novel prostate-specific protein. Cancer Res. 2001;61:1563–1568. [PubMed] [Google Scholar]
- 14.Lachat P, Shaw P, Gebhard S, van Belzen N, Chaubert P, Bosman FT. Expression of NDRG1, a differentiation-related gene, in human tissues. Histochem Cell Biol. 2002;118:399–408. doi: 10.1007/s00418-002-0460-9. [DOI] [PubMed] [Google Scholar]
- 15.Segawa T, Nau ME, Xu LL, Chilukuri RN, Makarem M, Zhang W, Petrovics G, Sesterhenn IA, McLeod DG, Moul JW, et al. Androgen-induced expression of endoplasmic reticulum (ER) stress response genes in prostate cancer cells. Oncogene. 2002;21:8749–8758. doi: 10.1038/sj.onc.1205992. [DOI] [PubMed] [Google Scholar]
- 16.Tu LC, Yan X, Hood L, Lin B. Proteomics analysis of the interactome of N-myc downstream regulated gene 1 and its interactions with the androgen response program in prostate cancer cells. Mol Cell Proteomics. 2007;6:575–588. doi: 10.1074/mcp.M600249-MCP200. [DOI] [PubMed] [Google Scholar]
- 17.Pandini G, Genua M, Frasca F, Squatrito S, Vigneri R, Belfiore A. 17beta-Estradiol up-regulates the insulin-like growth factor receptor through a nongenotropic pathway in prostate cancer cells. Cancer Res. 2007;67:8932–8941. doi: 10.1158/0008-5472.CAN-06-4814. [DOI] [PubMed] [Google Scholar]
- 18.Zhao Q, Caballero OL, Levy S, Stevenson BJ, Iseli C, de Souza SJ, Galante PA, Busam D, Leversha MA, Chadalavada K, et al. Transcriptome-guided characterization of genomic rearrangements in a breast cancer cell line. Proc Natl Acad Sci USA. 2009;106:1886–1891. doi: 10.1073/pnas.0812945106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, Sam L, Barrette T, Palanisamy N, Chinnaiyan AM. Transcriptome sequencing to detect gene fusions in cancer. Nature. 2009;458:97–101. doi: 10.1038/nature07638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Mostaghel EA, Page ST, Lin DW, Fazli L, Coleman IM, True LD, Knudsen B, Hess DL, Nelson CC, Matsumoto AM, et al. Intraprostatic androgens and androgen-regulated gene expression persist after testosterone suppression: therapeutic implications for castration-resistant prostate cancer. Cancer Res. 2007;67:5033–5041. doi: 10.1158/0008-5472.CAN-06-3332. [DOI] [PubMed] [Google Scholar]
- 21.Hessels D, Smit FP, Verhaegh GW, Witjes JA, Cornel EB, Schalken JA. Detection of TMPRSS2-ERG fusion transcripts and prostate cancer antigen 3 in urinary sediments may improve diagnosis of prostate cancer. Clin Cancer Res. 2007;13:5103–5108. doi: 10.1158/1078-0432.CCR-07-0700. [DOI] [PubMed] [Google Scholar]
- 22.Laxman B, Morris DS, Yu J, Siddiqui J, Cao J, Mehra R, Lonigro RJ, Tsodikov A, Wei JT, Tomlins SA, et al. A first-generation multiplex biomarker analysis of urine for the early detection of prostate cancer. Cancer Res. 2008;68:645–649. doi: 10.1158/0008-5472.CAN-07-3224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Laxman B, Tomlins SA, Mehra R, Morris DS, Wang L, Helgeson BE, Shah RB, Rubin MA, Wei JT, Chinnaiyan AM. Noninvasive detection of TMPRSS2:ERG fusion transcripts in the urine of men with prostate cancer. Neoplasia. 2006;8:885–888. doi: 10.1593/neo.06625. [DOI] [PMC free article] [PubMed] [Google Scholar]
Supplemental References
- 1.Carroll JS, Meyer CA, Song J, Li W, Geistlinger TR, Eeckhoute J, Brodsky AS, Keeton EK, Fertuck KC, Hall GF, et al. Genome-wide analysis of estrogen receptor binding sites. Nat Genet. 2006;38:1289–1297. doi: 10.1038/ng1901. [DOI] [PubMed] [Google Scholar]
- 2.Lupien M, Eeckhoute J, Meyer CA, Wang Q, Zhang Y, Li W, Carroll JS, Liu XS, Brown M. FoxA1 translates epigenetic signatures into enhancer-driven lineage-specific transcription. Cell. 2008;132:958–970. doi: 10.1016/j.cell.2008.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




