Skip to main content
NCBI home page
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2009 May 29;191(15):4879–4887. doi: 10.1128/JB.00296-09

Identification of a Terminal Rhamnopyranosyltransferase (RptA) Involved in Corynebacterium glutamicum Cell Wall Biosynthesis▿

Helen L Birch 1,‡, Luke J Alderwick 1,‡, Doris Rittmann 2, Karin Krumbach 2, Helga Etterich 2, Anna Grzegorzewicz 3, Michael R McNeil 3, Lothar Eggeling 2, Gurdyal S Besra 1,*
PMCID: PMC2715713  PMID: 19482925

Abstract

A bioinformatics approach identified a putative integral membrane protein, NCgl0543, in Corynebacterium glutamicum, with 13 predicted transmembrane domains and a glycosyltransferase motif (RXXDE), features that are common to the glycosyltransferase C superfamily of glycosyltransferases. The deletion of C. glutamicum NCgl0543 resulted in a viable mutant. Further glycosyl linkage analyses of the mycolyl-arabinogalactan-peptidoglycan complex revealed a reduction of terminal rhamnopyranosyl-linked residues and, as a result, a corresponding loss of branched 2,5-linked arabinofuranosyl residues, which was fully restored upon the complementation of the deletion mutant by NCgl0543. As a result, we have now termed this previously uncharacterized open reading frame, rhamnopyranosyltransferase A (rptA). Furthermore, an analysis of base-stable extractable lipids from C. glutamicum revealed the presence of decaprenyl-monophosphorylrhamnose, a putative substrate for the cognate cell wall transferase.

A common feature of members of the Corynebacterineae is that they possess an unusual cell wall dominated by a heteropolysaccharide termed an arabinogalactan (AG), which is linked to both mycolic acids and peptidoglycan, forming the mycolyl-arabinogalactan-peptidoglycan (mAGP) complex (5, 10, 12, 15, 24, 25, 34). The formation of the arabinan domain in the mAGP complex, consisting mainly of α1→5, α1→3, and β1→2 glycosyl linkages, results from the subsequent addition of arabinofuranose (Araf) from the lipid-linked sugar donor β-d-arabinofuranosyl-1-monophosphoryldecaprenol (DPA) by a set of unique membrane-bound arabinofuranosyltransferases (5, 7, 12, 18, 34).

The deletion of Corynebacterium glutamicum emb (embCg) (4) and a chemical analysis of the cell wall revealed a novel truncated AG structure possessing only terminal Araf residues with a corresponding loss of cell wall-bound mycolic acids (4). The presence of a novel enzyme responsible for “priming” the galactan domain for further elaboration by EmbCg proteins led to the identification of AftA, which belongs to the glycosyltransferase C (GT-C) superfamily (5). Recently, additional GT-C enzymes have been identified, termed AftB, which is responsible for the attachment of terminal β(1→2) Araf residues (34), and AftC, which is involved in AG branching (12) before decoration with mycolic acids, both of which are conserved within the Corynebacterineae (12, 34). It is clear that additional glycosyltransferases involved in both AG and lipoarabinomannan biosynthesis still remain to be identified. Indeed, Liu and Mushegian (22) identified 15 members of the GT-C superfamily residing in the Corynebacterineae, representing candidates involved in the biosynthesis of cell wall-related glycans and lipoglycans (22). We have continued our earlier studies (5, 12, 34) to identify genes required for the biosynthesis of the core structural elements of the mAGP complex by studying mutants of C. glutamicum and the orthologous genes and enzymes of Mycobacterium tuberculosis.

A particularly interesting feature of C. glutamicum is the presence of terminal rhamnopyranose (t-Rhap) residues attached to the C2 position of α(1→5)-linked Araf residues in the arabinan domain of AG (4). The biological function of these residues remains to be clarified; nevertheless, they are a feature of the corynebacterial cell wall, and the biosynthesis of which needs to be addressed. The current paradigm of AG biosynthesis follows a linear pathway which is built upon a decaprenyl pyrophosphate lipid carrier. The unique disaccharide linker and galactan domain is synthesized by a variety of GT-A and GT-B family glycosyltransferases, all of which utilizing a nucleotide diphosphate-activated sugar substrate for transferase activity. It has been hypothesized by us (3, 5) and others (8) that a major shift in the biosynthetic machinery takes place upon the initiation of arabinan polymerization. AftA, Emb, AftC, and AftB all belong to the GT-C family of glycosyltransferases, all of which utilize DPA as the sole lipid-activated phosphosugar donor for arabinose transfer into the cell wall. Since t-Rhap residues are present in the arabinan component of the cell wall, the enzyme(s) responsible for its addition is likely to belong to the GT-C family of glycosyltransferases and, as determined through deduction, is one which utilizes a lipid-phosphate-derived rhamnose substrate similar to DPA. Herein, we present the putative protein NCgl0543 as a distinct t-Rhap of the GT-C superfamily, which is responsible for the transfer of t-Rhap residues to the arabinan domain to form the branched 2,5-linked Araf motifs of C. glutamicum. In addition, we have identified a novel decaprenyl-monophosphorylrhamnose and discuss its role in substrate presentation for AG biosynthesis in C. glutamicum.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

C. glutamicum ATCC 13032 and Escherichia coli DH5αmcr were grown in Luria-Bertani broth (Difco) at 30°C and 37°C, respectively. The recombinant strains generated in this study were grown on rich brain heart infusion (BHI; Difco) or brain heart infusion sorbitol (BHIS) medium, the latter containing 0.5 M sorbitol and the salt medium CGXII as described previously (17). M. tuberculosis H37Rv DNA was obtained from the NIH Tuberculosis Research Materials and Vaccine Testing Contract at Colorado State University. Samples for lipid analyses were prepared by harvesting cells at an optical density of 10 to 15 followed by a saline wash and freeze-drying.

Construction of plasmids and strains.

The vectors made were pVWEx-Cg-rptA, pVWEx-Rv3779, and pK19mobsacBΔrptA. To construct the latter deletion vector, crossover PCR was applied with primer pairs AB (A, CGTTGAATTCGGTTCCAGTAGCACCTGCGAAAGG; B, CCCATCCACTAAACTTAAACACAATCCATAGTGTCGTCAGCATC) and CD (C, TGTTTAAGTTTAGTGGATGGGCCGGATCCAACGAAGCC; D, GCTTTCTAGAATGCGGGCAACCGCGCAGTGTG) (all primers in 5′-3′ direction) and C. glutamicum genomic DNA as a template. Both amplified products were used in a second PCR with primer pair AD to generate a 587-bp fragment consisting of sequences adjacent to NCgl0543, which was treated with EcoRI and XbaI and ligated with pK19mobsacB to yield pK19mobsacBΔrptA. To enable the expression of NCgl0543, the primer pair EF (E, GATGAATCTAGAAAGGGAGATATAGATGCTGACGACACTATG; F, CTACTTTCTAGATTAGTTAGGGACCGTATGCGGC) was used to amplify rptA of C. glutamicum, which was treated with XbaI and ligated to yield pVWEx-Cg-rptA. The primer pair GH (G, GATAATCTAGAAGGGAGATATAGGTGGGCCTGTGGTTCG; H, GCCGTACTTTCTAGACTAGGAGTGTGTTGCTGCG) was used to amplify Rv3779 from M. tuberculosis. The resulting fragment was treated with XbaI to yield pVWEx-Rv3779. The correct orientation and the sequence identities were confirmed for all plasmids by sequencing.

The chromosomal deletion of the NCgl0543 gene was performed as described previously using two rounds of positive selection (31), and its successful deletion was verified by use of primer pair IK (I, GAACCGCAGGTGTATGAAGCACACGTG; K, 5′GGCAGATTACGCTGCAGTTCTTTCTGCG). This yielded the expected fragment of 837 bp in the deletion mutant and was termed C. glutamicum ΔrptA and a fragment of 3,179 bp in wild-type C. glutamicum.

Extraction and analysis of cell wall-bound mycolic acids.

C. glutamicum cultures (5 ml) were grown and metabolically labeled at mid-logarithmic phase of growth using 1 μCi/ml [1,2-14C]acetate (50 to 62 mCi/mmol; GE Healthcare, Amersham Bioscience) for 4 h at 30°C with gentle shaking, harvested, washed, and freeze-dried. Cells were then extracted by two consecutive extractions with 2 ml of CHCl3/CH3OH/H2O (10:10:3, vol/vol/vol) for 4 h at 50°C to provide cell wall-associated lipids and analyzed as described previously (1). The crude lipid extracts were resuspended in CHCl3/CH3OH (2:1) and equivalent aliquots (50,000 cpm) analyzed by thin-layer chromatography (TLC) using silica gel plates (5735 silica gel 60F254; Merck) developed in CHCl3/CH3OH/NH4OH (80:20:2, vol/vol/vol) to separate 14C-labeled trehalose dimycolate and phospholipids (28). Lipids were visualized by autoradiography by the overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal labeled lipids, quantified by phosphorimaging and compared to known standards (28). The bound corynomycolic acid methyl esters (CMAMEs) from the delipidated extracts described above were released by the addition of 2 ml of 5% aqueous solution of tetrabutyl ammonium hydroxide followed by overnight incubation at 100°C. After cooling, water (2 ml), CH2Cl2 (4 ml), and CH3I (500 μl) were added and mixed thoroughly for 30 min. The lower organic phase was recovered following centrifugation and washed three times with water (4 ml), dried, and resuspended in diethyl ether (4 ml). After centrifugation, the clear supernatant was again dried and resuspended in CH2Cl2 (100 μl). An aliquot (5 μl) from each strain was subjected to scintillation counting and an equivalent (5 μl) aliquot analyzed by TLC using silica gel plates (5735 silica gel 60F254; Merck), developed in petroleum ether/acetone (95:5, vol/vol) and either visualized by autoradiography by exposure of Kodak X-Omat AR film to the TLC plates to reveal 14C-labeled CMAMEs or charred following spraying with 5% molybdophosphoric acid in ethanol at 100°C and compared to known standards.

Isolation of the mAGP complex, glycosyl composition, and linkage analysis of alditol acetates by GC and GC/MS.

The thawed cells were resuspended in phosphate-buffered saline containing 2% Triton X-100 (pH 7.2), disrupted by sonication, and centrifuged at 27,000 × g (4, 10). The pelleted material was extracted three times with 2% sodium dodecyl sulfate in phosphate-buffered saline at 95°C for 1 h; washed with water, 80% (vol/vol) acetone in water, and acetone; and finally lyophilized to yield a highly purified cell wall preparation (4, 10). Cell wall or per-O-methylated cell wall preparations (4) were hydrolyzed in 2 M trifluoroacetic acid (TFA) and reduced with NaB2H4, and the resultant alditols were per-O-acetylated and examined by gas chromatography (GC) and GC/mass spectrometry (MS) as described previously (4, 10).

14C-carbohydrate labeling of C. glutamicum glycolipids.

Cells (10 g) from C. glutamicum and C. glutamicum ΔrptA were resuspended in 35 ml of 50 mM MOPS (morpholinepropanesulfonic acid; pH 7.9)-10 mM MgSO4-5 mM β-mercaptoethanol (buffer A) and subjected to probe sonication for 60 s on and 90 s off (repeated for a total of 10 cycles). The cell slurry was centrifuged at 27,000 × g for 20 min at 4°C; the pellet was recovered and the resulting supernatant further centrifuged at 100,000 × g for 90 min at 4°C. Purified C. glutamicum membranes were recovered and resuspended in buffer A to a final concentration of 15 to 20 mg/ml. The pellet from the 27,000 × g spin was resuspended in 24 ml of buffer A and 32 ml of Percoll, mixed thoroughly, and centrifuged at 27,000 × g for 60 min at 4°C. The upper band (corresponding to C. glutamicum cell wall “P60” material) was removed and washed with buffer A with further centrifugation to remove Percoll, and the final cell wall fraction was resuspended in buffer A to a final concentration of 8 to 10 mg/ml.

The initial, standard reaction to measure the incorporation of [14C]GlcNAc from UDP-[14C]GlcNAc, [14C]Rha from dTDP-[14C]Rha, [14C]Gal from UDP-[14C]Gal, and [14C]Ara from p[14C]Rpp was as follows. Decaprenyl phosphate (50 μg; 5 mg/ml stored in ethanol [10 μl]) was dried under nitrogen and was resuspended by the addition of 50 μl of a 1% IgePal CA-630 (Sigma-Aldrich) solution in buffer A and sonicated. The basic assay mix consisted of 2 mg of membranes and 0.5 mg cell wall “P60” from either C. glutamicum or C. glutamicum ΔrptA, 1 mM ATP, and 1 mM NADP in a final volume of 160 μl of buffer A and initiated by the addition of either 100,000 cpm UDP-[14C]GlcNAc (ammonium salt; Amersham, Bucks, United Kingdom; specific activity, 214 mCi/mmol), 200,000 cpm dTDP-[14C]Rha (enzymatically synthesized as described previously [27]; specific activity, 300 μCi/μmol), 50,000 cpm UDP-[14C]Gal (ammonium salt; Amersham, Bucks, United Kingdom; specific activity, 257 mCi/mmol), and 50,000 cpm p[14C]Rpp (enzymatically synthesized as described previously [32]; specific activity, 250 μCi/μmol). Reaction mixtures were incubated at 37°C for 2 h, quenched by the addition of CHCl3/CH3OH (1,066 μl; 1:1, vol/vol), and mixed at room temperature for 30 min. The samples were then centrifuged at 27,000 × g at room temperature for 20 min, the supernatant was removed from the pelleted material, and H2O (230 μl) and CHCl3 (537 μl) were added to the previously extracted supernatant, mixed at room temperature for 30 min, and then centrifuged at 5,000 × g. The lower organic fraction was recovered and washed twice with CHCl3/CH3OH/H2O (613 μl; 3:47:48, vol/vol/vol). After centrifugation at 5,000 × g for 10 min, the lower organic fraction was recovered and dried under compressed nitrogen. The resulting extract was resuspended in CHCl3/CH3OH (100 μl; 2:1, vol/vol). An aliquot (10 μl) from each assay was subjected to scintillation counting and the remainder of the sample analyzed by TLC using silica gel plates (5735 silica gel 60F254; Merck), developed in CHCl3/CH3OH/NH4OH/H2O (65:25:0.5:3.6, vol/vol/vol/vol) and visualized by autoradiography by the exposure of Kodak X-Omat AR film to the TLC plates to reveal the incorporation of [14C]GlcNAc, [14C]Rha, [14C]Gal, or [14C]Ara into the solvent extractable lipids.

Chemical identification of decaprenyl-1-monophosphate-rhamnopyranose.

Membranes from C. glutamicum or C. glutamicum ΔrptA were assayed as described above but with or without the addition of 50 μg/ml tunicamycin. Decaprenyl monophosphate (50 μg; 5 mg/ml stored in CHCl3/CH3OH [2:1, vol/vol]) was dried under nitrogen and resuspended by the addition of 107 μl of a 1% IgePal CA-630 (Sigma Aldrich) solution in buffer A and sonicated. The basic assay mix consisted of 2 mg of membranes, 0.5 mg cell wall “P60,” 1 mM ATP, 1 mM NADP in a final volume of 160 μl and was initiated by the addition of 5 mM of dTDP-Rha or 200,000 cpm of dTDP-[14C]Rha chemically synthesized as previously described (34) and incubated at 37°C for 1 h. Assays performed using dTDP-[14C]Rha were processed as described above, whereas assays performed using unlabeled dTDP-Rha were replenished by the addition of a further 2 mg of membranes and 0.5 mg of cell wall “P60” with further incubation at 37°C for 1 h. This process was repeated for a total of three additions with a final assay volume of 250 μl. The assays were quenched by the addition of CHCl3/CH3OH (3,330 μl; 1:1, vol/vol) and 1.6 M NaOH (250 μl) and mixed at room temperature for 30 min. The samples were then centrifuged at 27,000 × g at room temperature for 30 min, and the supernatant was removed from the pelleted material. H2O (720 μl) and CHCl3 (1,678 μl) were added to the previously extracted supernatant, mixed at room temperature for 30 min, and then centrifuged at 5,000 × g. The lower organic fraction was recovered and washed twice with 1.92 ml of CHCl3/CH3OH/H2O (3:47:48, vol/vol/vol). After centrifugation at 5,000 × g for 10 min, the lower organic fraction was recovered and dried under nitrogen. The resulting extract was resuspended in CHCl3/CH3OH (100 μl; 2:1, vol/vol) and analyzed by electrospray MS (ES-MS) in the negative mode on a Micromass LCT mass spectrometer as described previously (20).

RESULTS

Genome comparison of the NCgl0543 locus.

An examination of the genome sequence of C. glutamicum revealed that there are 14 glycosyltransferases of the GT-C family. To date, we have already identified the functions of AftA (5), AftB (34), AftC (12), MptA (29), and MptB (30), which act as membrane-bound glycosyltransferases using polyprenylated phosphoarabinosyl and -mannosyl sugar donors, respectively, in the synthesis of AG and lipoarabinomannan. The above-mentioned proteins are also present in M. tuberculosis, illustrating that they are required to build the elementary cell wall structure of the Corynebacterineae (16).

An as-yet-uncharacterized GT-C glycosyltransferase of C. glutamicum is encoded by the putative gene NCgl0543. Orthologues of this gene, with identities exceeding 34%, are present in C. glutamicum strain R, Corynebacterium efficiens, Corynebacterium glucuronolyticum (ATCC 51867), and Corynebacterium amycolatum SK46, the latter two saprophytic organisms being human skin pathogens (21, 37). The genomic organization surrounding NCgl0543 is largely syntenic and is preceded by a putative tRNA pseudouridine synthase, and downstream of NCgl0543 is a membrane protein of unknown function (Pfam class DUF690). There are no orthologues of NCgl0543 present in Corynebacterium diphtheriae, Corynebacterium jeikeium, or Corynebacterium urealyticum DSM 7109 (13, 36, 37).

NCgl0543 of C. glutamicum is a large polytopic membrane protein of 799 amino acid residues and is predicted to possess 13 transmembrane-spanning helices (TMH) (Fig. 1A). It is further characterized by a periplasmic carboxy-terminal extension of 237 amino acids (aa) similar to the C-terminal features of AftA (5), AftB (34), and the Emb proteins (4, 9, 35, 38). A particularly highly conserved region is present at the end of the long loop connecting TMH 3 and TMH 4. This region is schematically shown in Fig. 1A, as is part of its sequence (Fig. 1B). This sequence resembles the glycosyltransferase GT-C family DXD motif (22), as it contains a number of basic and acidic residues, with the latter being shown in mutational studies to be essential for glycosyltransferase activity using polyprenylated phosphosugar donors (9, 35).

FIG. 1.

FIG. 1.

Open in a new tab

Hypothetical spatial organization and partial sequence of the putative protein NCgl0543. (A) The hypothetical schematic organization of the putative protein NCgl0543 is shown spanning the membrane 13 times with the carboxy-terminal end consisting of 237 amino acids and located in the periplasm. Also shown is the long loop of 168 amino acids connecting TMH 3 and TMH 4. The black star indicates the putative glycosyltransferase region given in panel B and the white star a conserved region, also present in the putative protein Rv3779, in the periplasmic part of the protein. (B) Part of the loop region. Acidic and basic residues are highlighted. Although, the overall topology of the M. tuberculosis putative protein Rv3779 and its orthologs are somewhat different than that of the corynebacterial proteins, the loop region is strongly conserved in the Corynebacterineae, and this is indicated for selected mycobacterial species underneath the sequence alignment. Shown are aa 127 to 188 of the M. tuberculosis sequence and aa 184 to 235 of the C. glutamicum sequence. On top of the sequence comparison, the predicted secondary structure is given, with L indicating a loop region, H a helical structure, and E an extended sheet structure. The abbreviations are as follows: C. glu., Corynebacterium glutamicum ATCC 13032; C. glR. Corynebacterium glutamicum strain R; C. eff., Corynebacterium efficiens; C. gly., Corynebacterium glucuronolyticum; C. amy., Corynebacterium amycolatum; M. mar., Mycobacterium marinum (ATCC BAA-535); M. tub., Mycobacterium tuberculosis; M. par., Mycobacterium paratuberculosis; M. lep., Mycobacterium leprae.

Construction and growth of mutants.

In an attempt to delete NCgl0543 in C. glutamicum, the nonreplicative vector pK19mobsacBΔNCgl0543 was constructed. This was introduced into C. glutamicum via electroporation and the kanamycin-resistant clones obtained, indicating integration in the chromosome by heterologous recombination (31). Using the sucrose resistance provoked by the sacB gene, a second heterologous recombination event was selected. A total of nine clones were analyzed by PCR, and in two of them, a wild-type reversion at the NCgl0543 locus was restored, whereas a deletion of NCgl0543 was obtained in the seven remaining clones. These numbers indicate that the loss of NCgl0543 is not detrimental to cell growth or viability. As a result, and based on the results described below, one clone was subsequently termed C. glutamicum ΔrptA and confirmed by PCR to have rptACg deleted, whereas controls with the C. glutamicum wild type resulted in the expected larger amplification product (data not shown).

The growth of wild-type C. glutamicum and C. glutamicum ΔrptA in liquid mineral salt medium CGXII and rich BHIS medium was compared (17). Both strains exhibited comparable growth rates of 0.36 ± 0.03 h−1 and 0.60 ± 0.05 h−1 for the respective media. Thus, C. glutamicum ΔrptA does not exhibit an apparent growth defect, indicating some degree of tolerance to the deletion of rptACg. For further analyses, C. glutamicum ΔrptA was transformed with a plasmid bearing rptACg, as well as with a plasmid encoding Rv3779 of M. tuberculosis to result in C. glutamicum ΔrptA/pVWEx-Cg-rptA and C. glutamicum ΔrptA/pVWEx-Rv3779.

mAGP complex analyses from C. glutamicum, C. glutamicum ΔrptA, C. glutamicum ΔrptA/pVWEx-Cg-rptA, and C. glutamicum ΔrptA/pVWEx-Rv3779.

To study the function of a corynebacterial rptA deletion mutant, defatted cells were analyzed quantitatively for AG-esterified corynomycolic acids. Wild-type C. glutamicum exhibited the known profile of CMAMEs (data not shown) as previously described (4). Furthermore, cell wall-bound CMAMEs were not significantly altered in C. glutamicum ΔrptA (data not shown), which is contrary to the deletion of other GT-C glycosyltransferases in C. glutamicum (4, 5). An analysis of cell wall-associated lipids in several independent experiments highlighted no change in the lipid profiles of the rptACg deletion mutant compared to that of C. glutamicum (data not shown). This was confirmed quantitatively through [14C]acetate labeling of cultures and equal loading of the radioactivity of extractable free lipids from C. glutamicum, C. glutamicum ΔrptA, and the complemented C. glutamicum ΔrptA strain using plasmid pVWEx-Cg-rptA. These results demonstrate that, unlike embCg or aftACg (4, 5), rptACg has little or no involvement in the structure or biosynthesis of cell wall-bound/extractable lipids in C. glutamicum.

The cell wall core (the mAGP complex) was prepared from C. glutamicum and C. glutamicum ΔrptA as described previously (4, 10, 15), and the ratio of Rha/Ara/Gal in the mAGP complex was determined by gas chromatography (GC) analysis of alditol acetates (4, 10, 15) (Fig. 2). The glycosyl compositional analysis of wild-type C. glutamicum revealed a relative molar ratio of Rha/Ara/Gal of 21:71:31, which is in accordance with previous data (4) (Fig. 2). The C. glutamicum ΔrptA mutant yielded AG with a significant reduction in Rha content with no relative change in the molar ratio of Rha-Ara-Gal (1:71:31) (Fig. 2). The complementation of C. glutamicum ΔrptA with pVWEx-Cg-rptA restored the Rha/Ara/Gal ratio to that of wild-type C. glutamicum (Fig. 2). Interestingly, complementation with pVWEx-Rv3779 did not complement and yielded a phenotype identical to that of C. glutamicum ΔrptA (data not shown).

FIG. 2.

FIG. 2.

Open in a new tab

GC analysis of cell walls of C. glutamicum, C. glutamicum ΔrptA, and C. glutamicum ΔrptA/pVWEx-Cg-rptA. Samples of purified cell walls were hydrolyzed with 2 M TFA, reduced, per-O-acetylated, and analyzed as described in Materials and Methods (4, 10). Abbreviations: Ara, arabinose; Gal, galactose; Rha, rhamnose.

GC/MS analysis of per-O-methylated alditol acetate derivatives prepared from C. glutamicum and C. glutamicum ΔrptA indicated a loss of t-linked Rhap residues with a corresponding loss of 2,5-linked Araf residues (Fig. 3). The complementation of C. glutamicum ΔrptA with pVWEx-Cg-rptA restored the glycosyl linkage profile to that of wild-type C. glutamicum (Fig. 3). Furthermore, as demonstrated by our total sugar analysis and cell wall sugar linkage analysis, Rv3779 was unable to complement C. glutamicum ΔrptA by pVWEx-Rv3779. These results demonstrate that the putative protein NCgl0543 is involved in the biosynthesis of C. glutamicum AG through the addition of t-Rhap residues to the C2 position of the five-linked backbone domain of specific Araf residues.

FIG. 3.

FIG. 3.

Open in a new tab

GC/MS analysis of cell walls of C. glutamicum, C. glutamicum ΔrptA, and C. glutamicum ΔrptA/pVWEx-Cg-rptA. Samples of per-O-methylated cell walls were hydrolyzed with 2 M TFA, reduced, per-O-acetylated, and analyzed as described in Materials and Methods (4, 10).

Recognition of a rhamnose lipid-linked sugar donor, decaprenyl-P-rhamnose.

Initial assays involved wild-type membranes from C. glutamicum and UDP-[14C]GlcNAc, dTDP-[14C]Rha, UDP-[14C]Gal, or p[14C]Rpp as the sugar donor for AG biosynthesis. Samples of the radioactive lipids from each assay were applied to TLC plates which were then developed in CHCl3/CH3OH/NH4OH/H2O (65:25:0.5:3.6) and autoradiograms obtained (Fig. 4). As expected, a series of polar glycolipids were observed, including GlcNAc-P-polyprenyl (GL-1), Rha-GlcNAc-P-polyprenyl (GL-2), Gal-Rha-GlcNAc-P-polyprenyl (GL-3), Gal-Gal-Rha-GlcNAc-P-polyprenyl (GL-4), and DPA/DPR (β-d-ribofuranosyl-1-monophosphoryldecaprenyl) consistent with our previous studies utilizing Mycobacterium smegmatis membranes (27). Interestingly, the inclusion of dTDP-[14C]Rha also resulted in the synthesis of a more apolar rhamnose-labeled lipid X product, in comparison to that of GL-2 to -4 (Fig. 4). This lipid X was sensitive to acid and resistant to mild-base treatment, indicating that this product was also a polyprenyl-P-based lipid (data not shown). Importantly, an increase in the synthesis of lipid X, based on TLC and densitometry, was found when assays were repeated with membranes prepared from C. glutamicum ΔrptA (lipid X, 4,300 cpm) compared to C. glutamicum (lipid X, 3,057 cpm), indicating that lipid X was probably the lipid-linked sugar donor for the GT-C glycosyltransferase RptA in this study (Fig. 5). Furthermore, the synthesis of lipid X was unaffected by the addition of tunicamycin (C. glutamicum lipid X, 3,222 cpm; C. glutamicum ΔrptA lipid X, 4,203 cpm) which inhibits the GlcNAc phosphotransferase activity of Rv1302, thus leading to a marked decrease in GL-1 and higher GLs (e.g., higher than GL-2) (Fig. 5). The basic assay mixture was scaled up containing unlabeled dTDP-Rha and the lipid X extracted for subsequent characterization by treatment with a mild base. Negative-ion ES-MS revealed a major signal [M-H]− at m/z 777 for decaprenyl phosphate (Fig. 6A, inset), and a production at m/z 924 corresponding to decaprenyl-P-rhamnose (Fig. 6A). It has not escaped our attention that we also observe mass ions at m/z 934 and m/z 936, which could indicate five and six fully saturated isoprene units out of a possible 10. Similar observations have previously been reported in other Corynebacteriaceae glycolipids, such as the apparent mycolate transporter Myc-PL (11). Altogether, the dTDP-Rha labeling, sensitivity to acid, resistance to base and to tunicamycin, and analysis by ES-MS described above confirmed that lipid X was prenylated P-rhamnose (Fig. 6B) and is therefore the likely substrate of the membrane-bound rhamnosyltransferase RptA.

FIG. 4.

FIG. 4.

Open in a new tab

Analysis of [14C]GlcNAc-, [14C]Rha-, [14C]Gal-, and [14C]Ara-labeled glycolipids in C. glutamicum. Membranes from C. glutamicum were prepared, mixed with decaprenyl-1-monophosphate, and labeled with UDP-[14C]GlcNAc, dTDP-[14C]Rha, UDP-[14C]Gal, or p[14C]Rpp. Radiolabeled glycolipids were extracted, analyzed by TLC, and visualized by autoradiography as described in Materials and Methods.

FIG. 5.

FIG. 5.

Open in a new tab

Analysis of [14C]Rha base stable lipids in C. glutamicum and C. glutamicum ΔrptA and the effect of tunicamycin. Membranes from C. glutamicum and C. glutamicum ΔrptA were prepared, mixed with decaprenyl-1-monophosphate, and labeled with dTDP-[14C]Rha. [14C]Rha-labeled glycolipids were extracted, analyzed by TLC, and visualized by autoradiography as described in Materials and Methods.

FIG. 6.

FIG. 6.

Open in a new tab

MS analysis and identification of decaprenyl-1-monophosphorylrhamnose. (A) ES-MS (in the negative mode) of decaprenyl-1-monophosphorylrhamnose. (B) Structure of decaprenyl-1-monophosphorylrhamnose.

DISCUSSION

It is clear from this present study that rptACg is nonessential and is involved in the addition of t-Rhap residues to a five-linked Araf backbone giving rise to branched 2,5-linked Araf residues. We also report a Rha/Ara molar ratio of 21:71 in C. glutamicum AG (Fig. 2), which equates to approximately seven t-Rhap residues per arabinan tricosamer. This significant amount of rhamnose in the cell wall must not be dismissed, and more so, the functional significance must be elucidated. Rhamnose is present in the cell walls of many gram-positive bacteria such as staphylococci, streptococci, bacilli, and pseudomonades (40). In Pseudomonas aeruginosa, l-rhamnose is present in the form of mono- or disubstituted rhamnolipids, and these virulence factors are thought to act by disrupting lipid membranes by acting as a surfactant (39). In other gram-positive bacteria, rhamnose is present in the cell wall as part of the carbohydrate moieties of teichoic acids and other cell wall glycopolymers (6). However, since C. glutamicum is nonpathogenic, the introduction of t-Rhap residues is probably related to either (i) structural integrity or (ii) a mechanism to cap and end arabinan synthesis and provide a control point for the extent of mycolation of the “terminal” arabinan units.

rptACg shares approximately 40% sequence similarity with the putative M. tuberculosis protein Rv3779. Although, the total lengths of the proteins differ by 133 aa, there are remarkable structural similarities, such as the high identity at the sequence level in the GT-C loop, which is located between TMH 3 and 4 in C. glutamicum (Fig. 1) and TMH 4 and 5 in M. tuberculosis Rv3779. This loop is followed by 10 TMH in C. glutamicum, which are present and similarly arranged in the M. tuberculosis ortholog. Interestingly, within the final periplasmic region, there is also a similar stretch of amino acid residues (Fig. 1A, white star). Since the carboxy-terminal periplasmic domain is suggested to play a role in substrate recognition, which in the case of the GT-C glycosyltransferases is a growing polysaccharide, we speculate that both RptACg and the putative Rv3779 protein recognize a related substrate, such as an arabinan oligosaccharide and distinct sugar donors, since the putative protein Rv3779 failed to complement C. glutamicum ΔrptA.

NCgl0543 is part of the rfb locus, and its genomic organization is well retained in Corynebacterineae. Orthologues of this locus, which include rfbE, NCgl0197, NCgl0195, and rfbD (NCgl0198), are present in C. glutamicum. RfbE has similarity to an ATP-dependent export carrier and is tentatively annotated as being a polysaccharide export ATP-binding protein, and rfbD is tentatively annotated as being a polysaccharide export ABC transporter permease gene (14). We have found that the galactosyltransferase NCgl0195 (2, 26) is essential in C. glutamicum (data not shown) and is involved in GL-3 and GL-4 biosynthesis. Due to the function of RptACg, and its similarity to the putative protein Rv3779, we speculate that the rfb locus is essential for polysaccharide biosynthesis and the resultant export to the periplasm. Finally, the discovery of rptACg has shed new light on the glycosyltransferases which are key to building the cell wall AG of Corynebacterineae.

The biosynthesis of high-energy nucleotide-derived sugar substrates of Corynebacteriaceae glycosyltransferases, such as UDP-α-d-galactofuranose (41) and dTDP-Rhap (23), has been well characterized. These substrates are utilized by GT-A and -B glycosyltransferases in the cytoplasm of the cell to form a preliminary linear galactan polysaccharide before being exported to the periplasm, by an as-yet-unidentified flippase. At this point, further polysaccharide biosynthesis employs glycosyltransferases belonging to the GT-C family which make use of prenylated phosphosugar substrates (8, 22). In Corynebacterineae, decaprenyl (C50), and to a lesser extent octahydroheptaprenyl (C35), are the predominant lipid carriers for peptidoglycan, arabinogalactan, and mannan biosynthesis. Decaprenyl phosphate is glycosylated by arabinose and ribose to form DPA and DPR, respectively (42); mannose to form β-d-mannosyl-1-monophosphoryldecaprenyl (DPM) (19, 43); and glucose to form β-d-glucosyl-1-monophosphoryldecaprenol (GPM) (33). To date, this is the first report of a GT-C rhamnosyltransferase (RptA). Furthermore, this is also the first report of a rhamnosylated monophosphodecaprenyl, which is the substrate for RptA and novel with respect to DPA, DPR, and DPM.

Acknowledgments

H.L.B. is a Medical Research Council quota student. G.S.B. acknowledges support in the form of a personal research chair from James Bardrick and a Royal Society Wolfson Research merit award, as a former Lister Institute-Jenner Research Fellow, and from the Medical Research Council and The Wellcome Trust (081569/Z/06/Z). M.R.M. acknowledges the support of the NIH in the form of grant AI 33706.

Footnotes

▿

Published ahead of print on 29 May 2009.

REFERENCES

  • 1.Alderwick, L., L. G. Dover, M. Seidel, R. Gande, H. Sahm, L. Eggeling, and G. Besra. 2006. Arabinan-deficient mutants of Corynebacterium glutamicum and the consequent flux in decaprenylmonophosphoryl-D-arabinose metabolism. Glycobiology 161073-1081. [DOI] [PubMed] [Google Scholar]
  • 2.Alderwick, L., L. G. Dover, N. Veerapen, S. S. Gurcha, L. Kremer, D. L. Roper, A. K. Pathak, R. C. Reynolds, and G. Besra. 2008. Expression, purification and characterisation of soluble GlfT and the identification of a novel galactofuranosyltransferase Rv3782 involved in priming GlfT-mediated galactan polymerisation in Mycobacterium tuberculosis. Protein Expr. Purif. 58332-341. [DOI] [PubMed] [Google Scholar]
  • 3.Alderwick, L. J., H. L. Birch, A. K. Mishra, L. Eggeling, and G. S. Besra. 2007. Structure, function and biosynthesis of the Mycobacterium tuberculosis cell wall: arabinogalactan and lipoarabinomannan assembly with a view to discovering new drug targets. Biochem. Soc. Trans. 351325-1328. [DOI] [PubMed] [Google Scholar]
  • 4.Alderwick, L. J., E. Radmacher, M. Seidel, R. Gande, P. G. Hitchen, H. R. Morris, A. Dell, H. Sahm, L. Eggeling, and G. S. Besra. 2005. Deletion of Cg-emb in Corynebacterianeae leads to a novel truncated cell wall arabinogalactan, whereas inactivation of Cg-ubiA results in an arabinan-deficient mutant with a cell wall galactan core. J. Biol. Chem. 28032362-32371. [DOI] [PubMed] [Google Scholar]
  • 5.Alderwick, L. J., M. Seidel, H. Sahm, G. S. Besra, and L. Eggeling. 2006. Identification of a novel arabinofuranosyltransferase (AftA) involved in cell wall arabinan biosynthesis in Mycobacterium tuberculosis. J. Biol. Chem. 28115653-15661. [DOI] [PubMed] [Google Scholar]
  • 6.Baddiley, J. 1972. Teichoic acids in cell walls and membranes of bacteria. Essays Biochem. 835-77. [PubMed] [Google Scholar]
  • 7.Belanger, A. E., G. S. Besra, M. E. Ford, K. Mikusova, J. T. Belisle, P. J. Brennan, and J. M. Inamine. 1996. The embAB genes of Mycobacterium avium encode an arabinosyl transferase involved in cell wall arabinan biosynthesis that is the target for the antimycobacterial drug ethambutol. Proc. Natl. Acad. Sci. USA 9311919-11924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Berg, S., D. Kaur, M. Jackson, and P. J. Brennan. 2007. The glycosyltransferases of Mycobacterium tuberculosis—roles in the synthesis of arabinogalactan, lipoarabinomannan, and other glycoconjugates. Glycobiology 1735R-56R. [DOI] [PubMed] [Google Scholar]
  • 9.Berg, S., J. Starbuck, J. B. Torrelles, V. D. Vissa, D. C. Crick, D. Chatterjee, and P. J. Brennan. 2005. Roles of conserved proline and glycosyltransferase motifs of EmbC in biosynthesis of lipoarabinomannan. J. Biol. Chem. 2805651-5663. [DOI] [PubMed] [Google Scholar]
  • 10.Besra, G. S., K. H. Khoo, M. R. McNeil, A. Dell, H. R. Morris, and P. J. Brennan. 1995. A new interpretation of the structure of the mycolyl-arabinogalactan complex of Mycobacterium tuberculosis as revealed through characterization of oligoglycosylalditol fragments by fast-atom bombardment mass spectrometry and 1H nuclear magnetic resonance spectroscopy. Biochemistry 344257-4266. [DOI] [PubMed] [Google Scholar]
  • 11.Besra, G. S., T. Sievert, R. E. Lee, R. A. Slayden, P. J. Brennan, and K. Takayama. 1994. Identification of the apparent carrier in mycolic acid synthesis. Proc. Natl. Acad. Sci. USA 9112735-12739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Birch, H., L. Alderwick, A. Bhatt, D. Rittmann, K. Krumbach, A. Singh, Y. Bai, T. Lowary, L. Eggeling, and G. Besra. 2008. Biosynthesis of mycobacterial arabinogalactan: identification of a novel α(1→3) arabinofuranosyltransferase. Mol. Microbiol. 691191-1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cerdeno-Tarraga, A. M., A. Efstratiou, L. G. Dover, M. T. Holden, M. Pallen, S. D. Bentley, G. S. Besra, C. Churcher, K. D. James, A. De Zoysa, T. Chillingworth, A. Cronin, L. Dowd, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Moule, M. A. Quail, E. Rabbinowitsch, K. M. Rutherford, N. R. Thomson, L. Unwin, S. Whitehead, B. G. Barrell, and J. Parkhill. 2003. The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res. 316516-6523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393537-544. [DOI] [PubMed] [Google Scholar]
  • 15.Daffe, M., P. J. Brennan, and M. McNeil. 1990. Predominant structural features of the cell wall arabinogalactan of Mycobacterium tuberculosis as revealed through characterization of oligoglycosyl alditol fragments by gas chromatography/mass spectrometry and by 1H and 13C NMR analyses. J. Biol. Chem. 2656734-6743. [PubMed] [Google Scholar]
  • 16.Dover, L. G., A. M. Cerdeno-Tarraga, M. J. Pallen, J. Parkhill, and G. S. Besra. 2004. Comparative cell wall core biosynthesis in the mycolated pathogens, Mycobacterium tuberculosis and Corynebacterium diphtheriae. FEMS Microbiol. Rev. 28225-250. [DOI] [PubMed] [Google Scholar]
  • 17.Eggeling, L., and M. Bott. 2005. Handbook of Corynebacterium glutamicum, 1st ed. CRC Press, Taylor & Francis Group, Boca Raton, FL.
  • 18.Escuyer, V. E., M. A. Lety, J. B. Torrelles, K. H. Khoo, J. B. Tang, C. D. Rithner, C. Frehel, M. R. McNeil, P. J. Brennan, and D. Chatterjee. 2001. The role of the embA and embB gene products in the biosynthesis of the terminal hexaarabinofuranosyl motif of Mycobacterium smegmatis arabinogalactan. J. Biol. Chem. 27648854-48862. [DOI] [PubMed] [Google Scholar]
  • 19.Gurcha, S. S., A. R. Baulard, L. Kremer, C. Locht, D. B. Moody, W. Muhlecker, C. E. Costello, D. C. Crick, P. J. Brennan, and G. S. Besra. 2002. Ppm1, a novel polyprenol monophosphomannose synthase from Mycobacterium tuberculosis. Biochem. J. 365441-450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lee, R. E., P. J. Brennan, and G. S. Besra. 1997. Mycobacterial arabinan biosynthesis: the use of synthetic arabinoside acceptors in the development of an arabinosyl transfer assay. Glycobiology 71121-1128. [DOI] [PubMed] [Google Scholar]
  • 21.Letek, M., E. Ordóñez, I. Fernández-Natal, J. A. Gil, and L. M. Mateos. 2006. Identification of the emerging skin pathogen Corynebacterium amycolatum using PCR amplification of the essential divIVA gene as a target. FEMS Microbiol. Lett. 265256-263. [DOI] [PubMed] [Google Scholar]
  • 22.Liu, J., and A. Mushegian. 2003. Three monophyletic superfamilies account for the majority of the known glycosyltransferases. Protein Sci. 121418-1431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ma, Y., J. A. Mills, J. T. Belisle, V. Vissa, M. Howell, K. Bowlin, M. S. Scherman, and M. McNeil. 1997. Determination of the pathway for rhamnose biosynthesis in mycobacteria: cloning, sequencing and expression of the Mycobacterium tuberculosis gene encoding alpha-D-glucose-1-phosphate thymidylyltransferase. Microbiology 143937-945. [DOI] [PubMed] [Google Scholar]
  • 24.McNeil, M., M. Daffe, and P. J. Brennan. 1990. Evidence for the nature of the link between the arabinogalactan and peptidoglycan of mycobacterial cell walls. J. Biol. Chem. 26518200-18206. [PubMed] [Google Scholar]
  • 25.McNeil, M., M. Daffe, and P. J. Brennan. 1991. Location of the mycolyl ester substituents in the cell walls of mycobacteria. J. Biol. Chem. 26613217-13223. [PubMed] [Google Scholar]
  • 26.Mikusova, K., M. Belanova, J. Kordulakova, K. Honda, M. R. McNeil, S. Mahapatra, D. C. Crick, and P. J. Brennan. 2006. Identification of a novel galactosyl transferase involved in biosynthesis of the mycobacterial cell wall. J. Bacteriol. 1886592-6598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mikusová, K., M. Mikus, G. S. Besra, I. Hancock, and P. J. Brennan. 1996. Biosynthesis of the linkage region of the mycobacterial cell wall. J. Biol. Chem. 2717820-7828. [DOI] [PubMed] [Google Scholar]
  • 28.Mikusova, K., R. A. Slayden, G. S. Besra, and P. J. Brennan. 1995. Biogenesis of the mycobacterial cell wall and the site of action of ethambutol. Antimicrob. Agents Chemother. 392484-2489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mishra, A. K., L. Alderwick, D. Rittmann, R. V. Tatituri, J. Nigou, M. Gilleron, L. Eggeling, and G. Besra. 2007. Identification of an α(1→6) mannopyranosyltransferase (MptA), involved in Corynebacterium glutamicum lipomannan biosynthesis, and identification of its orthologue in Mycobacterium tuberculosis. Mol. Microbiol. 651503-1517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mishra, A. K., L. Alderwick, D. Rittmann, C. Wang, A. Bhatt, W. R. Jacobs, K. Takayama, L. Eggeling, and G. Besra. 2008. Identification of a novel α(1→6) mannopyranosyltransferase MptB from Corynebacterium glutamicum by deletion of a conserved gene, NCgl1505, affords a lipomannan- and lipoarabinomannan-deficient mutant. Mol. Microbiol. 681595-1613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schafer, A., A. Tauch, W. Jager, J. Kalinowski, G. Thierbach, and A. Puhler. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 14569-73. [DOI] [PubMed] [Google Scholar]
  • 32.Scherman, M. S., L. Kalbe-Bournonville, D. Bush, Y. Xin, L. Deng, and M. McNeil. 1996. Polyprenylphosphate-pentoses in mycobacteria are synthesized from 5-phosphoribose pyrophosphate. J. Biol. Chem. 27129652-29658. [DOI] [PubMed] [Google Scholar]
  • 33.Schultz, J., and A. D. Elbein. 1974. Biosynthesis of mannosyl- and glucosyl-phosphoryl polyprenols in Mycobacterium smegmatis. Evidence for oligosaccharide-phosphoryl polyprenols. Arch. Biochem. Biophys. 160311-322. [DOI] [PubMed] [Google Scholar]
  • 34.Seidel, M., L. Alderwick, H. Birch, H. Sahm, L. Eggeling, and G. Besra. 2007. Identification of a novel arabinofuranosyltransferase AftB involved in a terminal step of cell wall arabinan biosynthesis in Corynebacterianeae, such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J. Biol. Chem. 28214729-14740. [DOI] [PubMed] [Google Scholar]
  • 35.Seidel, M., L. J. Alderwick, H. Sahm, G. S. Besra, and L. Eggeling. 2007. Topology and mutational analysis of the single Emb arabinofuranosyltransferase of Corynebacterium glutamicum as a model of Emb proteins of Mycobacterium tuberculosis. Glycobiology 17210-219. [DOI] [PubMed] [Google Scholar]
  • 36.Tauch, A., O. Kaiser, T. Hain, A. Goesmann, B. Weisshaar, A. Albersmeier, T. Bekel, N. Bischoff, I. Brune, T. Chakraborty, J. Kalinowski, F. Meyer, O. Rupp, S. Schneiker, P. Viehoever, and A. Pühler. 2005. Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora. J. Bacteriol. 1874671-4682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tauch, A., E. Trost, A. Tilker, U. Ludewig, S. Schneiker, A. Goesmann, W. Arnold, T. Bekel, K. Brinkrolf, I. Brune, S. Götker, J. Kalinowski, P. B. Kamp, F. P. Lobo, P. Viehoever, B. Weisshaar, F. Soriano, M. Dröge, and A. Pühler. 2008. The lifestyle of Corynebacterium urealyticum derived from its complete genome sequence established by pyrosequencing. J. Biotechnol. 13611-21. [DOI] [PubMed] [Google Scholar]
  • 38.Telenti, A., W. J. Philipp, S. Sreevatsan, C. Bernasconi, K. E. Stockbauer, B. Wieles, J. M. Musser, and W. R. Jacobs, Jr. 1997. The emb operon, a gene cluster of Mycobacterium tuberculosis involved in resistance to ethambutol. Nat. Med. 3567-570. [DOI] [PubMed] [Google Scholar]
  • 39.Van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg. Infect. Dis. 4551-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Weidenmaier, C., and A. Peschel. 2008. Teichoic acids and related cell-wall glycopolymers in Gram-positive physiology and host interactions. Nat. Rev. Microbiol. 6276-287. [DOI] [PubMed] [Google Scholar]
  • 41.Weston, A., R. J. Stern, R. E. Lee, P. M. Nassau, D. Monsey, S. L. Martin, M. S. Scherman, G. S. Besra, K. Duncan, and M. R. McNeil. 1997. Biosynthetic origin of mycobacterial cell wall galactofuranosyl residues. Tuber. Lung Dis. 78123-131. [DOI] [PubMed] [Google Scholar]
  • 42.Wolucka, B., M. McNeil, E. de Hoffmann, T. Chojnacki, and P. Brennan. 1994. Recognition of the lipid intermediate for arabinogalactan/arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. J. Biol. Chem. 26923328-23335. [PubMed] [Google Scholar]
  • 43.Yokoyama, K., and C. E. Ballou. 1989. Synthesis of α(1→6)-mannooligosaccharides in Mycobacterium smegmatis. Function of β-mannosylphosphoryldecaprenol as the mannosyl donor. J. Biol. Chem. 26421621-21628. [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES