Abstract
Interaction of TCF7l2 with translocated β-catenin in the nucleus transiently converts TCF7L2 to transcription factor activators, which induce the expression of target genes, including cyclin D1 and c-myc, in colorectal carcinogenesis. We evaluated the association of a polymorphism in TCF7L2 (RS12255372) which previously has been strongly associated with risk of Type II Diabetes, with colorectal cancer (CRC) and adenoma in the prospective Nurses’ Health Study (NHS) and Health Professionals Follow-up Study (HPFS) cohorts. In the NHS and HPFS control populations, the TCF7L2 T-allele frequency ranged from 28 to 30% and the genotype distribution was in agreement with Hardy-Weinberg equilibrium. Overall, there was suggestive evidence for an inverse association associated with homozygosity for the minor allele of RS12255372 (TCF7L2 TT) and CRC (conditional and covariate adjusted OR=0.63, 95%CI: 0.37–1.08; P for heterogeneity 0.52 for the association in women and men), which was more evident among women (OR=0.39, 95%CI: 0.16 – 0.91). The polymorphism was not associated with risk of colorectal adenoma. Furthermore, we observed no evidence of effect modification between the TCF7L2 SNP and covariates such as family history (p-interaction=0.45) or BMI (p-interaction=0.27) or with genetic variants in the APC Asp1822Val SNP (NHS cancer p-interaction=0.40, NHS adenoma p-interaction 0.10). In summary, the marginal association of TCF7L2 SNP with CRC may be due to chance, but warrants further laboratory and epidemiological investigation.
Keywords: TCF7L2, polymorphism, Wnt pathway, colorectal cancer
Introduction
T-cell factor (TCF)/LEF proteins facilitate the formation of multiprotein enhancer complexes to modulate the transcription of target genes. Interaction of T-cell factor 7 like 2 (TCF7L2, previously reported as TCF-4) with translocated β-catenin in the nucleus transiently converts TCF7L2 to a transcription factor activator, which induces the expression of target genes, including cyclin D1 and c-myc, in colorectal carcinogenesis [1]. Duval et al. (1999; 2000) characterized the genomic structure of TCF7L2/TCF-4 in colorectal cancer (CRC) cell lines [2–3]. TCF7L2 has alternative exons leading to isoforms with short, medium, or long C-terminal ends; the long C-terminal ends may mediate transcriptional repression [3]. TCF7L2 frameshift mutation in MSI-H CRC leads to selective loss of TCF7L2 isoforms with CtBP-binding abilities [4]. Recently, a genome-wide analysis of 11 CRC tumor cell lines or xenografts classified TCF7L2 [5] as a cancer candidate gene (with a cancer mutation prevalance, CaMP, score of 2.8; >1 is a cancer candidate gene). Polymorphisms in TCF7L2 have been associated with disease susceptibility. Specifically, Grant et al. (2006) demonstrated that a polymorphism in TCF7L2 is associated with increased risk of type II diabetes (T2D) [6–12] by impaired beta-cell function [7,9]. Epidemiologic studies have suggested that hyperinsulinemia may be related to the risk of colon adenoma and cancer [13–16]. Given its relevance to the etiology of colorectal cancer, we evaluated the association of the TCF7L2 (RS12255372) polymorphism with colorectal cancer and adenoma in the prospective Nurses’ Health Study (NHS) and Health Professionals Follow-up Study (HPFS) cohorts.
Materials and methods
Study population
The NHS began in 1976 when 121,700 female registered nurses in the United States between the ages of 30 and 55 completed a self-administered questionnaire on their medical history and baseline health-related exposures. Subsequently, these participants have completed a mailed, self-administered questionnaire biennially to update information on their lifestyle, medical history, and diet (every 2 to 4 years).
In 1989 and 1990, 32,826 women, between the ages of 43 and 69, provided blood samples. Upon receipt, samples were immediately centrifuged and aliquoted into plasma, red blood cells, and buffy coat fractions for storage in liquid nitrogen. After blood collection through June 2000, 197 incident cases of colorectal cancer were confirmed through medical records or death reports, of which 190 cases were successfully genotyped. Controls were randomly selected from women who were alive and free of cancer at the time of case ascertainment. One control was matched to each case on year of birth and month of blood draw. As previously described, [17], cases of colorectal adenoma and controls were chosen from among women who supplied a blood sample, had a sigmoidoscopy or colonoscopy (by 1998) after providing a blood sample, and were free from diagnosed cancer (except nonmelanoma skin cancer), ulcerative colitis, and adenoma before endoscopy. Newly diagnosed polyps (in individuals who never had a polyp diagnosed before the date of blood draw) were reported on the 1990, 1992, 1994, 1996, or 1998 questionnaire. These polyps were confirmed to be adenomatous by review of histopathological reports and were classified by location (proximal or distal colon, or rectum), size (<1 cm, ≥1 cm), and histology (tubular, tubulovillous, villous, carcinoma-in-situ (CIS)) by study investigators blinded to the exposure information. Advanced adenoma was defined as large adenomas ≥1 cm in size and [Aditi – do you mean “or” as well here – typically advanced adenoma also includes polyps < 1cm with any villous component) tubulovillous, villous, or carcinoma in situ histology. Between 1989 and 1998, 557 women with colorectal adenoma were identified, and one control was selected for each case, matched on year of birth, year of blood draw, time period of recent endoscopy, indication for endoscopy, and time period of first or most recent endoscopy. One case was subsequently found to be hyperplastic and was excluded from the analysis. Thus, the total number of cases and controls analyzed in this study were 556 cases and 557 controls. Diet was assessed in 1986, 1990, 1994 and 1996 with a semiquantitative food frequency questionnaire.
The HPFS began in 1986 when 51,529 US male dentists, optometrists, osteopaths, podiatrists, pharmacists, and veterinarians, ages 40 to 75 years, responded to a mailed questionnaire [18]. These men provided baseline information on age, marital status, height, weight, ancestry, medications, smoking history, medical history, physical activity, and diet. Exposure and medical history information are updated every 2 years. Blood samples were collected from 18,225 of the HPFS participants between 1993 and 1995. Among these men, 168 incident cases of CRC were identified between the date of blood draw and January 2002. Men who were alive and free of diagnosed cancer at the time of case ascertainment were selected as controls and were matched to cases on year of birth and month of blood draw.
Genotyping methods
Genotyping was performed at the Dana-Farber/Harvard Cancer Center High-Throughput Polymorphism Core. DNA was extracted from 50-µL buffy coat fractions diluted with 150 µL of PBS by the Qiagen QIAamp Blood Kit (Qiagen, Chatsworth, CA) spin protocol. The genotype of theTCF7L2 polymorphism was determined by measuring end-point fluorescence using the 5’ nuclease assay (Taqman) on the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) [19]. The primers for RS12255372 (G,T) in Intron 3 TCF7L2 were: Forward: GCTGAGCTGCCCAGGAATAT; Reverse: GCAGAGGCCTGAGTAATTATCAGAA.
Quality control was ensured by including a random 10% of the samples in the 96-well plates as duplicates. The quality control samples served as internal controls to validate the genotyping methods; there was 100% concordance of the quality control samples. Laboratory personnel were blinded to the status (case, control, or quality control) of samples.
Statistical analysis
The study population included 357 incident CRC cases and 814 matched controls and 556 incident adenoma cases and 557 matched controls for the analyses. The number of cases and controls for the polymorphism was slightly lower because of missing genotyping data. Genotype distributions were evaluated for agreement with Hardy-Weinberg equilibrium (HWE) by the chi-square test. We evaluated differences among cases and controls using the chi-square test for categorical variables and the paired t-test for continuous variables.
We used both conditional and unconditional logistic regression for the analyses to compute genotype odds ratios (ORs), 95% confidence intervals (CIs), allelic trend tests, and interactions. In the multivariate models, we adjusted for known risk factors for colorectal neoplasia, including family history of CRC, pack-years of smoking, postmenopausal hormone use, body mass index (BMI), physical activity, aspirin use, total energy intake, and consumption of red meat, alcohol, and folate. Unconditional logistic analyses explicitly adjusted for matching variables, including age, history of previous endoscopy (before blood draw), year of endoscopy, (endoscopy variables I assume are only for the polyps) and blood draw factors.
The SNP was initially examined with the codominant model, evaluating the TCF7L2 as a three-level categorical variable. We also used the dominant model, comparing variant carriers with the referent homozygous wild type. The risk for advanced and small adenoma was evaluated by polytomous logistic regression with an ordinal outcome variable that was modeled as a three-level categorical variable: advanced adenoma, small adenoma, and controls. Effect modification by covariates, family history, and BMI was tested with p-values obtained from the likelihood ratio test comparing models with and without the interaction term between genotype and covariate. Gene-gene interactions with a non-synonymous Adematous Polyposis Coli (APC) Asp 1822 Val were tested by likelihood ratio tests comparing the model with main effects for each polymorphism to the model including indicator variables for the cross-tabulation of the two polymorphisms. All p-values reported are two-sided.
Results
Cancer
Details of this study population have been previously reported [17]. Briefly, there were 367 incident cases of CRC and 852 controls. The mean age of cases and their matched controls was 68 years. As expected, family history was more common in the cases, whereas aspirin use, multivitamin use, and being a never smoker was more common among controls.
Adenoma
Details of this study population have been previously reported [18]. The mean age of cases and their matched controls was 62.3 years. Family history of CRC, smoking >25 pack-years, BMI > 30 kg/m2, and consumption of >1 serving of red meat/day were associated with an increased risk of colorectal adenoma. In addition, cases were less likely than controls to be current users of postmenopausal hormones or to take multivitamins and aspirin (<7 aspirin tablets/week). A sub-analysis of distal-only adenoma did not reveal a point estimate that varied (point estimate varied less than 10%) from the overall main effect of the SNP.
TCF7L2 polymorphism
The TCF7L2 T-allele frequency ranged from 28 to 30% and the genotype distribution was in agreement with Hardy-Weinberg equilibrium. Overall, there was a marginal inverse association with the minor allele of RS12255372 (TCF7L2 TT) and CRC (conditional and covariate adjusted OR=0.63, 95%CI: 0.37–1.08; P for heterogeneity 0.52 for the association in women and men). Although limited by sample size and thus perhaps due to chance, this association was more evident among women (OR=0.39, 95%CI: 0.16 – 0.91). The TCF7L2 polymorphism was not associated with risk of small (multivariate OR=0.95 (95% CI: 0.74 – 1.18)) or advanced (multivariate OR=1.01 (95% CI: 0.78 – 1.32)) colorectal adenomas (p-value=0.82 for 2- degree of freedom likelihood ratio test, data not shown). Furthermore, we observed no evidence of effect modification between the TCF7L2 SNP and covariates such as family history (p-interaction=0.45) and BMI (p-interaction=0.27) or with genetic variants in the APC Asp1822Val SNP (NHS cancer p-interaction=0.40, NHS adenoma p-interaction 0.10).
Discussion
APC is the gatekeeper tumor suppressor gene associated with CRC. High-penetrance mutations in the APC pathway are a hallmark of familial CRC (familial adenomatus polyposis or FAP). In this pathway, activated Wnt signaling leads to the accumulation of nuclear β-catenin. The cytoplasmic level of β-catenin is regulated by ubiquitin-mediated proteolysis after it is targeted for phosphorylation by glycogen synthase kinase 3β (GSK-3β). The phosphorylation of β-catenin by GSK-3β occurs in the context of a structural complex that includes Axin and APC [20]. GSK-3β activity is inhibited in the presence of a Wnt signal [21]. Interaction of excess translocated β-catenin in the nucleus with TCF7L2 upregulates expression of specific target genes, including cyclin D1, c-myc [22–23] and GLP-1 [24].
In this study, we observed a marginal inverse association between the TCF7L2 polymorphism and risk of CRC, but not adenoma. Evaluating the gene-environment association of the SNP with family history and BMI did not reveal a significant interaction. Furthermore, the APC Asp1822Val SNP did not modify the risk of CRC and adenoma among women for any TCF7L2 genotype.
In the past year several publications have reported an increased risk of T2D (this abbrevation, if you are going to use it, needs to be defined earlier) among T-allele carriers. Grant et al. (2006) identified DG10S478 located in intron 3-exon 4 of the TCF7L2 gene on chromosome 10q25.2 (in a well-defined LD block of 92.1 kb based on CEU HapMap v16; GenBank NM 030756) that had an r2 of 0.95 with the rs12255372 SNP [6]. The authors suggest that the TCF7L2 variants increase T2D risk by altering proglucagon gene expression [6] in enteroendrocrine cells [24] via the Wnt signaling pathway [26]. Florez et al. (2006) reported that individuals with the TT genotype have decreased insulin secretion [7]. The reduced insulin secretion may be due to decreased expression of proglucagon and glucagons like peptide-1 [24]. Zhang et al. (2006) reported an increased risk for T2D for the TT genotype in the NHS (687 T2D, 1051 controls) with an OR of 1.86 (95% CI: 1.30 –2.67) and in the HPFS (886 T2D, 896 controls) with an OR of 2.15 (95% CI: 1.48 – 3.13) [8]. A study of breast cancer risk among 592 German families [25] and 735 controls reported a modest association with increased risk (OR=1.19 (95% CI: 1.01–1.42) for the T-allele.
I might include a paragraph here which discussed the assocation between diabetes and CRC and how you would have expected, based on that relationship, to have seen an increased risk with the polymorphism. Hence, this study suggests that there is NO increased risk and possibly an inverse association that warrants more investigation. That might be a better sell overall – as a null study which if anything, shows inverse assocation.
The TCF7L2 polymorphism is located in interspersed repeat elements, 41 kb upstream and 9 kb downstream of alternatively spliced exon 4 [7]. A limitation of this analysis is that the functional relevance of this SNP is unknown. In summary, the marginal inverse association of TCF7L2 SNP with CRC may be due to chance, but warrants further laboratory and epidemiological investigation.
Table 1.
Association between the TCF7L2 (rs12255372) genetic variants with colorectal cancer and adenoma risk in the Nurses’ Health Study and Health Professionals Follow-up Study
| Cases N (%) |
Controls* N (%) |
Conditional OR1 (95% CI) |
Multivariate Conditional OR2 (95% CI) |
|
|---|---|---|---|---|
| NHS and HPFS CRC3 | ||||
| TCF7 L2 | N=357 | N=814 | ||
| GG | 199 (55.7) | 413 (50.7) | 1.00 (Reference) | 1.00 (Reference) |
| GT | 135 (37.8) | 328 (40.3) | 0.89 (0.68 – 1.16) | 0.90 (0.68 – 1.18) |
| TT | 23 (6.4) | 73 (9.0) | 0.64 (0.38 – 1.07) | 0.63 (0.37 – 1.08) |
| 4P-trend | 0.10 | |||
| GT+TT | 158 (44.3) | 401 (49.3) | 0.84 (0.69 – 1.03) | 0.84 (0.68 – 1.04) |
| NHS CRC | ||||
| TCF7L2 | ||||
| GG | 100 (53.2) | 233 (49.7) | 1.00 (Reference) | 1.00 (Reference) |
| GT | 81 (43.1) | 194 (41.4) | 0.99 (0.70 – 1.40) | 1.00 (0.68 – 1.46) |
| TT | 7 (3.7) | 42 (9.0) | 0.39 (0.17 – 0.91) | 0.39 (0.16 – 0.91) |
| P-trend | 0.14 | |||
| GT+TT | 88 (46.8) | 236 (50.4) | 0.81 (0.62 – 1.07) | 0.81 (0.60 – 1.07) |
| HPFS CRC | ||||
| TCF L2 | ||||
| GG | 101 (58.7) | 186 (52.8) | 1.00 (Reference) | 1.00 (Reference) |
| GT | 55 (32.0) | 135 (38.4) | 0.75 (0.50 – 1.13) | 0.78 (0.50 – 1.20) |
| TT | 16 (9.3) | 31 (8.8) | 0.96 (0.48 – 1.91) | 0.89 (0.42 – 1.89) |
| P-trend | 0.37 | |||
| GT+TT | 71 (41.3) | 166 (47.2) | 0.88 (0.66 – 1.17) | 0.87 (0.64 – 1.18) |
| NHS Adenoma | ||||
| TCF7L2 | ||||
| GG | 271 (51.8) | 273 (52.4) | 1.00 (Reference) | 1.00 (Reference) |
| GT | 218 (41.7) | 204 (39.2) | 1.06 (0.81 – 1.39) | 1.12 (0.83 – 1.51) |
| TT | 34 (6.4) | 44 (8.4) | 0.75 (0.45 – 1.24) | 0.74 (0.41 – 1.32) |
| P-trend | 0.83 | |||
| GT+TT | 252 (48.2) | 248 (47.6) | 0.95 (0.78 – 1.16) | 0.98 (0.78 – 1.22) |
HWE p-value for total NHS and HPFS controls is 0.50 (NHS cancer: HWE p=0.86 controls, p=0.05 cases; HPFS cancer: HWE p=0.36 controls, p=0.04 cases; NHS adenoma: HWE p=0.50 controls, HWE p=0.26)
Conditional logistic regression conditioned on the strata defined by the matching variables
Conditional logistic regression conditioned on the strata defined by the matching variables, and adjusted for family history of colon cancer, pack years smoked, body mass index, PMH use, BMI, aspirin intake, physical activity, alcohol intake, total folate consumption, and red meat consumption.
P for heterogeneity 0.52 for the association in women and men
Armitage test for trend
Table 2.
Association of TCF7L2 variants with covariates
| Cases N (%) |
Controls N (%) |
Multivariate OR1 (95% CI) |
P-int2 | ||
|---|---|---|---|---|---|
| TCF7L2 | Family History | ||||
| GG | No | 152 (42.9) | 335 (41.9) | 1.00 (Ref) | |
| GT+TT | No | 120 (33.9) | 334 (41.8) | 0.78 (0.58 – 1.06) | |
| GG | Yes | 45 (12.7) | 70 (8.8) | 1.35 (0.85 – 2.13) | |
| GT+TT | Yes | 37 (10.4) | 61 (7.6) | 1.39 (0.85 – 2.27) | |
| 0.45 | |||||
| TCF7L2 | BMI | ||||
| GG | <25 | 85 (24.0) | 185 (23.3) | 1.00 (Ref) | |
| GT+TT | <25 | 69 (19.5) | 190 (23.8) | 0.83 (0.55 – 1.24) | |
| GG | ≥25 | 112 (31.6) | 220 (27.5) | 1.02 (0.70 – 1.50) | |
| GT+TT | ≥25 | 88 (24.9) | 205 (25.6) | 0.84 (0.55 – 1.24) | 0.27 |
Logistic regression adjusted for family history of colon cancer, pack years smoked, body mass index (BMI), post-menopausal hormone (PMH) use, aspirin intake, physical activity, alcohol intake, total folate consumption, and red meat consumption.
P-int: p-values obtained from the likelihood ratio test (LRT) comparing models with and without the interaction term between genotype and covariate
Table 3.
Interaction of TCF7L2 and APC 1822 variants and CRC and CRA risk in the NHS
| Cancer Cases | Controls | Multivariate OR1 (95% CI) |
P-int2 | ||
|---|---|---|---|---|---|
| TCF7L2 | APC 1822 | ||||
| GG | Asp | 50 (28.3) | 129 (29.3) | 1.00 (Ref) | |
| GT+TT | Asp | 55 (31.1) | 128 (29.1) | 1.13 (0.69 – 1.86) | |
| GG | Asp+Val | 42 (23.7) | 88 (20.0) | 1.23 (0.68 – 2.22) | |
| GT+TT | Asp+Val | 30 (17.0) | 95 (21.6) | 0.76 (0.42 – 1.37) | |
| 0.40 | |||||
| Adenoma Cases | Controls |
Multivariate OR2 (95% CI) |
P-int | ||
| TCF7L2 | APC 1822 | ||||
| GG | Asp | 154 (30.5) | 147 (29.3) | 1.00 (Ref) | |
| GT+TT | Asp | 129 (25.5) | 139 (27.7) | 0.91 (0.63 - 1.33) | |
| GG | Asp+Val | 109 (21.6) | 117 (23.4) | 0.94 (0.64 – 1.37) | |
| GT+TT | Asp+Va1 | 113 (22.4) | 98 (19.6) | 1.21 (0.80 – 1.84) | |
| 0.10 |
Logistic regression adjusted for family history of colon cancer, pack years smoked, body mass index (BMI), post-menopausal hormone (PMH) use, aspirin intake, physical activity, alcohol intake, total folate consumption, and red meat consumption.
P-int: P-value from LRT comparing the model with main effects for each polymorphism to the model including crosstabulated indicator variables.
The commonly used abbreviations are
- SNPs
single nucleotide polymorphisms
- TCF7L2
T-cell factor 7 like 2
- CRC
colorectal cancer
- T2D
Type II Diabetes
- NHS
Nurses’ Health Study
- HPFS
Health Professionals Follow-up Study
- OR
Odds Ratio
- CI
confidence interval
References
- 1.Nelson WJ, Nusse R. Convergence of Wnt, beta-catenin, and cadherin pathways. Science. 2004;303:1483–1487. doi: 10.1126/science.1094291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Duval A, Gayet J, Zhou XP, Iacopetta B, Thomas G, Hamelin R. Frequent frameshift mutations of the TCF-4 gene in colorectal cancers with microsatellite instability. Cancer Res. 1999;59:4213–4215. [PubMed] [Google Scholar]
- 3.Duval A, Rolland S, Tubacher E, Bui H, Thomas G, Hamelin R. The human T-cell transcription factor-4 gene: structure, extensive characterization of alternative splicings, and mutational analysis in colorectal cancer cell lines. Cancer Res. 2000;60:3872–3879. [PubMed] [Google Scholar]
- 4.Cuilliere-Dartigues P, El-Bchiri J, Krimi A, Buhard O, Fontanges P, Flejou JF, Hamelin R, Duval A. TCF-4 isoforms absent in TCF-4 mutated MSI-H colorectal cancer cells colocalize with nuclear CtBP and repress TCF-4-mediated transcription. Oncogene. 2006;25:4441–4448. doi: 10.1038/sj.onc.1209471. [DOI] [PubMed] [Google Scholar]
- 5.Sjölblom, et al. The consensus coding sequences of human breast and colorectal cancers. Science. 2006;314:268–274. doi: 10.1126/science.1133427. [DOI] [PubMed] [Google Scholar]
- 6.Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, Helgason A, Stefansson H, Emilsson V, Helgadottir A, Styrkarsdottir U, Magnusson KP, Walters GB, Palsdottir E, Jonsdottir T, Gudmundsdottir T, Gylfason A, Saemundsdottir J, Wilensky RL, Reilly MP, Rader DJ, Bagger Y, Christiansen C, Gudnason V, Sigurdsson G, Thorsteinsdottir U, Gulcher JR, Kong A, Stefansson K. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006;38:320–323. doi: 10.1038/ng1732. [DOI] [PubMed] [Google Scholar]
- 7.Florez Florez JC, Jablonski KA, Bayley N, Pollin TI, de Bakker PIW, Shuldiner AR, Knowler WC, Nathan DM, Altshuler D. the Diabetes Prevention Program: TCF7L2 polymorphisms and progression to diabetes in the Diabetes Prevention Program. N Engl J Med. 2006;355:241–250. doi: 10.1056/NEJMoa062418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang C, Qi L, Hunter DJ, Meigs JB, Manson JE, van Dam RM, Hu FB. Variant of transcription factor 7-like 2 (TCF7L2) gene and the risk of type 2 diabetes in large cohorts of U.S. women and men. Diabetes. 2006;55:2645–2648. doi: 10.2337/db06-0643. [DOI] [PubMed] [Google Scholar]
- 9.Saxena R, Gianniny L, Burtt NP, Lyssenko V, Giuducci C, Sjogren M, Florez JC, Almgren P, Isomaa B, Orho-Melander M, Lindblad U, Daly MJ, Tuomi T, Hirschhorn JN, Ardlie KG, Groop LC, Altshuler D. Common single nucleotide polymorphisms in TCF7L2 are reproducibly associated with type 2 diabetes and reduce the insulin response to glucose in nondiabetic individuals. Diabetes. 2006;55:2890–2895. doi: 10.2337/db06-0381. [DOI] [PubMed] [Google Scholar]
- 10.Scott LJ, Bonnycastle LL, Willer CJ, Sprau AG, Jackson AU, Narisu N, Duren WL, Chines PS, Stringham HM, Erdos MR, Valle TT, Tuomilehto J, Bergman RN, Mohlke KL, Collins FS, Boehnke M. Association of transcription factor 7-like 2 (TCF7L2) variants with type 2 diabetes in a Finnish sample. Diabetes. 2006;55:2649–2653. doi: 10.2337/db06-0341. [DOI] [PubMed] [Google Scholar]
- 11.Groves CJ, Zeggini E, Minton J, Frayling TM, Weedon MN, Rayner NW, Hitman GA, Walker M, Wiltshire S, Hattersley AT, McCarthy MI. Association analysis of 6,736 U.K. subjects provides replication and confirms TCF7L2 as a type 2 diabetes susceptibility gene with a substantial effect on individual risk. Diabetes. 2006;55:2640–2644. doi: 10.2337/db06-0355. [DOI] [PubMed] [Google Scholar]
- 12.Damcott CM, Pollin TI, Reinhart LJ, Ott SH, Shen H, Silver KD, Mitchell BD, Shuldiner AR. Polymorphisms in the transcription factor 7-like 2 (TCF7L2) gene are associated with type 2 diabetes in the Amish: replication and evidence for a role in both insulin secretion and insulin resistance. Diabetes. 2006;55:2654–2659. doi: 10.2337/db06-0338. [DOI] [PubMed] [Google Scholar]
- 13.Platz EA, Hankinson SE, Rifai N, Colditz GA, Speizer FE, Giovannucci E. Glycosylated hemoglobin and risk of colorectal cancer and adenoma (United States) Cancer Causes Control. 1999;10:379–386. doi: 10.1023/a:1008953611657. [DOI] [PubMed] [Google Scholar]
- 14.Wei EK, Ma J, Pollak MN, et al. C-peptide, insulin-like growth factor binding protein-1, glycosylated hemoglobin, and the risk of distal colorectal adenoma in women. Cancer Epidemiol Biomarkers Prev. 2006;15:750–755. doi: 10.1158/1055-9965.EPI-05-0820. [DOI] [PubMed] [Google Scholar]
- 15.Wei EK, Ma J, Pollak MN, et al. A prospective study of C-peptide, insulin-like growth factor-I, insulin-like growth factor binding protein-1, and the risk of colorectal cancer in women. Cancer Epidemiol Biomarkers Prev. 2005;14:850–855. doi: 10.1158/1055-9965.EPI-04-0661. [DOI] [PubMed] [Google Scholar]
- 16.Tran TT, Naigamwalla D, Oprescu AI, et al. Hyperinsulinemia, but not other factors associated with insulin resistance, acutely enhances colorectal epithelial proliferation in vivo. Endocrinology. 2006;147:1830–1837. doi: 10.1210/en.2005-1012. [DOI] [PubMed] [Google Scholar]
- 17.Koushik A, Kraft P, Fuchs C, Hankinson SE, Willett WC, Giovannucci EL, Hunter DJ. Polymorphisms in one-carbon metabolism genes and associations with colorectal cancer. Cancer Epidemiol. Biomarkers Prev. 2006;15:2408–2417. doi: 10.1158/1055-9965.EPI-06-0624. [DOI] [PubMed] [Google Scholar]
- 18.Tranah GJ, Giovannucci E, Ma J, Fuchs C, Hunter DJ. APC Asp1822Val and Gly2502Ser polymorphisms and risk of colorectal cancer and adenoma. Cancer Epidemiol. Biomarkers Prev. 2005;14:863–870. doi: 10.1158/1055-9965.EPI-04-0687. [DOI] [PubMed] [Google Scholar]
- 19.Livak KJ. Allelic discrimination using fluorogenic probes and 5’ nuclease assay. Genet Anal. 1999;14:143–149. doi: 10.1016/s1050-3862(98)00019-9. [DOI] [PubMed] [Google Scholar]
- 20.Hart MJ, de los Santos R, Albert IN, Rubinfeld B, Polakis P. Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr Biol. 1998;8:573–581. doi: 10.1016/s0960-9822(98)70226-x. [DOI] [PubMed] [Google Scholar]
- 21.Polakis P. Wnt signaling and cancer. Genes Dev. 2000;14:1837–1851. [PubMed] [Google Scholar]
- 22.Tetsu O, McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature. 1999;398:422–426. doi: 10.1038/18884. [DOI] [PubMed] [Google Scholar]
- 23.He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ, Vogelstein B, Kinzler KW. Identification of c-MYC as a target of the APC pathway. Science. 1998 Sep 4;281(5382):1509–1512. doi: 10.1126/science.281.5382.1509. [DOI] [PubMed] [Google Scholar]
- 24.Yi F, Brubaker PL, Jin T. TCF-4 mediates cell type-specific regulation of proglucagon gene expression by beta-catenin and glycogen synthase kinase-3beta. J Biol Chem. 2005;280:1457–1464. doi: 10.1074/jbc.M411487200. [DOI] [PubMed] [Google Scholar]
- 25.Burwinkel B, Shanugam KS, Hemminki K, Meindl A, Schmutzler RK, Sutter C, Wappenschmidt B, Kiechle M, Bartram CR, Frank B. Transcription factor 7-like 2 (TCF7L2) variant is associated with familial breast cancer risk: a case-control study. BMC Cancer. 2006;6:268. doi: 10.1186/1471-2407-6-268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Smith U. TCF7L2 and type 2 diabetes – we WNT to know. Diabetologia. 2007;50:5–7. doi: 10.1007/s00125-006-0521-z. [DOI] [PubMed] [Google Scholar]