Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Dec 1.
Published in final edited form as: Clin Cancer Res. 2008 Dec 1;14(23):7804–7812. doi: 10.1158/1078-0432.CCR-08-0744

Association between CCND1 G/A870 polymorphism, allele-specific amplification, cyclin D1 expression and survival in esophageal and lung carcinoma

Vanita K Gupta 1, Andrew Feber 1, Liqiang Xi 1, Arjun Pennathur 2, Maoxin Wu 1, James D Luketich 2, Tony E Godfrey 1,*
PMCID: PMC2723959  NIHMSID: NIHMS83291  PMID: 19047108

Abstract

Purpose

Cyclin D1 (D1) is found on 11q13 which is a region frequently amplified in several tumor types. The CCND1 locus gives rise to at least two protein isoforms of D1 (D1a and D1b). A common G/A polymorphism (G/A870) is thought to influence the expression levels of D1a and D1b. D1b has been suggested to be increased in the presence of the A allele and more oncogenic than D1a. Furthermore, the A allele has been reported to correlate with increased risk of carcinoma in several tumor types suggesting that this polymorphism and D1b are important in tumor progression. However, contradictory data regarding the polymorphism, D1 variant expression, and correlation with survival have been reported. We explored the relationship between gene amplification, G/A870 genotype, D1a and D1b expression and overall survival in esophageal adenocarcinoma (EAC) and non-small cell lung cancer (NSCLC).

Experimental Design

DNA and RNA were isolated from 54 EAC samples and 89 NSCLC samples and analyzed for gene amplification, genotype at the polymorphism, gene expression, and association with overall survival.

Results

D1 variant expression did not correlate with amplification, genotype or overall survival in either tumor type. Total D1 expression correlated with decreased patient survival. Several other genes on 11q13 also appear to be overexpressed and correlated with decreased survival.

Conclusions

We report that the G/A870 polymorphism does not correlate with patient survival or with D1a or D1b expression. However, total D1 expression and expression of several other genes on 11q13 appear to be associated with EAC patient survival.

Keywords: CCND1, cyclin D1, esophageal adenocarcinoma, NSCLC

INTRODUCTION

Genomic instability resulting in DNA amplification, rearrangements or deletions, is a common mechanism by which tumors modulate gene expression and acquire invasive and metastatic potential (1,2). The chromosomal band 11q13 has been found to be amplified or rearranged in a wide variety of carcinomas including breast, head and neck, and bladder and this is often associated with poor prognosis (3-6). The 11q13 amplicon core is a gene rich region containing at least 10 genes. However, despite reports on overexpression of other genes in the region (7,8) the most likely tumorigenic driver at this locus is still thought to be CCND1, which encodes cyclin D1.

Cyclin D1 was identified in 1991 as a proto-oncogene and its role in cell cycle progression was established soon after. Cyclin D1 is a highly regulated factor, induced by mitogenic signals to transition cells from the quiescent G1 phase to the proliferative S phase of the cell cycle. Once induced, it binds and activates the cyclin dependant kinases, CDK 4 and 6, which hyperphosphorylates Rb to release the E2F transcription factor necessary for the expression of S phase genes.

In 1995, a frequent G/A single nucleotide polymorphism (SNP) was identified in the CCND1 gene (9). This G/A polymorphism (G/A870) occurs at the exon 4 splice donor site and although it does not alter the amino acid encoded, it is hypothesized to affect splicing at the exon 4/intron 4 boundary. The G allele represents a more conserved consensus splice donor site than the A allele which may not be recognized as efficiently (10). The result is reduced splicing at the exon 4/intron 4 boundary and the expression of a truncated protein due to an intronic, in-frame TGA stop codon (Fig 1). Consequently the C-terminal domain of the resulting cyclin D1 variant, cyclin D1b, which does not encode the fifth and final exon, lacks residues required for nuclear export and has been demonstrated to be constitutively nuclear in localization (11,12). Furthermore, cyclin D1b demonstrated increased transforming capability compared to the full length D1 variant, D1a, and therefore may be a more potent oncogene.

Figure 1. Cyclin D1 splice variants.

Figure 1

Open in a new tab

Cyclin D1a encodes all 5 exons and a 3' UTR with 2 putative polyadenylation signals about 300 and 3000 bases downstream of the TGA stop codon. D1b encodes exons 1-4 and part of intron 4 with its 3'UTR found in intron 4. Similar to D1a, the cyclin D1b 3' UTR has 2 potential polyadenylation sites about 300 and 3000 bases downstream of the stop codon. The expression of D1a or D1b is hypothesized to be determined by the G/A polymorphism at nucleotide 870, the last nucleotide of exon 4, and recognition of the exon 4/intron 4 boundary.

While both homozygous A and G genotypes can give rise to cyclin D1a and D1b transcripts, it is generally thought that the A allele results in increased expression of cyclin D1b compared with the G allele. However, this belief is derived from only two reports (9,13) on a limited number of non-small cell lung cancer (NSCLC) and head and neck cancer samples. Furthermore, in a recent review of CCND1 in NSCLC, data is presented that appears to contradict the original NSCLC report (14). In addition, one study on lymphoma and leukemia actually found that the G, not the A allele, may result in increased D1b expression (15). Thus, while some differences in alternative splicing may be tissue specific, the association between the A/G870 SNP and cyclin D1, D1a, and D1b expression remains unclear.

Independent of cyclin D1 expression levels, several studies have identified a correlation between the A/A, A/G genotypes and an increased risk of developing cancer or decreased overall survival in various tumor types including breast, colon, head and neck, lung, and esophageal squamous cell carcinoma. As with the gene expression studies, the results between different studies are not entirely consistent (13,14,16-22) but, in general, there appears to be an association of the A allele with cancer risk and progression. Since cyclin D1b has increased oncogenicity and is believed to be preferentially expressed from the polymorphic A allele, the relationship between SNP genotype, variant expression and overall survival needs to be clarified.

In this study we have quantitatively analyzed DNA and RNA isolated from a large series of primary esophageal adenocarcinoma (EAC) and NSCLC tissues. We examine the relationships between the CCND1 G/A polymorphism, 11q13 amplification, cyclin D1, D1a or D1b expression and overall survival. We report that amplification at 11q13 has no allele bias, the G/A870 SNP does not correlate with expression of cyclin D1a or D1b and that the G/A870 genotype does not correlate with patient survival. Overall expression of cyclin D1 may be associated with survival in EAC, but not in NSCLC, and expression of individual cyclin D1 variants does not appear to be prognostic. Finally, in EAC, other genes in the 11q13 amplicon may be important drivers of tumor progression in addition to CCND1.

METHODS

Patients and Tissues

Esophageal adenocarcinoma and lung carcinoma specimens were obtained from patients treated at the University of Pittsburgh Medical Center. All patients provided informed consent and research was approved by appropriate IRBs. Patient characteristics are shown in Table 1. Tumors were snap frozen in liquid nitrogen and embedded for sectioning on a cryostat. H&E slides from each specimen underwent pathologic review to identify those with >70% tumor. 20-60, 5μM sections were then cut for nucleic acid isolation. 54 EAC samples were analyzed for genotyping, but survival information is a reflection of 39 patients. Survival data is a reflection of 68 of 89 patients for lung carcinoma specimens (Table 1).

Nucleic Acid isolation

Genomic DNA was isolated from tumor tissue using the QiaAmp DNA Mini Kit (Qiagen, Valencia, CA) according to manufacturer's protocols. Similarly, total RNA was isolated using the Stratagene RNA Isolation Kit (Stratagene, La Jolla, CA) according to manufacturer's protocols. DNA and RNA quantity and purity were determined by UV absorbance. DNA quality was assessed by gel electrophoresis and total RNA integrity was determined using the Agilent Bioanalyzer RNA nano chips. No samples were used unless the RNA integrity number was >6.0.

CCND1 genotype and allele-specific copy number analysis

DNA was analyzed by restriction fragment length polymorphism (RFLP) polymerase chain reaction (PCR) as previously described (9). Briefly, 1 ng genomic DNA was amplified by PCR under the following conditions: 10 minute initial denaturation at 95°C followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, elongation at 72°C for 30 seconds and ending with a final extension at 72 °C for 7 minutes. The 167 bp PCR products were digested for 16 hours at 37 °C followed by 20 min at 65 °C with 1 U of the ScrFI restriction endonuclease (New England Biolabs, Ipswich, MA) which recognizes the sequence 5'-CCNGG-3' when the G allele is present, but not the polymorphic A allele. Digested PCR products were then analyzed by electrophoresis on ethidium bromide stained 10% TBE criterion gels (Bio-Rad, Hercules, CA). Samples with the G/G genotype produced 2 bands (146bp and 21bp), the A/A genotype produced 1 band (167bp), and the G/A genotype produced 3 bands (167bp, 146bp, and 21bp). Genotype was determined by reference to control samples.

Genotypes of all samples were also confirmed by real time PCR using the Applied Biosystems TaqMan SNP Genotyping Assay (Assay # C_744725_1) and the TaqMan universal PCR mastermix (Applied Biosystems, Foster City, CA) according to manufacturer's protocols. Assays are designed with a single set of primers and two dual labeled probes identical in sequence, except for a single nucleotide change (G or A), labeled with either the FAM (G allele) or VIC (A allele) flourophore. Real time PCR and end point allelic discrimination reactions were performed on the ABI 7900HT PCR machine. Each sample was analyzed in two separate experiments each in triplicate (n=6). Genotype was determined by reference to control samples.

Allele-specific CCND1 copy number was determined using a variation of Quantitative Microsatellite Analysis (QuMa) as previously described (23). PCR loci for the microsatellite reference pool included D4S1605, D5S478, D12S1699, D14S988, D21S1904, and D22S922 and used previously published primer sequences (24) along with a FAM/BHQ dual labeled T(GT)10 probe.

Briefly, the Ct values for the FAM (G allele) and VIC (A allele) probes used in the TaqMan genotyping study, were averaged separately for each sample and the Ct for the pooled microsatellite reference was subtracted to obtain a delta Ct (dCt) value [dCtsample= CtFAM or VIC - Ctmicrosatellite reference]. The FAM and VIC dCt values were also determined for 16 heterozygous normal lung samples which served as the calibrator (dCtcalibrator) for copy number calculations. Each sample (including controls) was analyzed in two separate experiments, each in triplicate (n=6 for each mean Ct value). The delta delta Ct (ddCt) was then determined by subtracting the dCtcalibrator from the dCtsample for each sample and each allele [for example, ddCt(G allele) = dCtFAM Sample - mean dCtFAM Calibrator] The relative DNA copy number for each allele at the CCND1 locus was then calculated as 2-(ddct). Using this methodology, the copy number estimate for a homozygote should be approximately 2 while for a heterozygote it should be 1.

Ninety-five percent confidence intervals (CI) were then calculated for each allele using the standard deviations (SD) of the 16 FAM and 16 VIC dCt values observed in the controls. The CIs were applied separately to heterozygous and homozygous cases in order to determine statistically significant differences from 1 or 2 copies respectively.

Gene Expression analysis by reverse transcription real-time PCR

2μg of total RNA extracted from the same samples analyzed for genotyping was reverse transcribed in 100μL reactions with 1X PCR buffer, 7.5mM MgCl2, 1mM dNTP, 500μM random hexamers, 0.8U RNase Block (Stratagene, La Jolla, CA) and 0.1 U MMLV reverse transcriptase. The reaction was carried out with the following protocol: 10 minutes at 25°C, 40 minutes at 48 °C, and 5 minutes at 95 °C. The cDNA was diluted 4-fold and examined for expression of total Cyclin D1, Cyclin D1a, and Cyclin D1b in both EAC and NSCLC samples and for expression of TAOS1, TAOS2, and MYEOV in the EAC samples only. All gene expression was normalized to the endogenous control gene β-glucuronidase (GUS). The relative expression was determined using the delta Ct methods described previously (25).

Total D1 expression was analyzed using an Applied Biosystems (Applied Biosystems, Foster City, CA) Gene Expression Assays on Demand (Assay # Hs00277039_m1) with primers and probes that span exon 2-3. Cyclin D1a and D1b-specific expression were examined using a common dual labeled probe in exon 4 (5' FAMTTCCTCTCCAGAGTGATCAAGTGTGACCC-BHQ 3') and the following PCR primers: D1a-forward 5'GTCCTACTACCGCCTCACACG3', D1b-forward 5'TGAGGAGCCCCAACAACTTC3', D1a-reverse 5'TTCGATCTGCTCCTGGCAG3' and D1b-reverse 5'CCTGGGACATCACCCTCACTTA3'). Sequences for TAOS1 PCR primers and probe were previously published (24). MYEOV expression was analyzed using an Applied Biosystems Gene Expression Assays on Demand (Assay # Hs00371084_m1). TAOS2 was analyzed using the following oligonucleotides: forward primer 5'GAGCCAAAGACATCGGAATCTG3', reverse primer 5' TGAAGGAGATCACGAAGGCAT3', and a dual labeled FAM/BHQ probe 5'CTCAGAGGCATTGGGAAGCTTGCTGT 3'.

All gene qPCR assays were performed using the Universal TaqMan PCR master mix (Applied Biosystems, Foster City, CA) with appropriate primers and probes and 2μl of diluted cDNA under the following conditions:10 minute initial denaturation at 95°C followed by 45 cycles of denaturation at 95 °C for 30 seconds and annealing at 60 °C for 1 minute on an ABI 7900HT instrument (Applied Biosystems). Each sample was analyzed in two separate experiments, each in triplicate (n=6) for each gene and normalized to Gus. Average Ct was used to calculate the gene expression.

Statistical Analyses

Association of genotype (AA, AG or GG) and 11q13 amplification (positive/negative) with patient survival was explored using Kaplan-Meier overall survival curves and log-rank tests. Associations of genotype with disease stage (I/II vs III/IV), and lymph node status (positive or negative) were determined using a Chisquared test. Analysis of variance (ANOVA) was used to assess the association between 11q13 amplification and cyclin D1, cyclin D1a, cyclin D1b, MYEOV, TAOS1 and TAOS2 expression as well as between genotype and D1, D1a, and D1b expression. Association of gene expression with overall survival was estimated with Cox proportional hazards regression coefficients and by generating Kaplan-Meier survival curves based on a median split of gene expression.

RESULTS

CCND1 genotype, amplification, and survival in 54 primary EAC tumors

The genotype of CCND1 at the G/A870 SNP was examined in 54 EAC primary tumors. RFLP-PCR revealed 22 homozygous genotypes (8 A/A, 14 G/G) and 32 heterozygous (G/A) genotypes (Fig 2) and this was confirmed by TaqMan allelic discrimination assays. Allele specific copy number analysis identified amplification in 13 (24%) EAC samples with monoallelic amplification in 12 of the 13 cases. 3-16 copies of the A allele were observed in 3 A/A and 3 G/A samples. 3-19 copies of the G allele were observed in 5 G/G and 2 G/A samples. A single G/A sample demonstrated amplification (4-5 copies) of both the G and the A alleles. Neither CCND1 genotype nor amplification correlated with survival, age of onset, tumor stage, or node status (data not shown).

Figure 2. RFLP-PCR analysis of EAC samples.

Figure 2

Open in a new tab

Genomic DNA from primary EAC samples and a control samples was amplified by PCR, digested by SCRF1, and analyzed by gel electrophoresis. G/G homozygotes are represented by a single band at 146 bp, A/A homozygotes by a single band at 167 bp, and G/A heterozygotes by the presence of both bands. The 21 bp fragment can not be seen on this gel. Control samples were included in triplicate, along with the negative controls: control sample without enzyme and a no-template control. Genotypes were verified by TaqMan PCR.

Association of Cyclin D1, D1a and D1b expression with genotype and survival in EAC

Cyclin D1, D1a and D1b mRNA expression was examined by Real Time TaqMan PCR in RNA extracted from a subset of the same EAC samples (45 EAC) analyzed for genotyping. The CCND1 locus is amplified in 12 of the 45 EAC examined for D1 expression. D1a and D1b expression did not correlate with amplification (two tailed students T Test assuming equal variance, p=0.11 and p=0.37 respectively) but total D1 expression was statistically significant (p=0.035) (Fig 3A). Neither D1a nor D1b expression correlated with genotype (Fig 3B). Interestingly, high expression of total cyclin D1 appears to correlate with decreased survival (Cox regression p=0.045; Log rank p=0.077 based on a median split) but neither D1a nor D1b expression individually reached statistical significance for association with survival (Cox-regression p=0.24 and p=0.13, respectively) (Fig. 3C).

Figure 3. D1a expression does not correlate with amplification, genotype or survival in EAC.

Figure 3

Open in a new tab

RNA isolated from a subset of the same primary tumors analyzed for genotyping were examined for total D1, D1a, and D1b expression. A) CCND1 is amplified in 12 of the 45 EAC samples but only total D1 expression correlated with amplification B). CCND1 expression did not correlate with the A/A, G/A, or G/G genotypes. C). Low and high expression groups were selected based on a median split of expression observed in all samples. Only total D1 expression correlated with decreased survival.

CCND1 genotype, amplification and survival in 89 primary NSCLC tumors

The CCND1 G/A870 SNP genotype was examined in 52 adenocarcinomas (AC) and 37 squamous cell lung carcinomas (SCC). RFLP-PCR and SNP genotyping by real time PCR revealed 44 homozygous genotypes (6 A/A, 15 G/G in the AC and 10 A/A, 13 G/G in the SCC) and 45 (31 AC and 14 SCC) heterozygous G/A genotypes (data not shown). CCND1 allele specific copy number changes determined by QuMa demonstrated monoallelic gene amplification (>2 copies) in 17 (19%) NSCLC samples. 3-22 copies of the A allele were observed in 6 A/A (3 AC and 3 SCC) and 2 G/A (both AC) samples. 3-12 copies of the G allele were observed in 9 G/G (4 AC and 5 SCC). No amplifications of the G allele were observed in the heterozygous G/A genotype. Similar to EAC, neither CCND1 genotype nor amplification correlated with survival, early age of onset, tumor stage, or node status (data not shown).

CCND1 amplification, G/A870 genotype and expression of Cyclin D1a and D1b in NSCLC

Cyclin D1, D1a, and D1b mRNA expression, was examined in a subset of the same NSCLC samples (40 AC and 29 SCC) analyzed for genotyping. The CCND1 locus is amplified in 12 of these 69 NSCLC samples but increased Cyclin D1 was not observed in samples with amplification (Figure 4A). Similar to results in EAC, neither D1a nor D1b expression correlated with genotype (Fig 4B). Furthermore total Cyclin D1, D1a and D1b expression did not significantly correlate with survival (Fig. 4C).

Figure 4. CCND1 expression does not correlate with amplification, genotype or survival in NSCLC.

Figure 4

Open in a new tab

RNA isolated from a subset of the same primary tumors analyzed for genotyping were examined for total D1, D1a, and D1b expression. CCND1 did not correlate with amplification (A) genotype (B) or survival (C) in NSCLC. In panel C, low and high expression groups were selected based on a median split of expression observed in all samples.

Other genes in the 11q13 amplicon are over expressed in EAC and correlate with survival

The 11q13 amplicon is a gene rich region. Previously published reports have demonstrated TAOS1, TAOS2, and MYEOV overexpression in breast, head and neck and esophageal squamous cell carcinoma samples with genomic amplification (24,26,27). Therefore, we analyzed expression of TAOS1, TAOS2, and MYEOV in the same 45 EAC RNAs examined for CCND1 expression. TAOS1 and MYEOV expression were statistically correlated with amplification (two tailed students T Test assuming equal variance, p=0.0061 and p=0.012 respectively) whereas TAOS2 was borderline (p=0.074) (Fig 5A). Interestingly, neither TAOS1 nor MYEOV expression correlated significantly with survival (Cox regression p=0.12 and p=0.56, respectively) but high expression of TAOS2 was associated with decreased survival (Cox regression p=0.030; log-rank p=0.045 based on a median split) (Fig 5B).

Figure 5. Expression of other genes on 11q13 amplicon correlate with amplification or survival in EAC.

Figure 5

Open in a new tab

MYEOV, TAOS1, and TAOS2 expression were analyzed in the sample RNA for total D1, D1a, and D1b expression. A) MYEOV and TAOS1 correlate with amplification but TAOS2 did not. B) Although high expression of all genes trended towards decreased survival, only high expression of TAOS2 expression correlated significantly with decreased survival. Low and high expression groups were selected based on a median split of expression observed in all samples.

DISCUSSION

CCND1 is encoded by 5 exons and 4 introns and over 100 SNPs have been identified in this genomic region. Although none of these SNPs result in amino acid substitutions the G/A transition at nucleotide 870 is thought to affect CCND1 expression because it occurs at the final intron/exon boundary and may alter recognition of the exon 4 splice donor site (28). It has been reported that the A allele at this SNP may be correlated with both increased risk of carcinoma and poor patient outcome, although these reports are somewhat inconsistent. However, the literature also provides a possible biological rationale for an association of the A allele with clinical endpoints. It has been reported that the A allele may result in increased expression of a cyclin D1 variant (cyclin D1b) with increased oncogenic potential. While cyclin D1a (the full length isoform typically referred to as cyclin D1) encodes all 5 exons, D1b is homologous through exon 4, but lacks the fifth and final exon and instead contains part of intron 4 and a different 3' UTR (Fig 1). Theoretically, the AA genotype and/or amplification of an A allele in tumors would result in higher expression of cyclin D1b thus increasing cancer risk and resulting in a more aggressive disease. So far however, these hypotheses have never been fully examined.

Cyclin D1 variant expression and association with the G/A870 polymorphism was originally examined in 9 heterozygous NSCLC samples. This data indicated that D1a was preferentially expressed from the G allele and D1b from the A allele (9). Subsequently, a similar finding was reported in 3 head and neck squamous cell carcinoma samples (13). However, a study in lymphoma found that the A allele gave rise to the D1a transcript and conversely, the G allele was the major source of D1b expression (15). These contradictory results could suggest tissue specific or tumor type differences but in a 2007 review article, analysis of 48 NSCLC failed to demonstrate a correlation between the genotype and D1 isoform expression and the data supporting this was not shown leaving questions about the relationship between the G/A870 SNP and D1a or D1b expression (14).

In this study, we analyzed genotype, allele-specific amplification, cyclin D1 variant expression levels and patient survival in 54 EAC and 89 NSCLC specimens. We found that CCND1 was amplified in 24% of EAC samples and 19% of NSCLC samples but no allele-specific amplification bias was observed. Furthermore, we did not see any association of genotype with patient survival in either tumor type. We observed that, for the most part, samples with amplified CCND1 exhibited increased total cyclin D1 mRNA expression, but neither D1a nor D1b levels individually were significantly elevated in amplified samples. Furthermore, neither D1a nor D1b expression correlated with genotype or with survival. Interestingly, increased total D1 expression did correlate with survival in EAC, but not in NSCLC. This may suggest a tissue specific effect of CCND1 expression. It may also be that total cyclin D1 expression is more important in terms of tumor development and progression than either of the individual variants alone.

Currently, studies in multiple tumor types have examined the impact of the G/A870 polymorphism on cancer risk and survival. While several studies in breast (17), head and neck (20), and colorectal cancers (18) have implicated the A/A or A/G genotype with increased risk of carcinoma, other studies in the very same tumor types have implicated the G/G genotype with increased risk of carcinoma (13,19) or have found no effect of the polymorphism (16,21). In EAC, the A/A genotype was associated with increased risk of carcinoma in one study (29) but not in another (30) and increased D1 protein correlated with poor overall survival of patients (31). While we cannot assess cancer risk in our study, we were unable to find a correlation between genotype and survival. Furthermore, if one allele provides an advantage to the tumor, then one may anticipate an allele-specific bias in amplification of the CCND1 locus in tumors, but none was observed. The discrepancy in results between different studies could be due to several factors. First, a disparity in allelic distribution exists between ethnic populations (12) suggesting that the polymorphism affects the populations differently and large, multiethnic studies are needed to investigate the effect of the polymorphic allele on survival (10). Given the near equal frequency of the polymorphism (approximately 42% A and 58% G), it is difficult for this SNP alone to be an effective predictor of a complex multistage disease. In addition, the G/A870 SNP may be in linkage disequilibrium with a C/G SNP at position 1722 in D1, since patients with A870 most likely carry C1722 as well (13). It is possible that the G/A870 polymorphism is an effective predictor of prognosis or risk only when additional factors, such as a second polymorphism, are taken into account (10,13,17).

Another possible reason for the lack of consensus in studies is that we may not have a complete picture of the regulation of the transcripts generated from the CCND1 locus. Previously, Northern blot analysis of CCND1 revealed 2 transcripts: a 4.2-4.8 kb transcript and a 1.3-1.7 kb transcript. Cloning and sequencing of the transcripts revealed that while they both contained exons 1-5, the shorter transcript terminated 0.2 kb downstream of the stop codon (32,33) whereas the longer transcript terminated approximately 3000bp downstream, thus accounting for the difference observed on Northerns. Recently, a similar short cyclin D1a transcript, associated with longer mRNA half-life, increased proliferation, and shorter length of patient survival, was reported in mantle cell lymphoma (34). Although this transcript was polyadenylated it was suggested that no polyadenylation-like signals could be found (9,34). However, examination of exon 5 does in fact reveal an “AATAAT” polyadenylation-like signal approximately 300 bases downstream of the TGA stop codon (Fig. 1). Thus it seems likely that the transcript observed in mantle cell lymphoma may be a naturally occurring variant. Given its apparent difference in half-life, and its impact on proliferation and survival, this short version of CCND1a deserves more investigation. In addition, examination of intron 4 revealed 2 polyadenylation-like signals: one about 300 bases (“AATAAA”) after the stop codon utilized in cyclin D1b and the other approximately 3000 bases (“TATAAA”) later (Fig. 1). Similar to northern blots of D1a, 2 transcripts have also been reported for D1b, differing by approximately 3kb in size (9). Thus both cyclin D1a and D1b appear to have long and short transcripts which differ in their 3' UTRs underscoring the complexity of D1a and D1b gene expression and possible function.

It has been reported that D1 is overexpressed in a wide variety of cancers, but overexpression alone does not result in cellular transformation or tumorigenesis (35-38). It has been assumed that cyclin D1 overexpression promotes tumorigenesis through its role in proliferation (39,40). Although it is clearly involved in cell cycle progression, studies examining tumor samples with increased D1 expression did not find increased cell cycle activity (hyperphorphorlation of RB, increased proliferation) in tumor samples (41,42). Thus it is likely that cyclin D1 may have other, less understood roles in cell function and may exert its actions through CDK independent activities, as demonstrated by D1 mutants incapable of activating CDK 4/6 (43). Furthermore, recent data suggests that D1a and D1b may have differing roles in cell cycle function. D1b may have cell cycle independent activities (38). Additionally, D1b has been shown to have an inverse role from D1a or no activity at all in the cell cycle (44,45). Understanding D1a and D1b's activities is important to understanding their role in tumorigenesis and to D1 serving as a useful prognostic or therapeutic target. Current CDK4/6 small molecule inhibitors that target tumor cells with kinase activity and wild type Rb may not be useful in patients with higher expression of D1b if D1b acts in an inverse manner to D1a (10,46).

Finally, the impact of 11q13 amplification may not be limited to expression of a single gene. The 11q13 amplicon core contains more than 10 known genes (including MYEOV, TAOS1, TAOS2, FGF3, and FGF4) with CCND1 being the most consistently studied. Recently however TAOS1 expression was found to be more dependent on copy number than CCND1 in oral squamous cell carcinoma cell lines (24). In addition, MYEOV has been shown to be co-amplified with CCND1 (26,27). We examined the expression of these two genes and found that both correlated with 11q13 amplification, but did not correlate with survival. We also examined the expression of TAOS2 and were surprised to find that although it did not correlate with amplification, high expression correlated with decreased overall survival. Thus TAOS1 and MYEOV appear to be regulated by gene copy number whereas TAOS2 expression is not. This is similar to findings in oral squamous cell carcinoma where TAOS2 was reported to be the only gene that was consistently overexpressed in samples without 11q13 amplification, suggesting other mechanisms of regulation of expression (24). Although the functions of MYEOV, TAOS1, and TAOS2 are currently unknown, their correlation with amplification or survival suggests that they, along with CCND1, may play a role in EAC tumorigenesis.

A
  
Esophageal Carcinoma No. of patients
Histology
Adeno 54
Sex
Male 47
Female 7
N-Stage
N0 28
N1 26
T- Stage
T1 23
T2 8
T3 20
T4 3
Overall Stage
I 17
II 17
III 16
IV 4
Unknown 0
Age (Years)
Median 71.1
Range 43.5- 83.5
Follow Up (Months)
Median 21.8
Range 2.2-55.4
Open in a new tab
B
  
Lung Carcinoma No. of patients
Histology
Adeno 51
Squamous 37
NSCLC 1
Sex
Male 45
Female 44
N-Stage
N0 55
N1 21
N2 11
Unknown 2
T- Stage
T1 29
T2 54
T3 4
T4 2
Overall Stage
I 50
II 18
III 18
IV 1
Unknown 2
Age (Years)
Median 68
Range 42.5-85.8
Follow Up (Months)
Median 23.7
Range 0.6-55.2
Open in a new tab

Acknowledgments

This work is supported by a Ruth L. Kirschstein National Research Service Award (VKG), NIH R01 CA090665-05 (JDL) and NIH R01 CA90665-01 (TEG).

Footnotes

Statement of Clinical Relevance Cyclin D1 is an oncogene that is frequently amplified and overexpressed in many tumor types. It has been suggested that Cyclin D1 amplification, expression and genotype at a specific single nucleotide polymorphism (G/A870) may be associated with cancer risk and patient outcome. Cyclin D1 genotype has also been associated with expression of two different cyclin D1 isoforms; D1a and D1b. However the clinical relevance of cyclin D1 amplification, genotype and D1a and D1b expression has never been systematically explored. We find that the genotype of Cyclin D1 does not impact isoform expression and does not appear to be a marker of prognosis. The association of the G/A870 SNP with cancer risk does not therefore appear to be a result of increased Cyclin D1b expression. Total Cyclin D1 expression does however appear to be associated with survival in esophageal cancer but not in lung cancer. In addition, expression of several other genes at the 11q13 locus appears to correlate with amplification and decreased patient survival. Examination of the expression of several genes in this chromosomal region may therefore be more effective as prognostic markers than cyclin D1 expression or genotype alone.

References

  • 1.Nowell PC. The clonal evolution of tumor cell populations. Science. 1976;194:23–8. doi: 10.1126/science.959840. [DOI] [PubMed] [Google Scholar]
  • 2.Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57–70. doi: 10.1016/s0092-8674(00)81683-9. [DOI] [PubMed] [Google Scholar]
  • 3.Schwab M. Amplification of oncogenes in human cancer cells. Bioessays. 1998;20:473–9. doi: 10.1002/(SICI)1521-1878(199806)20:6<473::AID-BIES5>3.0.CO;2-N. [DOI] [PubMed] [Google Scholar]
  • 4.Dickson C, Fantl V, Gillett C, et al. Amplification of chromosome band 11q13 and a role for cyclin D1 in human breast cancer. Cancer Lett. 1995;90:43–50. doi: 10.1016/0304-3835(94)03676-a. [DOI] [PubMed] [Google Scholar]
  • 5.Gollin SM. Chromosomal alterations in squamous cell carcinomas of the head and neck: window to the biology of disease. Head Neck. 2001;23:238–53. doi: 10.1002/1097-0347(200103)23:3<238::aid-hed1025>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
  • 6.Xu J, Tyan T, Cedrone E, Savaraj N, Wang N. Detection of 11q13 amplification as the origin of a homogeneously staining region in small cell lung cancer by chromosome microdissection. Genes Chromosomes Cancer. 1996;17:172–8. doi: 10.1002/(SICI)1098-2264(199611)17:3<172::AID-GCC5>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
  • 7.Schuuring E. The involvement of the chromosome 11q13 region in human malignancies: cyclin D1 and EMS1 are two new candidate oncogenes--a review. Gene. 1995;159:83–96. doi: 10.1016/0378-1119(94)00562-7. [DOI] [PubMed] [Google Scholar]
  • 8.Dickson C, Fantl V, Gillett C, et al. Amplification of chromosome band 11q13 and a role for cyclin D1 in human breast cancer. Cancer Lett. 1995;90:43–50. doi: 10.1016/0304-3835(94)03676-a. [DOI] [PubMed] [Google Scholar]
  • 9.Betticher DC, Thatcher N, Altermatt HJ, et al. Alternate splicing produces a novel cyclin D1 transcript. Oncogene. 1995;11:1005–11. [PubMed] [Google Scholar]
  • 10.Knudsen KE, Diehl JA, Haiman CA, Knudsen ES. Cyclin D1: polymorphism, aberrant splicing and cancer risk. Oncogene. 2006;25:1620–8. doi: 10.1038/sj.onc.1209371. [DOI] [PubMed] [Google Scholar]
  • 11.Lu F, Gladden AB, Diehl JA. An alternatively spliced cyclin D1 isoform, cyclin D1b, is a nuclear oncogene. Cancer Res. 2003;63:7056–61. [PubMed] [Google Scholar]
  • 12.Solomon DA, Wang Y, Fox SR, et al. Cyclin D1 splice variants. Differential effects on localization, RB phosphorylation, and cellular transformation. J Biol Chem. 2003;278:30339–47. doi: 10.1074/jbc.M303969200. [DOI] [PubMed] [Google Scholar]
  • 13.Holley SL, Matthias C, Jahnke V, et al. Association of cyclin D1 polymorphism with increased susceptibility to oral squamous cell carcinoma. Oral Oncol. 2005;41:156–60. doi: 10.1016/j.oraloncology.2004.08.005. [DOI] [PubMed] [Google Scholar]
  • 14.Gautschi O, Ratschiller D, Gugger M, Betticher DC, Heighway J. Cyclin D1 in non-small cell lung cancer: a key driver of malignant transformation. Lung Cancer. 2007;55:1–14. doi: 10.1016/j.lungcan.2006.09.024. [DOI] [PubMed] [Google Scholar]
  • 15.Howe D, Lynas C. The cyclin D1 alternative transcripts [a] and [b] are expressed in normal and malignant lymphocytes and their relative levels are influenced by the polymorphism at codon 241. Haematologica. 2001;86:563–9. [PubMed] [Google Scholar]
  • 16.Krippl P, Langsenlehner U, Renner W, et al. The 870G>A polymorphism of the cyclin D1 gene is not associated with breast cancer. Breast Cancer Res Treat. 2003;82:165–8. doi: 10.1023/B:BREA.0000004372.20461.33. [DOI] [PubMed] [Google Scholar]
  • 17.Shu XO, Moore DB, Cai Q, et al. Association of cyclin D1 genotype with breast cancer risk and survival. Cancer Epidemiol Biomarkers Prev. 2005;14:91–7. [PubMed] [Google Scholar]
  • 18.Le ML, Seifried A, Lum-Jones A, Donlon T, Wilkens LR. Association of the cyclin D1 A870G polymorphism with advanced colorectal cancer. JAMA. 2003;290:2843–8. doi: 10.1001/jama.290.21.2843. [DOI] [PubMed] [Google Scholar]
  • 19.Hong Y, Eu KW, Seow-Choen F, Fook-Chong S, Cheah PY. GG genotype of cyclin D1 G870A polymorphism is associated with increased risk and advanced colorectal cancer in patients in Singapore. Eur J Cancer. 2005;41:1037–44. doi: 10.1016/j.ejca.2005.01.009. [DOI] [PubMed] [Google Scholar]
  • 20.Zheng Y, Shen H, Sturgis EM, et al. Cyclin D1 polymorphism and risk for squamous cell carcinoma of the head and neck: a case-control study. Carcinogenesis. 2001;22:1195–9. doi: 10.1093/carcin/22.8.1195. [DOI] [PubMed] [Google Scholar]
  • 21.Wong YK, Lin SC, Chang CS, et al. Cyclin D1 genotype in areca-associated oral squamous cell carcinoma. J Oral Pathol Med. 2003;32:265–70. doi: 10.1034/j.1600-0714.2003.00131.x. [DOI] [PubMed] [Google Scholar]
  • 22.Zhang J, Li Y, Wang R, et al. Association of cyclin D1 (G870A) polymorphism with susceptibility to esophageal and gastric cardiac carcinoma in a northern Chinese population. Int J Cancer. 2003;105:281–4. doi: 10.1002/ijc.11067. [DOI] [PubMed] [Google Scholar]
  • 23.Ginzinger DG, Godfrey TE, Nigro J, et al. Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis. Cancer Res. 2000;60:5405–9. [PubMed] [Google Scholar]
  • 24.Huang X, Gollin SM, Raja S, Godfrey TE. High-resolution mapping of the 11q13 amplicon and identification of a gene, TAOS1, that is amplified and overexpressed in oral cancer cells. Proc Natl Acad Sci U S A. 2002;99:11369–74. doi: 10.1073/pnas.172285799. %20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tassone F, Hagerman RJ, Taylor AK, et al. Elevated Levels of FMR1 mRNA in Carrier Males: A New Mechanism of Involvement in the Fragile-X Syndrome. Am J Hum Genet. 2000;66:6–15. doi: 10.1086/302720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Janssen JW, Imoto I, Inoue J, et al. MYEOV, a gene at 11q13, is coamplified with CCND1, but epigenetically inactivated in a subset of esophageal squamous cell carcinomas. J Hum Genet. 2002;47:460–4. doi: 10.1007/s100380200065. [DOI] [PubMed] [Google Scholar]
  • 27.Janssen JW, Cuny M, Orsetti B, et al. MYEOV: a candidate gene for DNA amplification events occurring centromeric to CCND1 in breast cancer. Int J Cancer. 2002;102:608–14. doi: 10.1002/ijc.10765. %20. [DOI] [PubMed] [Google Scholar]
  • 28.Knudsen KE, Diehl JA, Haiman CA, Knudsen ES. Cyclin D1: polymorphism, aberrant splicing and cancer risk. Oncogene. 2006;25:1620–8. doi: 10.1038/sj.onc.1209371. [DOI] [PubMed] [Google Scholar]
  • 29.Casson AG, Zheng Z, Evans SC, et al. Cyclin D1 polymorphism (G870A) and risk for esophageal adenocarcinoma. Cancer. 2005;104:730–9. doi: 10.1002/cncr.21229. [DOI] [PubMed] [Google Scholar]
  • 30.Geddert H, Kiel S, Zotz RB, et al. Polymorphism of p16 INK4A and cyclin D1 in adenocarcinomas of the upper gastrointestinal tract. J Cancer Res Clin Oncol. 2005;131:803–8. doi: 10.1007/s00432-005-0021-4. [DOI] [PubMed] [Google Scholar]
  • 31.Izzo JG, Wu TT, Wu X, et al. Cyclin D1 guanine/adenine 870 polymorphism with altered protein expression is associated with genomic instability and aggressive clinical biology of esophageal adenocarcinoma. J Clin Oncol. 2007;25:698–707. doi: 10.1200/JCO.2006.08.0283. %20. [DOI] [PubMed] [Google Scholar]
  • 32.Lebwohl DE, Muise-Helmericks R, Sepp-Lorenzino L, et al. A truncated cyclin D1 gene encodes a stable mRNA in a human breast cancer cell line. Oncogene. 1994;9:1925–9. [PubMed] [Google Scholar]
  • 33.Xiong Y, Connolly T, Futcher B, Beach D. Human D-type cyclin. Cell. 1991;65:691–9. doi: 10.1016/0092-8674(91)90100-d. [DOI] [PubMed] [Google Scholar]
  • 34.Wiestner A, Tehrani M, Chiorazzi M, et al. Point mutations and genomic deletions in CCND1 create stable truncated cyclin D1 mRNAs that are associated with increased proliferation rate and shorter survival. Blood. 2007;109:4599–606. doi: 10.1182/blood-2006-08-039859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Benzeno S, Lu F, Guo M, et al. Identification of mutations that disrupt phosphorylation-dependent nuclear export of cyclin D1. Oncogene. 2006;25:6291–303. doi: 10.1038/sj.onc.1209644. [DOI] [PubMed] [Google Scholar]
  • 36.Hinds PW, Mittnacht S, Dulic V, et al. Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell. 1992;70:993–1006. doi: 10.1016/0092-8674(92)90249-c. [DOI] [PubMed] [Google Scholar]
  • 37.Quelle DE, Ashmun RA, Shurtleff SA, et al. Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev. 1993;7:1559–71. doi: 10.1101/gad.7.8.1559. [DOI] [PubMed] [Google Scholar]
  • 38.Alt JR, Gladden AB, Diehl JA. p21(Cip1) Promotes cyclin D1 nuclear accumulation via direct inhibition of nuclear export. J Biol Chem. 2002;277:8517–23. doi: 10.1074/jbc.M108867200. [DOI] [PubMed] [Google Scholar]
  • 39.Alao JP. The regulation of cyclin D1 degradation: roles in cancer development and the potential for therapeutic invention. Mol Cancer. 2007;6(24):24. doi: 10.1186/1476-4598-6-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Diehl JA. Cycling to cancer with cyclin D1. Cancer Biol Ther. 2002;1:226–31. doi: 10.4161/cbt.72. [DOI] [PubMed] [Google Scholar]
  • 41.Oyama T, Kashiwabara K, Yoshimoto K, Arnold A, Koerner F. Frequent overexpression of the cyclin D1 oncogene in invasive lobular carcinoma of the breast. Cancer Res. 1998;58:2876–80. [PubMed] [Google Scholar]
  • 42.Zukerberg LR, Benedict WF, Arnold A, et al. Expression of the retinoblastoma protein in low-grade B-cell lymphoma: relationship to cyclin D1. Blood. 1996;88:268–76. [PubMed] [Google Scholar]
  • 43.Lamb J, Ramaswamy S, Ford HL, et al. A mechanism of cyclin D1 action encoded in the patterns of gene expression in human cancer. Cell. 2003;114:323–34. doi: 10.1016/s0092-8674(03)00570-1. [DOI] [PubMed] [Google Scholar]
  • 44.Leveque C, Marsaud V, Renoir JM, Sola B. Alternative cyclin D1 forms a and b have different biological functions in the cell cycle of B lymphocytes. Exp Cell Res. 2007;313:2719–29. doi: 10.1016/j.yexcr.2007.04.018. [DOI] [PubMed] [Google Scholar]
  • 45.Sawa H, Ohshima TA, Ukita H, et al. Alternatively spliced forms of cyclin D1 modulate entry into the cell cycle in an inverse manner. Oncogene. 1998;16:1701–12. doi: 10.1038/sj.onc.1201691. [DOI] [PubMed] [Google Scholar]
  • 46.Fry DW, Harvey PJ, Keller PR, et al. Specific inhibition of cyclin-dependent kinase 4/6 by PD 0332991 and associated antitumor activity in human tumor xenografts. Mol Cancer Ther. 2004;3:1427–38. [PubMed] [Google Scholar]

RESOURCES