Skip to main content
Clinical and Vaccine Immunology: CVI logoLink to Clinical and Vaccine Immunology: CVI
. 2009 Jun 10;16(8):1139–1145. doi: 10.1128/CVI.00424-08

T-Cell mRNA Expression in Response to Mycobacterium bovis BCG Vaccination and Mycobacterium bovis Infection of White-Tailed Deer▿

Tyler C Thacker 1,*, Mitchell V Palmer 1, W Ray Waters 1
PMCID: PMC2725541  PMID: 19515866

Abstract

Understanding immune responses of white-tailed deer (WTD) to infection with Mycobacterium bovis provides insight into mechanisms of pathogen control and may provide clues to development of effective vaccine strategies. WTD were vaccinated with either M. bovis BCG strain Pasteur or BCG strain Danish. Both vaccinees and unvaccinated controls were subsequently inoculated with virulent M. bovis via the intratonsillar route. Real-time PCR was used to assess T-cell mRNA expression in peripheral blood leukocytes (PBL) from animals following vaccination and infection. Recall T-cell responses were measured by assessing the relative expression of gamma interferon (IFN-γ), T-cell-specific T-box transcription factor (Tbet), interleukin 12p40 (IL-12p40), IL-12p35, IL-23p19, FoxP3, IL-17, and GATA3 in PBL stimulated in vitro with purified protein derivative (PPD) of M. bovis or a recombinant fusion protein, ESAT6-CFP10. Animals vaccinated with BCG Danish expressed more IFN-γ and Tbet than either BCG Pasteur-vaccinated animals or unvaccinated controls. BCG Pasteur-vaccinated animals expressed more GATA3 than either group. After infection, unvaccinated controls expressed more Tbet and IL-12p40 than vaccinated animals. BCG Pasteur-vaccinated animals expressed more GATA3 than either the unvaccinated controls or the BCG Danish-vaccinated animals after infection. Animals were divided into pathology groups to correlate gene expression with severity of pathology. Animals in the visible lesion group expressed more Tbet and IFN-γ than animals that were culture negative, while Tbet and IFN-γ expression in the culture-positive, no-visible-lesion group was intermediate. GATA3 expression inversely correlated with pathology. Overall, expression of immune response genes correlated more closely with pathology than vaccination treatment.


A self-sustaining outbreak of Mycobacterium bovis in free-ranging white-tailed deer ([WTD] Odocoileus virginianus) has occurred in Michigan (36, 37). Epidemiological and strain typing evidence suggests that infected WTD serve as a reservoir since interspecies transmission from deer to cattle occurs (21, 25, 29). In Minnesota, infected WTD have been found adjacent to infected cattle (http://www.bah.state.mn.us/tb/). It is not yet known if the 18 infected deer (from 2005 to 2008) represent a self-sustaining outbreak. Control of these wildlife reservoirs may be critical to preventing continued infection of domestic cattle. In Michigan, efforts to control tuberculosis (TB) in free-ranging WTD through removal of WTD and through changes in management practices, while providing some benefit, have not yet proven effective in eliminating the reservoir (22). Similar experiences have occurred in other areas of the world where a wildlife reservoir exists (6, 7). Development of an effective vaccine may provide a significant tool for eradication of M. bovis from the free-ranging WTD population.

Immunological responses of WTD and other ruminants to M. bovis infection appear to be complex. The adaptive immune response is believed to be primarily responsible for immunity to M. bovis infection. Specific T-cell responses have been roughly divided into four types: T-helper type 1 (TH1), TH2, TH17, and regulatory T cells (Treg). Each of these responses has been reported to play a role in M. bovis immunity or pathology. TH1 responses, characterized by gamma interferon (IFN-γ) expression, are required for effective immune responses to mycobacteria (4, 9). However, IFN-γ expression does not correlate with protection in mice (8, 19), deer (42), or cattle (41, 44). Two closely related cytokines, interleukin-12 (IL-12) and IL-23, mediate TH1 and TH17 responses, respectively (13). The proinflammatory TH17 cells produce IL-17 in response to antigens; these cells are implicated in inflammatory diseases such as experimental autoimmune encephalomyelitis (15) and have been implicated in playing a role in TB (13). In mice, IL-17 is not required for initial clearance of M. bovis BCG but is required for protection after challenge with M. tuberculosis (12), suggesting that IL-17 may be important in long-term immunity to mycobacteria.

TH2 responses are implicated in poor prognosis relative to TB (31, 33, 38, 47), presumably by interfering with TH1-mediated responses. In the murine model, blocking IL-4 in vivo results in decreased bacterial burden, suggesting that TH2 responses are detrimental to mycobacterial control (35). A similar detrimental role for IL-4 has been suggested from studies in humans where IL-4 and IL-13 mRNA expression correlate with disease severity (32, 38). In addition to TH2, Treg responses are implicated in limiting protective immunity (5, 10, 16). Treg frequency is increased in peripheral blood and sites of infection in TB patients and correlates with disease severity (10, 16).

Vaccination of WTD with the M. bovis BCG strain Danish (20) or BCG strain Pasteur (23) has been shown to be efficacious as measured by a reduction in pathology (24). To determine T-cell-mediated responses induced by vaccination with these BCG strains and to correlate these responses to protection/pathology, WTD were vaccinated with either BCG Danish or BCG Pasteur and subsequently infected with virulent M. bovis. Sixteen weeks after vaccination and then 16 weeks after infection, gene expression was measured in isolated peripheral blood leukocytes (PBL) stimulated with either purified protein derivative (PPD) of M. bovis or the recombinant fusion protein ESAT6 (early secreted antigenic target 6-kDa protein)-CFP10 (culture filtrate 10-kDa protein). ESAT6-CFP10 was evaluated because it is one of the dominant T-cell antigen proteins produced by M. bovis (1, 30, 40) and has been used to increase diagnostic test specificity (45, 46). TH1 responses were evaluated using the T-cell-specific T-box transcription factor (Tbet), IFN-γ, and IL-12p35. TH2 responses were evaluated by measuring transcription of GATA binding protein 3 transcription factor (GATA3), IL-4, and IL-10. TH17 responses were evaluated using IL-17, and IL-23p19 mRNA and Treg responses were evaluated using the transcription factor Forkhead box P3 (FoxP3).

MATERIALS AND METHODS

Animals, vaccination, and challenge.

Thirty-five WTD (∼1 year old) were obtained from a captive breeding herd (TB and paratuberculosis free) at the National Animal Disease Center (Ames, IA). All deer were housed and cared for according to institutional guidelines, and procedures were approved by the Institutional Animal Care and Use Committee prior to the beginning of the experiment. Deer were randomly assigned to one of three groups: a group receiving one subcutaneous dose of 107 CFU of M. bovis BCG Pasteur (n = 12), a group receiving one subcutaneous dose of 107 CFU of M. bovis BCG Danish (n = 11), or a group of unvaccinated deer (n = 12). After 120 days deer received intratonsillar inoculations of approximately 495 CFU of M. bovis strain 95-1315 into each tonsillar crypt, for a total dose of 990 CFU, as described previously (28).

Strain 95-1315 used for challenge was originally isolated from a free-ranging, naturally infected WTD in Michigan. For inoculation, deer were anesthetized by intramuscular injection of a combination of xylazine (2 mg/kg of body weight) (Mobay Corporation, Shawnee, KS) and ketamine (6 mg/kg) (Fort Dodge Laboratories, Fort Dodge, IA). After inoculation, the effects of xylazine were reversed by intravenous injection of tolazoline (4 mg/kg) (Lloyd Laboratories, Shanandoah, IA). Vaccinated and unvaccinated deer were housed together in an outdoor paddock prior to challenge with virulent M. bovis, at which time they were moved to an appropriate biosecurity level 3 animal facility. Deer were fed a commercial pelleted feed with free access to water.

The M. bovis BCG strains as well as the challenge strain M. bovis 95-1315 was grown in Middlebrook's 7H9 medium supplemented with 10% oleic acid-albumin-dextrose complex (Difco, Detroit, MI) plus 0.05% Tween 80 (Sigma Chemical Co., St. Louis, MO), as described previously (2). Mid-log-phase growth bacilli were pelleted by centrifugation at 750 × g, washed twice with phosphate-buffered saline (0.01 M; pH 7.2), and diluted to the appropriate cell density in 2 ml of phosphate-buffered saline. Bacilli were enumerated by serial dilution plate counting on Middlebrook 7H11 selective medium (Becton Dickinson, Cockeysville, MD).

Necropsy and tissue sampling.

At 130 days postchallenge with virulent M. bovis, all deer were euthanized by intravenous sodium pentobarbital. At necropsy, the following tissues or fluids were collected and processed for isolation of M. bovis and microscopic analysis as described previously (26): palatine tonsil, lung, liver, and the mandibular, parotid, medial retropharyngeal, tracheobronchial, mediastinal, hepatic, mesenteric, and prefemoral lymph nodes. Tissues were processed for isolation of M. bovis as previously described (27). Isolates of M. bovis were identified by colony morphology, growth, and biochemical characteristics as well as by PCR.

Leukocyte preparation and culture.

Total PBL were prepared from the buffy coat fraction of blood collected in the anticoagulant acid-citrate-dextrose at 16 weeks after vaccination (prior to infection) and 16 weeks after infection (32 weeks after vaccination). Contaminating red blood cells were removed by hypotonic lysis as described previously (11, 34). PBL were seeded into 96-well round-bottom microtiter plates (Falcon, Becton-Dickinson; Lincoln Park, NJ) at 1 × 106 cells in a total volume of 200 μl of complete RPMI medium (RPMI 1640 medium with 2 mM l-glutamine, 25 mM HEPES buffer, 100 units/ml penicillin, 0.1 mg/ml streptomycin, 1% nonessential amino acids [Sigma, St. Louis, MO], 2% essential amino acids [Sigma], 1% sodium pyruvate [Sigma], 50 μM 2-mercaptoethanol [Sigma], and 10% [vol/vol] fetal bovine serum). Wells contained medium alone (nil stimulated) or either 10 μg/ml M. bovis PPD or 10 μg/ml ESAT6-CFP10. PPD was obtained from CSL Animal Health, Parkville, Victoria, Australia, and ESAT6-CFP10 was kindly provided by F. Chris Minion. Cultures were incubated at 37°C in a 5% CO2 atmosphere for 16 h.

Isolation and reverse transcription of leukocyte RNA.

Isolation and reverse transcription of PBL RNA were performed as previously described (42). Briefly, cells were harvested by centrifugation, lysed with 150 μl of buffer RLT (Qiagen, Valencia, CA), and stored at −80°C. RNA was isolated using an RNeasy Mini Kit (Qiagen) according to the manufacturer's directions and eluted from the column with 50 μl of RNase-free water (Ambion, Austin, TX). Contaminating DNA was enzymatically removed by treating RNA with DNA-free (Ambion). Twenty microliters of RNA was reverse transcribed in a 50-μl reaction mixture using SuperScript II (Invitrogen, Carlsbad, CA) with 0.5 μg of oligo(dT)12-18 and 40 units of RNaseOut (Invitrogen), according to the manufacturer's directions. Samples were heated to 70°C for 5 min and then reverse transcribed at 42°C for 60 min. The resulting cDNA was stored at −80°C until used in real-time PCRs.

Analysis of cytokine gene expression by real-time PCR.

Real-time PCR was performed using SYBR green Master Mix (Applied Biosystems, Foster City, CA) according to the manufacturer's directions. Briefly, 2.5 μl of cDNA was added to a 25-μl reaction mixture with 1 μM of each primer. Primers used were designed using bovine sequences with Primer3Plus (43) and then sequenced to ensure correct design. The following primer pairs were used: FoxP3 Forward, TACGGGGCTCTTCTCTCTCA; FoxP3 Reverse, ACAGTCGAAAGGGTGCTGTC; GATA-3 Forward, AACCGGGCATTACCTGTGTA; GATA-3 Reverse, AGGACGTACCTGCCCTTCTT; IL-12p35 Forward, TGACAACCCTGTGCCTTAAA; IL-12p35 Reverse, CCTGCATCAGCTCAGCAATA; IL-23p19 Forward, TCACAGGGGAGCCTTCTCTA; IL-23p19 Reverse, AGTTCCCTGAGGCCCAGTAT; IL-17 Forward, CACAGCATGTGAGGGTCAAC; IL-17 Reverse, GGTGGAGCGCTTGTGATAAT; T-bet Forward, CCTGGACCCAACTGTCAACT; T-bet Reverse, GGTAGAAACGGCTGGAGATG. Primers for IFN-γ, IL-12p40, IL-4, and IL-10 were as described previously (42). All reactions were performed in triplicate, and data were analyzed with the 2−ΔΔCt method as described previously (18). β-Actin served as the internal control to normalize RNA content between samples. The nil-stimulated sample was used as the calibrator. The use of β-actin as the internal control was validated as suggested by Livak and Schmittgen (18). The data are expressed relative to samples collected prior to vaccination.

Statistical analysis.

All statistical analyses were performed with SAS software, version 9.1.3 (SAS Institute, Inc., Cary, NC). A mixed model for repeated measures (PROC MIXED) using the spatial power law for unequally spaced time points as the repeated effect (17) was used. For each stimulus and gene, the outcome variable (2−ΔΔCt) was log transformed. The model accounted for the effects of vaccination/pathology and time along with the interaction of vaccination/pathology and time. Prior to either analysis, the following covariance structures were tested, and the structure with the lowest scores was used in the final analysis: −2 REML (residual maximum likelihood) log likelihood, Akaike's information criterion, and the Schwarz's Bayesian information criterion. A P value of less than 0.05 was considered significant.

Correlations were calculated using the PROC CORR function (SAS). A Pearson product moment correlation was calculated for cytokine-to-cytokine correlations. Correlation of cytokine gene expression with pathology was performed using Spearman's correlation using the relative gene expression verses pathology. The pathology groups were assigned the following ordinal values: culture negative (CN group), 1; no visible lesions (NVL group), 2; and visible lesions (VL group), 3. Effects with a P value of less than 0.05 and an R value of greater than 0.5 were considered significant.

RESULTS

Vaccine-induced immunological responses.

Sixteen weeks after vaccination and prior to infection, PPD-specific immune responses were evaluated. Animals vaccinated with BCG Danish expressed approximately twofold more Tbet mRNA in response to PPD than did the unvaccinated controls (Fig. 1A), whereas the BCG Pasteur-vaccinated animals were not statistically different from controls. IFN-γ expression followed a pattern similar to that of Tbet expression (Fig. 1B). Animals vaccinated with BCG Danish expressed 15-fold more IFN-γ mRNA than controls expressed and 7-fold more than the BCG Pasteur-vaccinated animals. Vaccination did not induce significant differential expression of GATA3, IL-4, IL-10, IL-12p35, IL-12p40, IL-17, IL-23p19, and FoxP3 in response to PPD stimulation (data not shown). There was no significant gene expression in response to ESAT6-CFP10 stimulation in conjunction with BCG vaccination (data not shown). These data are consistent with the absence of the genes encoding ESAT6 or CFP10 in BCG Danish or BCG Pasteur.

FIG. 1.

FIG. 1.

Relative cytokine gene expression in vaccinated and control animals 16 weeks after vaccination. Gene expression was measured in PBL that were stimulated with PPD. Data are presented as means ± standard errors of the means relative to prevaccination. Statistical analysis was performed as described in Materials and Methods.

Gene expression in vaccinees after infection.

Sixteen weeks after infection, PPD- and ESAT6-CFP10-specific immune responses were evaluated. When recall responses to ESAT6-CFP10 were evaluated, BCG Danish-vaccinated deer expressed 1.9-fold less Tbet mRNA than unvaccinated controls (Fig. 2A), and FoxP3 gene expression was 1.3-fold greater (Fig. 2E). No significant differences between IFN-γ, IL-12p40, IL-17, IL-4, IL-10, or GATA3 gene expression in response to ESAT6-CFP10 stimulation were detected between BCG Danish vaccinees and unvaccinated controls (Fig. 2 and data not shown). PPD stimulation resulted in decreased IL-12p40 expression in the PBL from BCG Danish vaccinees compared to controls. Tbet, IFN-γ, GATA3, or FoxP3 gene expression levels were not different between the BCG Danish vaccinees and unvaccinated controls (Fig. 2).

FIG. 2.

FIG. 2.

Cytokine gene expression in vaccinated and control animals 16 weeks after infection with M. bovis. Gene expression was measured in PBL stimulated with either PPD or ESAT6-CFP10 (EC). Data are presented as means ± standard errors of the means relative to prevaccination. Statistical analysis was performed as described in Materials and Methods.

PBL from BCG Pasteur-vaccinated animals expressed significantly less Tbet and IL-12p40 mRNA than controls when cells were stimulated with ESAT6-CFP10, whereas GATA3 and FoxP3 mRNA increased (Fig. 2). IFN-γ, IL-17, IL-4, or IL-10 recall responses to ESAT6-CFP10 were not significantly different between these two groups. When PPD was used as the antigen, PBL from BCG Pasteur vaccinees expressed significantly less IL-12p40 and significantly more GATA3 and FoxP3 (Fig. 2). IFN-γ, Tbet, IL-17, IL-4, and IL-10 mRNA expression levels were not significantly different between BCG Pasteur-vaccinated deer and controls when cells were stimulated with PPD (Fig. 2 and data not shown).

Gene expression was similar between BCG Danish- and BCG Pasteur-vaccinated animals as determined by measurement of Tbet, IFN-γ, IL-12p40, IL-17, IL-4, IL-10, and FoxP3 (Fig. 2 and data not shown). BCG Pasteur-vaccinated animals expressed significantly more GATA3 mRNA than either BCG Danish-vaccinated animals or the unvaccinated controls (Fig. 2D).

Across all time points and conditions IFN-γ gene expression correlated with Tbet expression (for PPD, R = 0.86 and P < 0.0001; for ESAT6-CFP10, R = 0.79 and P < 0.0001). Neither vaccination nor infection induced significant IL-12p35 or IL-23p19 mRNA expression in stimulated PBL.

Correlation of cytokine gene expression with pathology.

M. bovis infection of WTD produces variable pathology. To assess the association between gene expression and pathology, animals were divided into three pathology groups, irrespective of vaccine, based on pathology and culture results (Table 1). Animals with visible lesions at necropsy and from which M. bovis was cultured were included in the VL group (n = 6). M. bovis culture-positive animals with no gross lesions were assigned to the NVL group (n = 5). M. bovis culture-negative animals without visible lesions were assigned to the CN group (n = 13). The low numbers of vaccinated animals in the VL and NVL pathology groups prevented the analysis of vaccine-specific effects on gene expression and pathology; therefore, the association of gene expression with pathology was performed irrespective of vaccination.

TABLE 1.

Pathology and culture results

Animal Vaccine Lesion Lung/LNa Head LNb Culturec Group
903 Control VL − + + VL
919 Control VL − + + VL
933 Control VL − + + VL
895 Control VL + + + VL
888 Danish VL + − + VL
922 Pasteur VL − + + VL
877 Control NVL − − + NVL
929 Control NVL − − + NVL
899 Danish NVL − − + NVL
923 Danish NVL − − + NVL
898 Pasteur NVL − − + NVL
881 Control NVL − − − CN
886 Control NVL − − − CN
920 Control NVL − − − CN
891 Danish NVL − − − CN
897 Danish NVL − − − CN
901 Danish NVL − − − CN
904 Danish NVL − − − CN
927 Danish NVL − − − CN
878 Pasteur NVL − − − CN
879 Pasteur NVL − − − CN
884 Pasteur NVL − − − CN
906 Pasteur NVL − − − CN
907 Pasteur NVL − − − CN
a

Visible lesions in the lungs and/or associated lymph nodes.

b

Visible lesion in the lymph nodes of the head.

c

Isolation of M. bovis from one or more tissues.

Sixteen weeks after challenge with virulent M. bovis, Tbet gene expression in response to PPD stimulation was approximately four- and threefold greater in PBL from the VL group than in the CN and NVL groups, respectively, while the NVL group expressed 1.5-fold more than the CN group (Fig. 3A). Recall responses to ESAT6-CFP10 resulted in approximately fivefold greater Tbet expression in the VL group than in either the NVL or CN group.

FIG. 3.

FIG. 3.

T-cell mRNA expression in different pathology groups following vaccination and infection. Animals were grouped by pathology. Tbet (A), IFN-γ (B), IL-17 (C), FoxP3 (D), and GATA3 (E) were measured in PBL stimulated with either PPD or ESAT6-CFP10 (EC) 16 weeks after infection with M. bovis. Data are presented as means ± standard errors of the means relative to prevaccintion.

IFN-γ gene expression was greatest in the VL group, with no significant difference between the NVL and CN groups (Fig. 3B). IFN-γ expression in PBL from the VL group was 86-fold greater than in the CN group and 26-fold greater than that in the NVL group when cells were stimulated with PPD. ESAT6-CFP10 stimulation of PBL from the VL group resulted in IFN-γ mRNA expression at levels 193-fold greater than in the CN group and 110-fold greater than in the NVL group. IFN-γ mRNA expression was not statistically different between the NVL and CN groups, regardless of antigenic stimulus. IFN-γ mRNA expression correlated with pathology (for PPD, R = 0.68989 and P = 0.0008; for ESAT6-CFP10, R = 0.79805 and P < 0.0001). Tbet expression correlated with IFN-γ (r = 0.86 and P < 0.0001) expression.

IL-17 expression in the VL group was approximately 4- and 25-fold greater than expression in the NVL and CN groups, respectively, when cells were stimulated with ESAT6-CFP10 (Fig. 3C). There were no statistically significant differences in IL-17 gene expression detected in the PPD-stimulated cells primarily due to one animal with high expression levels in the NVL group; however, IL-17 expression correlated with pathology (for PPD, R = 0.57997 and P = 0.0147; for ESAT6-CFP10, R = 0.81482 and P = 0.0002). Expression of IL-23, a cytokine that is closely related to IL-17, correlated with IL-17 expression (r = 0.56 and P < 0.03; data not shown).

FoxP3, a transcription factor responsible for Treg differentiation and function, was not differentially regulated between the groups in this study (Fig. 3D). GATA3 expression inversely correlated with pathology (Fig. 3E) (R = −0.67834; P = 0.0020). When cells were stimulated with ESAT6-CFP10, the VL group expressed approximately 1.5-fold fewer GATA3 transcripts than the CN group, and the NVL group was intermediate. When cells were stimulated with PPD, the NVL and VL groups expressed similar levels of GATA3, yet each expressed less than the CN group (Fig. 3D).

DISCUSSION

Differential immune responses as measured by mRNA expression were elicited by vaccination with BCG Danish versus BCG Pasteur. BCG Danish vaccination induced stronger TH1 responses, as indicated by Tbet and IFN-γ expression. Unexpectedly, BCG Pasteur vaccination elicited greater GATA3 expression than vaccination with BCG Danish. After infection, BCG Danish-vaccinated animals did not have lesions in head- or lung-associated lymph nodes; however, they did have minimal lung lesions (24). In contrast, BCG Pasteur-vaccinated animals had lesions in head- and lung-associated lymph nodes but none in the lungs (24). Differential gene expression in peripheral blood may explain, in part, the observed difference in lesion location. BCG Danish induced a stronger IFN-γ response (Fig. 1) in peripheral leukocytes that may be reflective of immune competence in the lymph nodes that prevents establishment of infection at that site. BCG Pasteur may generate a more tissue-oriented immune response since the IFN-γ response was low in peripheral blood (Fig. 1) and since there were no lesions in the lungs.

TH1 immune responses after infection were generally greater in the unvaccinated group than in either vaccine group. The large variation observed, particularly with IFN-γ expression, obscured vaccine effects (Fig. 2B). This large variation may be explained by the failure of the vaccine in some animals to limit pathology. When gene expression is considered irrespective of the vaccine group, the variation is considerably smaller (Table 1; Fig. 3B). The correlation of IFN-γ expression to pathology is consistent with previously published data from WTD (42) and cattle (41, 44). IL-17 expression was similar to that of the IFN-γ (Fig. 3). These data are consistent with previous reports that vaccination of mice produces similar numbers of IFN-γ- and IL-17-producing cells in the lungs (12). In addition, it has been reported that IL-17 was not required for the primary response to vaccination; however, it was required for the recall response when the mice were infected with virulent M. tuberculosis (12, 48). The contribution of IL-17 to pathology is not clear; however, the absence of IL-23 and IL-17 in mice results in increased lung inflammation (14) after TB infection. Here, we report that IL-17 expression correlates with pathology, suggesting that IL-17 may contribute to overall immunopathology or is indicative of uncontrolled infection (i.e., continuous antigenic stimulation).

GATA3 gene expression is associated with TH2 differentiation (49) and is the transcription factor that is believed to be the master regulator of TH2 cells (3). Regardless of the vaccine group, GATA3 expression was least in the VL group and inversely correlated with pathology. These data suggest that, over the time frame examined in this study, increased TH2 responses are not indicative of increased pathology (42) and may correlate with bacterial control. In M. tuberculosis-infected humans, GATA3 expression was 3.8-fold greater in patients that had fast responses to anti-TB therapy than in those in the slow-response group (39). Among the vaccinees, PBL from the BCG Pasteur-vaccinated animals expressed more GATA3 after infection (Fig. 2D). The relevance of induction of GATA3 by BCG Pasteur is not clear; however, these animals did not have lesions in the lung (24).

In the current study, there was no clear correlation between gene expression and protection; however, the correlation of IFN-γ with pathology was confirmed, and GATA3 inverse correlation with pathology is established. Here, we report that immune responses in the peripheral blood did not identify a mechanism for the differences observed in efficacy, at least for the genes measured in this experiment. Measurement of immune responses at foci of infection may be required to determine the immunological responses that correlate with the differences in vaccine efficacy.

Footnotes

▿

Published ahead of print on 10 June 2009.

REFERENCES

  • 1.Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice. J. Immunol. 1543359-3372. [PubMed] [Google Scholar]
  • 2.Bolin, C. A., D. L. Whipple, K. V. Khanna, J. M. Risdahl, P. K. Peterson, and T. W. Molitor. 1997. Infection of swine with Mycobacterium bovis as a model of human tuberculosis. J. Infect. Dis. 1761559-1566. [DOI] [PubMed] [Google Scholar]
  • 3.Bowen, H., A. Kelly, T. Lee, and P. Lavender. 2008. Control of cytokine gene transcription in Th1 and Th2 cells. Clin. Exp. Allergy 381422-1431. [DOI] [PubMed] [Google Scholar]
  • 4.Casanova, J. L., and L. Abel. 2002. Genetic dissection of immunity to mycobacteria: the human model. Annu. Rev. Immunol. 20581-620. [DOI] [PubMed] [Google Scholar]
  • 5.Chen, X., B. Zhou, M. Li, Q. Deng, X. Wu, X. Le, C. Wu, N. Larmonier, W. Zhang, H. Zhang, H. Wang, and E. Katsanis. 2007. CD4+ CD25+ FoxP3+ regulatory T cells suppress Mycobacterium tuberculosis immunity in patients with active disease. Clin. Immunol. 12350-59. [DOI] [PubMed] [Google Scholar]
  • 6.Corner, L. A., M. A. Stevenson, D. M. Collins, and R. S. Morris. 2003. The re-emergence of Mycobacterium bovis infection in brushtail possums (Trichosurus vulpecula) after localised possum eradication. N. Z. Vet. J. 5173-80. [DOI] [PubMed] [Google Scholar]
  • 7.Donnelly, C. A., R. Woodroffe, D. R. Cox, F. J. Bourne, C. L. Cheeseman, R. S. Clifton-Hadley, G. Wei, G. Gettinby, P. Gilks, H. Jenkins, W. T. Johnston, A. M. Le Fevre, J. P. McInerney, and W. I. Morrison. 2006. Positive and negative effects of widespread badger culling on tuberculosis in cattle. Nature 439843-846. [DOI] [PubMed] [Google Scholar]
  • 8.Elias, D., H. Akuffo, and S. Britton. 2005. PPD induced in vitro interferon gamma production is not a reliable correlate of protection against Mycobacterium tuberculosis. Trans. R. Soc. Trop. Med. Hyg. 99363-368. [DOI] [PubMed] [Google Scholar]
  • 9.Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, and B. R. Bloom. 1993. An essential role for interferon γ in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 1782249-2254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Guyot-Revol, V., J. A. Innes, S. Hackforth, T. Hinks, and A. Lalvani. 2006. Regulatory T cells are expanded in blood and disease sites in patients with tuberculosis. Am. J. Respir. Crit. Care Med. 173803-810. [DOI] [PubMed] [Google Scholar]
  • 11.Kehrli, M. E., Jr., B. J. Nonnecke, and J. A. Roth. 1989. Alterations in bovine lymphocyte function during the periparturient period. Am. J. Vet. Res. 50215-220. [PubMed] [Google Scholar]
  • 12.Khader, S. A., G. K. Bell, J. E. Pearl, J. J. Fountain, J. Rangel-Moreno, G. E. Cilley, F. Shen, S. M. Eaton, S. L. Gaffen, S. L. Swain, R. M. Locksley, L. Haynes, T. D. Randall, and A. M. Cooper. 2007. IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat. Immunol. 8369-377. [DOI] [PubMed] [Google Scholar]
  • 13.Khader, S. A., and A. M. Cooper. 2008. IL-23 and IL-17 in tuberculosis. Cytokine 4179-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper. 2005. IL-23 compensates for the absence of IL-12p70 and is essential for the IL-17 response during tuberculosis but is dispensable for protection and antigen-specific IFN-γ responses if IL-12p70 is available. J. Immunol. 175788-795. [DOI] [PubMed] [Google Scholar]
  • 15.Komiyama, Y., S. Nakae, T. Matsuki, A. Nambu, H. Ishigame, S. Kakuta, K. Sudo, and Y. Iwakura. 2006. IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J. Immunol. 177566-573. [DOI] [PubMed] [Google Scholar]
  • 16.Li, L., S. H. Lao, and C. Y. Wu. 2007. Increased frequency of CD4+ CD25high Treg cells inhibit BCG-specific induction of IFN-γ by CD4+ T cells from TB patients. Tuberculosis 87526-534. [DOI] [PubMed] [Google Scholar]
  • 17.Littell, R. C., G. A. Milliken, W. W. Stroup, and R. D. Wolfinger. 1996. SAS system for mixed models. SAS Institute Inc., Cary, NC.
  • 18.Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25402-408. [DOI] [PubMed] [Google Scholar]
  • 19.Majlessi, L., M. Simsova, Z. Jarvis, P. Brodin, M. J. Rojas, C. Bauche, C. Nouze, D. Ladant, S. T. Cole, P. Sebo, and C. Leclerc. 2006. An increase in antimycobacterial Th1-cell responses by prime-boost protocols of immunization does not enhance protection against tuberculosis. Infect. Immun. 742128-2137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nol, P., M. V. Palmer, W. R. Waters, F. E. Aldwell, B. M. Buddle, J. M. Triantis, L. M. Linke, G. E. Phillips, T. C. Thacker, J. C. Rhyan, M. R. Dunbar, and M. D. Salman. 2008. Efficacy of oral and parenteral routes of Mycobacterium bovis bacille calmette-guerin vaccination against experimental bovine tuberculosis in white-tailed deer (Odocoileus virginianus): a feasibility study. J. Wildl. Dis. 44247-259. [DOI] [PubMed] [Google Scholar]
  • 21.O'Brien, D. J., S. M. Schmitt, J. S. Fierke, S. A. Hogle, S. R. Winterstein, T. M. Cooley, W. E. Moritz, K. L. Diegel, S. D. Fitzgerald, D. E. Berry, and J. B. Kaneene. 2002. Epidemiology of Mycobacterium bovis in free-ranging white-tailed deer, Michigan, USA, 1995-2000. Prev. Vet. Med. 5447-63. [DOI] [PubMed] [Google Scholar]
  • 22.O'B rien, D. J., S. M. Schmitt, S. D. Fitzgerald, D. E. Berry, and G. J. Hickling. 2006. Managing the wildlife reservoir of Mycobacterium bovis: the Michigan, USA, experience. Vet. Microbiol. 112313-323. [DOI] [PubMed] [Google Scholar]
  • 23.Palmer, M. V., T. C. Thacker, and W. R. Waters. 2007. Vaccination of white-tailed deer (Odocoileus virginianus) with Mycobacterium bovis bacillus Calmette Guerin. Vaccine 256589-6597. [DOI] [PubMed] [Google Scholar]
  • 24.Palmer, M. V., T. C. Thacker, and W. R. Waters. 2008. Vaccination with Mycobacterium bovis BCG strains Danish and Pasteur in white-tailed deer (Odocoileus virginianus) experimentally challenged with Mycobacterium bovis. Zoonoses Public Health 56243-251. [DOI] [PubMed] [Google Scholar]
  • 25.Palmer, M. V., W. R. Waters, and D. L. Whipple. 2004. Investigation of the transmission of Mycobacterium bovis from deer to cattle through indirect contact. Am. J. Vet. Res. 651483. [DOI] [PubMed] [Google Scholar]
  • 26.Palmer, M. V., W. R. Waters, and D. L. Whipple. 2002. Lesion development in white-tailed deer (Odocoileus virginianus) experimentally infected with Mycobacterium bovis. Vet. Pathol. 39334-340. [DOI] [PubMed] [Google Scholar]
  • 27.Palmer, M. V., W. R. Waters, and D. L. Whipple. 2002. Susceptibility of raccoons (Procyon lotor) to infection with Mycobacterium bovis. J. Wildl. Dis. 38266-274. [DOI] [PubMed] [Google Scholar]
  • 28.Palmer, M. V., D. L. Whipple, and S. C. Olsen. 1999. Development of a model of natural infection with Mycobacterium bovis in white-tailed deer. J. Wildl. Dis. 35450-457. [DOI] [PubMed] [Google Scholar]
  • 29.Payeur, J. B., S. Church, L. Mosher, B. Robinson-Dunn, S. Schmitt, and D. Whipple. 2002. Bovine tuberculosis in Michigan wildlife. Ann. N. Y. Acad. Sci. 969259-261. [DOI] [PubMed] [Google Scholar]
  • 30.Pollock, J. M., and P. Andersen. 1997. Predominant recognition of the ESAT-6 protein in the first phase of interferon with Mycobacterium bovis in cattle. Infect. Immun. 652587-2592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ritacco, V., B. Lopez, I. N. De Kantor, L. Barrera, F. Errico, and A. Nader. 1991. Reciprocal cellular and humoral immune responses in bovine tuberculosis. Res. Vet. Sci. 50365-367. [DOI] [PubMed] [Google Scholar]
  • 32.Rook, G. A. 2007. Th2 cytokines in susceptibility to tuberculosis. Curr. Mol. Med. 7327-337. [DOI] [PubMed] [Google Scholar]
  • 33.Rook, G. A., R. Hernandez-Pando, K. Dheda, and G. Teng Seah. 2004. IL-4 in tuberculosis: implications for vaccine design. Trends Immunol. 25483-488. [DOI] [PubMed] [Google Scholar]
  • 34.Roth, J. A., and M. L. Kaeberle. 1981. Evaluation of bovine polymorphonuclear leukocyte function. Vet. Immunol. Immunopathol. 2157-174. [DOI] [PubMed] [Google Scholar]
  • 35.Roy, E., J. Brennan, S. Jolles, and D. B. Lowrie. 2008. Beneficial effect of anti-interleukin-4 antibody when administered in a murine model of tuberculosis infection. Tuberculosis 88197-202. [DOI] [PubMed] [Google Scholar]
  • 36.Schmitt, S. M., S. D. Fitzgerald, T. M. Cooley, C. S. Bruning-Fann, L. Sullivan, D. Berry, T. Carlson, R. B. Minnis, J. B. Payeur, and J. Sikarskie. 1997. Bovine tuberculosis in free-ranging white-tailed deer from Michigan. J. Wildl. Dis. 33749. [DOI] [PubMed] [Google Scholar]
  • 37.Schmitt, S. M., D. J. O'Brien, C. S. Bruning-Fann, and S. D. Fitzgerald. 2002. Bovine tuberculosis in Michigan wildlife and livestock. Ann. N. Y. Acad. Sci. 969262-268. [DOI] [PubMed] [Google Scholar]
  • 38.Seah, G. T., G. M. Scott, and G. A. Rook. 2000. Type 2 cytokine gene activation and its relationship to extent of disease in patients with tuberculosis. J. Infect. Dis. 181385-389. [DOI] [PubMed] [Google Scholar]
  • 39.Siawaya, J. F., N. B. Bapela, K. Ronacher, N. Beyers, P. van Helden, and G. Walzl. 2008. Differential expression of interleukin-4 (IL-4) and IL-4δ2 mRNA, but not transforming growth factor beta (TGF-β), TGF-βRII, Foxp3, gamma interferon, T-bet, or GATA-3 mRNA, in patients with fast and slow responses to antituberculosis treatment. Clin. Vaccine Immunol. 151165-1170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995. Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis. Infect. Immun. 631710-1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Thacker, T. C., M. V. Palmer, and W. R. Waters. 2007. Associations between cytokine gene expression and pathology in Mycobacterium bovis infected cattle. Vet. Immunol. Immunopathol. 119204-213. [DOI] [PubMed] [Google Scholar]
  • 42.Thacker, T. C., M. V. Palmer, and W. R. Waters. 2006. Correlation of cytokine gene expression with pathology in white-tailed deer (Odocoileus virginianus) infected with Mycobacterium bovis. Clin. Vaccine Immunol. 13640-647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Untergasser, A., H. Nijveen, X. Rao, T. Bisseling, R. Geurts, and J. A. Leunissen. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35W71-W74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Vordermeier, H. M., M. A. Chambers, P. J. Cockle, A. O. Whelan, J. Simmons, and R. G. Hewinson. 2002. Correlation of ESAT-6-specific gamma interferon production with pathology in cattle following Mycobacterium bovis BCG vaccination against experimental bovine tuberculosis. Infect. Immun. 703026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vordermeier, H. M., A. Whelan, P. J. Cockle, L. Farrant, N. Palmer, and R. G. Hewinson. 2001. Use of synthetic peptides derived from the antigens ESAT-6 and CFP-10 for differential diagnosis of bovine tuberculosis in cattle. Clin. Diagn. Lab. Immunol. 8571-578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Waters, W. R., B. J. Nonnecke, M. V. Palmer, S. Robbe-Austermann, J. P. Bannantine, J. R. Stabel, D. L. Whipple, J. B. Payeur, D. M. Estes, J. E. Pitzer, and F. C. Minion. 2004. Use of recombinant ESAT-6:CFP-10 fusion protein for differentiation of infections of cattle by Mycobacterium bovis and by M. avium subsp. avium and M. avium subsp. paratuberculosis. Clin. Diagn. Lab. Immunol. 11729-735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Welsh, M. D., R. T. Cunningham, D. M. Corbett, R. M. Girvin, J. McNair, R. A. Skuce, D. G. Bryson, and J. M. Pollock. 2005. Influence of pathological progression on the balance between cellular and humoral immune responses in bovine tuberculosis. Immunology 114101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Wozniak, T. M., A. A. Ryan, and W. J. Britton. 2006. Interleukin-23 restores immunity to Mycobacterium tuberculosis infection in IL-12p40-deficient mice and is not required for the development of IL-17-secreting T cell responses. J. Immunol. 1778684-8692. [DOI] [PubMed] [Google Scholar]
  • 49.Zheng, W., and R. A. Flavell. 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89587-596. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Vaccine Immunology : CVI are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES