Isolation and Characterization of Xenorhabdus nematophila Transposon Insertion Mutants Defective in Lipase Activity against Tween

Abstract

We identified Xenorhabdus nematophila transposon mutants with defects in lipase activity. One of the mutations, in yigL, a conserved gene of unknown function, resulted in attenuated virulence against Manduca sexta insects. We discuss possible connections between lipase production, YigL, and specific metabolic pathways.

The gammaproteobacterium Xenorhabdus nematophila is an insect pathogen that produces toxins and enzymes, including lipases, previously implicated in pathogenesis or nutrient acquisition (4, 9). Although the importance of lipases in bacterial virulence has been established for many pathogens (6, 11, 15, 18, 22, 33, 39, 42, 45-47, 51), the X. nematophila Tween-specific XplA lipase is not required for virulence but may play a role in bacterial nutrition (35, 38).

To further explore the regulation and potential roles of lipase activity in X. nematophila biology, we screened a transposon insertion library of 5,847 mutants for a lack of in vitro lipase activity on Tween 40 agar plates (3, 43). The Tn10 Km^r (50 μg ml⁻¹) mutants were obtained by mating X. nematophila with Escherichia coli S17-1 (λpir) carrying pSAG1 (2, 53) (Table 1). Transposon insertion sites were determined by sequencing of cloned or chromosomal DNA using standard methods (5, 34, 41). Sequencing was performed at the University of Wisconsin—Madison Biotechnology Center using BigDye v3.1 (Applied Biosystems, Foster City, CA) and the primers noted in Table 2. Identities of disrupted genes were predicted using BLAST (1) against public databases and the X. nematophila genome (52).

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Relevant characteristics	Source or reference
Strains
S17-1 (λpir)	E. coli donor strain for conjugations	44
Top10	E. coli; general cloning strain	Invitrogen (Carlsbad, CA)
HGB298	S. enterica serovar Typhimurium LT2	D. Downs
HGB007	X. nematophila wild-type ATCC 19061	ATCC
HGB009	Bacillus subtilis AD623	A. Driks
HGB081	X. nematophila wild-type AN6/1 Rifr	S. Forst
HGB760	HGB081 lrhA1::Tn10; Km	38
HGB761	HGB081 yigL1::Tn10; Km	This study
HGB1400	HGB007 gshA1::Tn10; Km	This study
HGB1401	HGB081 pgi1::Tn10; Km	This study
HGB1402	HGB007 purM1::Tn10; Km	This study
HGB1403	HGB007 insB1::Km	This study
HGB1404	HGB081 flhD5::Tn10; Km	This study
HGB1270	HGB081 (Tn7)	38
HGB1274	HGB081 (Tn7-yigL)	This study
HGB1275	HGB081 yigL1::Tn10 (Tn7)	This study
HGB1276	HGB081 yigL1::Tn10 (Tn7-yigL)	This study
Plasmids
pCR2.1-TOPO	Ampr Kmr; general cloning vector	Invitrogen (Carlsbad, CA)
pBUX-BF13	Ampr; triparental mating helper plasmid	2
pEVS107	oriR6K mini-Tn7 delivery vector; Ermr Kmr	49
pEVSyigL	pEVS107 + yigL (with promoter, 1,354-bp insert)	This study
pSAG1	Kmr; donor for Tn10 transposon mutants	29, 38

TABLE 2.

Primers used in this study

Primer	Sequence (5′ to 3′)	Use
YigLF	GCCTAATGTCAAGAGGCGTAA	Complementation
YigLR	CAGCACCTAATCAGATGCTGT	Complementation
AttTn7EXT	TGTTGGTTCACATCC	Complementation
ErmAnch1	TACTTATGAGCAAGTATTGTC	Complementation
RecAminFor	TGTCCGTTTGGATATCCGCC	qPCR
RecAminRev	CCCAGAGTATTAATACCTTCCCCAT	qPCR
XlpAintF	CGCTGCATTGGCAACAGGAAA	qPCR
XlpAintR	GCCAATCGTGCTGAACGGTAT	qPCR
YigLintF	GCCAATTCCTCGGATACCAA	qPCR
YigLintR	CGCAGATAACGAGAAACTGC	qPCR
YigLRTF	CCGTATACCAAGGAAACG	RT-PCR
YigLRTR	GTGACTGAATACCAGTTC	RT-PCR
PldBRTF	GCGAACCTCAATTCTCTG	RT-PCR
PldBRTR	CGGTAAGATCACCAGAGT	RT-PCR
MSActMiniFor	GGAAATCGTTCGTGACATCA	M. sexta qPCR
MSActMiniRev	CGGACCCTCTCGTTACCGAT	M. sexta qPCR
CecropinForGC	CAGCGCATTCGCCATGGC	M. sexta qPCR
CecropinRev	ACGGTCGCGACTGCAGCC	M. sexta qPCR

Consistent with published reports (12, 35, 38), genes encoding the regulators LrhA (16, 20, 26, 35, 38) and FlhDC (12) were identified in this screen (Table 3) and will not be discussed further. Lipase deficiency was also associated with mutations in genes predicted to encode the γ-glutamyl-cysteine ligase required for the synthesis of glutathione (gshA), the glycolytic enzyme glucose-6-phosphate isomerase (pgi), and phosphoribosylaminoimidazole synthetase (purM) involved in purine and thiamine biosynthesis (Fig. 1; Table 3). In other bacteria, both gshA and purM mutants have defects in thiamine biosynthesis and nucleotide metabolism (10, 13, 14). An additional mutation revealed by the screen was in a transposase B family gene (Fig. 1) (Table 3). The screen did not reveal the xlpA gene encoding the Tween-specific lipase activity (35, 38); this is likely due to nonrandom insertion specificities and a lack of genome saturation.

TABLE 3.

Results of screen for X. nematophila mutants defective in in vitro lipase activity against Tween

Mutant genotype	XNC1 ORFa	Classb	Predicted protein functionc	E valuec	% Homologyc,d	Homolog organisme
flhD5::Tn10	1627	Regulator	Regulator of flagellar synthesis	9e−54	88 (97)	P. luminescens
lrhA1::Tn10	2809	Regulator	LysR-type transcriptional regulator	2e−151	86 (93)	P. luminescens
gshA1::Tn10	1264	Metabolic	γ-Glutamate-cysteine ligase	0.0	74 (87)	P. luminescens
pgi1::Tn10	3940	Metabolic	Glucose-6-phosphate isomerase	0.0	84 (92)	P. luminescens
purM1::Tn10	2673	Metabolic	Phosphoribosylaminoimidazole synthetase	2e−177	85 (91)	P. luminescens
yigL1::Tn10	0426	Unknown	HAD-like hydrolase	4e−126	80 (87)	P. luminescens
insB1::Tn10	3457	Transposon	Transposase B	3e−51	68 (80)	Vibrio vulnificus

^aOpen reading frame (ORF) designation from the X. nematophila genome (https://www.genoscope.cns.fr/agc/mage/).

^bBased on predicted function from BLAST search results.

^cBased on BLASTp search results against NCBI nonredundant protein sequences. Database accessed on 3 February 2009.

^dData are presented as percent identity (percent similarity).

^eOrganism on which percent homology is based. P. luminescens; Photorhabdus luminescens.

FIG. 1.

Loci of genes with transposon insertions in X. nematophila lipase-deficient mutants. Loci of mutants with lesions in gshA (A), pgi (B), purM (C), yigL (D), and insB (E) are shown. Arrows indicate genes and their direction of transcription. The white inverted triangles represent the positions of the mini-Tn10 Km^r transposon insertions. Genes were named based on their similarity to E. coli, with the exception of insB, which was named after the genes encoding homologs from the transposase B family of transposases.

The primary focus of continued studies was a mutant with an insertion in yigL, a conserved gene with 77% similarity to E. coli yigL (for which it was named) (Fig. 1) (Table 3). Reverse transcriptase PCR (RT-PCR) using the Access RT-PCR system (Promega, Madison, WI) and relevant primers (Table 2) demonstrated that the transposon of yigL1::Tn10 interrupts yigL transcription (Fig. 2A). It does not adversely affect transcription of the putative lipase-encoding pldB located upstream, arguing against the idea that aberrant pldB expression is responsible for the lipase defect of the yigL1::Tn10 mutant and confirming that pldB does not encode the Tween-specific lipase activity. Furthermore, the yigL mutant was not defective in expression or stability of xlpA; quantitative PCR (qPCR) analysis of synthesized cDNA with the relevant primers (Table 2) on a Bio-Rad iCycler machine (8) showed that xlpA levels in the yigL1::Tn10 mutant were almost twice (197%; n = 2; P > 0.05) those of the wild type. Although not statistically significant, an increase in the xlpA transcript in the yigL mutant could reflect regulatory compensation of the lipase defect of this mutant. These data indicate that the yigL1::Tn10 defect in lipase activity occurs posttranscriptionally. Unlike xlpA transcription (38), which is positively regulated by LrhA, yigL transcription is not influenced significantly by LrhA; yigL transcript levels in the lrhA1::Tn10 mutant are 66.0% that of the wild type (n ≥ 5; P > 0.05), indicating that LrhA does not coordinately regulate these two genes.

FIG. 2.

(A) Transcription of upstream pldB is unaffected in the yigL1::Tn10 mutant. Reverse transcription and PCR amplifications using primers specific for yigL spanning the transposon insertion site (yigL, primers YigLRTF and YigLRTR; expected product size, 156 bp) (Table 2), or within pldB (pldB, primers PldBRTF and PldBRTR; expected product size, 132 bp) (Table 2) on RNA template isolated from the wild type (lanes 2 and 5), the yigL1::Tn10 mutant (lanes 3 and 6), or the yigL1::Tn10 mutant carrying a wild-type copy of yigL at the Tn7 site (lanes 4 and 7). Control reactions with each primer set were performed on wild-type chromosomal DNA (lane 1). RT was added only to the reactions shown in lanes 1 to 3. DNA size standards (1-kb ladder; Promega) were used to verify the correct product size but are not shown. (B) Predicted sequence of the X. nematophila YigL protein. The underlined sites labeled I to III are predicted to form an α/β hydrolase fold characteristic of the HAD-like family of hydrolases. The large, bold amino acid residues represent the predicted catalytic triad typical of this family (23, 25).

X. nematophila YigL has 70% identity and 81% similarity (an E value of 1e−108) to a predicted Yersinia pestis haloacid dehalogenase (HAD)-like hydrolase (23, 25) (Fig. 2B), and its gene sequence is predicted to encode the canonical α/β hydrolase fold and catalytic triad of the HAD superfamily (1, 23, 25). Like other Escherichia coli HAD superfamily members, E. coli YigL has phosphatase activity against a broad range of substrates, including phosphoramidates, phosphorylated nucleotides, and acetyl phosphate, but exhibits the highest activities toward 2-deoxyglucose-6-P, beta-glucose-6-P, and pyridoxyl phosphate (24). Consistent with this, a phylogenomic map (48) constructed for X. nematophila using 769 sequenced genomes from NCBI (accessed 8 November 2008) revealed that yigL clusters tightly into a single mountain and is coinherited with 53 other genes (Table 4) predicted to encode proteins from several distinct classes, including those involved in cell wall biosynthesis and fatty acid, amino-sugar, phospho-sugar, and nucleotide metabolism and transport. Furthermore, given that coinheritance is an indicator of related function, it is striking that YigL groups with other genes predicted to be involved in pathways revealed by our mutagenesis analysis (e.g., pgi in glycolysis and purM and gshA in nucleotide metabolism). These data suggest that the metabolic pathways connecting glycolytic intermediates to nucleotide, lipid, and amino-sugar end products influence lipase activity and that YigL is a functional component of these metabolic processes. Additionally, E. coli yigL is transcriptionally upregulated during heat shock in a σ³²-dependent manner (50), suggesting that YigL could be part of the stress response that maintains the stability of proteins and/or the cell envelope. Testing the expression and activity of X. nematophila YigL under a wide variety of environmental stresses and nutritional conditions might illuminate its role in metabolism, stress response, and lipase production.

TABLE 4.

ORFs that cluster with yigL on a phylogenomic map

Class of gene product	ORF IDa	Predicted function of gene productb
Phospho-sugar metabolism	XNC1_4588	Trehalose-6-P hydrolase, alternative inducer of maltose system, cytoplasmic
	XNC1_3025	Fructose-bisphosphate aldolase, class II
	XNC1_0100	6-Phosphofructokinase I
	XNC1_1869	Pyruvate kinase I (formerly F), fructose stimulated
	XNC1_1557	Pyruvate formate lyase I, induced anaerobically
	XNC1_2802	Acetate kinase A (propionate kinase 2)
	XNC1_2801	Phosphotransacetylase (phosphate acetyltransferase)
Phosphotransferase system/sugar transport	XNC1_1357	PTS family enzyme IIC (N terminal); enzyme IIB (center); enzyme IIA (C terminal), N-acetylglucosamine specific
	XNC1_2826	Putative phosphotransferase enzyme II, A component SgcA
	XNC1_2827	Putative sugar phosphotransferase component II B
	XNC1_2828	PTS family enzyme IIC, ascorbate specific
	XNC1_3215	PTS family enzyme I and Hpr components, PEP-protein phosphotransferase
	XNC1_3216	PTS family enzyme IIA component
	XNC1_4343	Putative PTS family enzyme IIBC with sucrose/glucose-specific domain
	XNC1_4589	PTS family enzyme IIBC, trehalose(maltose)-specific
Other transporters/channels	XNC1_1164	Cobalt import ATP-binding protein CbiO
	XNC1_2982	Putative myo-inositol transport protein (SSS family)
	XNC1_0751	Branched-chain amino acid transport system II (LIV-II) (LIVCS family)
	XNC1_0214	MIP channel, glycerol diffusion
	XNC1_2168	Conserved hypothetical protein, putative ABC transporter
	XNC1_0970	Putative transport protein, multidrug resistance-like (ABC superfamily, membrane [N terminal], atp_bind [C terminal])
	XNC1_0971	Putative transport protein, multidrug resistance-like (ABC superfamily, atp_bind)
Amino-sugar/fatty acid metabolism/cell	XNC1_4208	Putative alanine racemase
wall biosynthesis	XNC1_1356	Glucosamine-6-phosphate deaminase
	XNC1_0667	Glycerate kinase I
	XNC1_0384	UDP-GlcNAc:undecaprenylphosphate GlcNAc-1-phosphate transferase
	XNC1_0156	Conserved hypothetical protein, possible cell wall biosynthesis, glycosyltransferase
	XNC1_1120	Conserved hypothetical protein, putative galactosyl transferase
	XNC1_3910	Beta-ketoacyl synthase
	XNC1_1767	Putative polyketide biosynthesis protein PksG
Nucleotide/nucleoside metabolism	XNC1_2671	Uracil transport protein (NCS2 family)
	XNC1_1498	Uridine/cytidine kinase
	XNC1_4241	Hypothetical protein, YjjG, dUMP phosphatase
	XNC1_0911	Hypoxanthine phosphoribosyltransferase
	XNC1_0520	Anaerobic ribonucleotide reductase activating protein
	XNC1_0521	Anaerobic ribonucleoside-triphosphate reductase
	XNC1_0886	5′-Methylthioadenosine/S-adenosylhomocysteine nucleosidase
Gene expression	XNC1_0009	Hypothetical protein YkgM putative ribosomal protein
	XNC1_0513	Putative sensory kinase in two-component regulatory system
	XNC1_2769	Putative elongation factor
	XNC1_1888	Tyrosine tRNA synthetase
	XNC1_1533	Putative tRNA (uracil-5-)-methyltransferase with S-adenosyl-l-methionine-dependent methyltransferase domain
Phage related	XNC1_3956	Putative antirepressor protein
	XNC1_3129	Putative phage integrase
	XNC1_3506	Putative phage integrase
	XNC1_3598	Putative phage integrase
Other enzyme	XNC1_1435	Putative phosphatase
	XNC1_1447	Putative phosphatase/sulfatase with NAD(P)-binding domain
	XNC1_0539	Binuclear zinc phosphodiesterase (fragment)
	XNC1_0769	Pyrrolidone-carboxylate peptidase 2 (EC 3.4.19.3) (5-oxoprolyl-peptidase 2) (pyroglutamyl-peptidase I 2) (PGP-I 2) (Pyrase 2)
	XNC1_2468	Conserved hypothetical protein, putative spermidine acetyltransferase
Unknown	XNC1_1792	Conserved hypothetical protein
	XNC1_2744	Conserved hypothetical protein

^aORF IDs are according to NCBI locus tag registry assignment (genome submission is currently under way) and the Genoscope website (https://www.genoscope.cns.fr/agc/mage/). Predicted functions are based on BLASTp similarities in the NCBI non-redundant protein database and automated annotation on the MaGe database.

^bPTS, phosphotransferase system.

To further characterize the potential function of disrupted genes, we tested the lipase-deficient mutants for their lipase activities against other Tween substrates (43), their protease activities (3), their hemolytic activities (17, 40) on agar containing 5% defibrinated sheep blood (Colorado Serum Company, Denver, CO), their motility (53), and their antibiotic activities (30, 53) against Bacillus subtilis (Table 5). Each mutant was defective in lipase activity against Tween substrates but was the same as the wild type for other phenotypes tested, with two exceptions: the gshA1::Tn10 mutant was defective in antibiotic production, and the purM1::Tn10 mutant had increased hemolytic activity compared to that of the wild-type. The insB mutant was not studied further because it is a mobile element of unknown cellular function and no other tested phenotypes distinguished it from wild-type X. nematophila. However, it should be noted that multiple mobile DNA elements were present in the YigL phylogenomic cluster (Table 4), suggesting that such elements may play a role in lipase production.

TABLE 5.

Selected phenotypes of X. nematophila lipase-deficient mutants^a

Strain genotype	Motilityb	Lipasec	Proteased	Hemolysind	Antibiotic productione
Wild-type	+	+	+	+	+
gshA1::Tn10	+	−	+	+	−
pgi1::Tn10	+	−	+	+	+
purM1::Tn10	+	−	+	++	+
yigL1::Tn10	+	−	+	+	+
insB1::Tn10	+	−	+	+	+

^a+, the activity was indistinguishable from that of the wild-type; −, the activity was not detected; ++, the activity was greater than that of the wild type. Experiments were conducted at least twice with at least two replicates per experiment.

^bSize of colony 24 h after inoculation on 0.25% agar plates.

^cQualitative evaluation of halo surrounding the bacterial colony, 3 days after inoculation on plates containing Tween 20, 40, or 60.

^dQualitative evaluation of halo surrounding the bacterial colony 3 days after inoculation on milk or sheep blood agar plates.

^eQualitative evaluation of halo of no growth surrounding the bacterial colony 24 h after inoculation with the tester bacterium (Bacillus subtilis).

Virulence of the lipase-deficient mutants was tested by injecting stationary-phase cultures into fourth-instar Manduca sexta insects (53), as previously described (8, 32). The gshA1::Tn10, pgi1::Tn10, and purM1::Tn10 mutants each killed at levels similar to that of the wild type (data not shown), indicating that the disrupted genes are not required for virulence in M. sexta or that X. nematophila encodes redundant activities. However, stationary-phase cultures of the yigL1::Tn10 mutant exhibited reduced virulence (Fig. 3A). To confirm the causal role of the yigL mutation in the virulence defect, we conjugated a Tn7 construct with or without a wild-type copy of yigL and 500 nucleotides of the upstream sequence, amplified using primers YigLF and YigLR (Table 2) and cloned into the ApaI and KpnI sites of pEVS107, into the chromosomal attTn7 site of wild-type X. nematophila and the yigL1::Tn10 mutant (2, 28). The resulting strains were verified to have the Tn7 insertion at the appropriate location by PCR using primers AttTn7EXT and ErmAnch1 (Table 2). Virulence (Fig. 3A) and lipase activity (data not shown) of the yigL1::Tn10 attTn7-yigL mutant were indistinguishable from that of the wild type, confirming that the yigL mutation caused the virulence and lipase defects of the yigL1::Tn10 mutant. Given that other lipase-deficient mutants, including the xlpA mutant (38), display wild-type virulence, the contribution of YigL to virulence is likely independent of its role in lipase activity.

FIG. 3.

The X. nematophila yigL1::Tn10 mutant has a virulence defect but suppresses insect humoral immunity. (A) Ability of stationary-phase X. nematophila cultures to kill M. sexta insects. Approximately 10⁴ CFU of cultures were injected into the insects, and the percent mortality at 72 h is shown. The wild type containing a Tn7 (black bar) or a wild-type copy of yigL in the Tn7 (hatched bar) or the yigL1::Tn10 mutant with a Tn7 (white bar) or a wild-type copy of yigL in the Tn7 (striped bar) was injected (n = 3). Error bars represent standard errors, and different letters indicate significantly different values (P < 0.05). (B) Transcript levels of the antimicrobial peptide cecropin in M. sexta insects after injection with phosphate-buffered saline (PBS) (striped bar), S. enterica serovar Typhimurium (hatched bar), wild-type X. nematophila (black bar), or the yigL1::Tn10 mutant (white bar). RNA was extracted from insects and cDNA was analyzed by qPCR. Data were compared to those for the PBS injection and are presented as percentages of the levels of transcript in PBS-injected insects (n = 5). An asterisk indicates a value significantly different than that for wild-type X. nematophila (P < 0.05).

Like some other previously described X. nematophila mutants (e.g., the xhlA and prtA mutants) (8; C. L. Lipke and H. Goodrich-Blair, unpublished data), the virulence defect of the yigL::Tn10 mutant was growth phase dependent. Approximately 10² CFU of the logarithmic-phase yigL1::Tn10 mutant caused mortality indistinguishable from that of the wild type after injection in M. sexta (the yigL1::Tn10 mutant and the wild type each caused 100% ± 0.0% mortality [mean ± standard error]; n = 3; P > 0.05). The yigL1::Tn10 mutant grew as well as or better than the wild type in the exponential phase of growth in Luria-Bertani broth (0.42 ± 0.13 doublings per hour ± standard deviation compared to 0.39 ± 0.17 for wild-type X. nematophila; P = 0.30; n = 2) (31), in defined medium with glucose as a carbon source (0.23 ± 0.00 for the yigL1::Tn10 mutant; 0.23 ± 0.00 for the wild type; P > 0.05; n = 2) (32), or in insect blood (0.22 ± 0.02 for the yigL1::Tn10 mutant; 0.23 ± 0.01 for the wild type; P > 0.05; n = 2) (hemolymph prepared as previously described [32]), indicating that a growth defect is unlikely to be the cause of virulence attenuation.

To further explore the role of yigL during X. nematophila infection, we assessed the ability of the yigL1::Tn10 mutant to modulate insect immunity. X. nematophila suppresses induction of several antimicrobial peptides, including cecropin (19, 27, 36). Suppression of M. sexta cecropin induction was monitored by injecting 10⁵ bacterial CFU into M. sexta and measuring cecropin levels using qPCR and relevant primers (Table 2) as described previously (7, 36). Insects injected with the yigL1::Tn10 mutant or wild-type X. nematophila did not induce cecropin levels as did those injected with Salmonella enterica serovar Typhimurium (Fig. 3B), indicating that YigL is not essential for cecropin suppression or that the yigL mutant fails to induce an immune response. Other potential roles of YigL during infection may be in suppression of cellular immunity (36, 37) or production of virulence determinants (e.g., toxins). Alternatively, the yigL mutant may have a lipase-independent metabolic defect that reduces its fitness in the insect host environment. If so, the fitness cost associated with this defect is specific to the insect environment, since the yigL1::Tn10 mutant displays wild-type levels of colonization of the infective-stage nematode Steinernema carpocapsae, the animal that transmits X. nematophila between insect hosts (47.5 ± 10.8 CFU per nematode ± standard error compared to 43.0 ± 0.3 CFU per nematode for the wild type; n = 2; P > 0.05) (17, 21).

Conclusions.

The biochemical function of X. nematophila YigL remains to be determined, and it must be established if the mutations of the metabolic class genes identified in this study are responsible for the loss of lipase activity. However, our evidence indicates that the lipase deficiency of these X. nematophila mutants may occur due to perturbation of carbohydrate, nucleic acid, and lipid metabolism and that YigL is a component of one or more of these pathways, possibly by virtue of its predicted broad substrate phosphatase activity.