Abstract
Identification of new immunogenic antigens that diagnose initial Pseudomonas aeruginosa infections in patients with cystic fibrosis (CF) alone or as an adjunct to microbiology is needed. In the present study, a proteomic analysis was performed to obtain a global assessment of the host immune response during the initial P. aeruginosa infection of patients with CF. Matrix-assisted laser desorption ionization-time of flight mass spectrometry was used to identify outer membrane protein L (OprL), a non-type III secretion system (TTSS) protein, as an early immunogenic protein during the initial P. aeruginosa infection of patients with CF. Longitudinal Western blot analysis of sera from 12 of 14 patients with CF detected antibodies to OprL during the initial P. aeruginosa infection. In addition, also detected were antibodies to ExoS, ExoU, or ExoS and ExoU, the latter indicating sequential P. aeruginosa infections during initial infections. Detection of serum reactivity to OprL, along with proteins of the TTSS, and in conjunction with microbiology may diagnose initial P. aeruginosa infections in patients with CF.
Cystic fibrosis (CF) is an autosomal recessive multisystem disease which is caused by mutations in the CF transmembrane conductance receptor. Patients with CF have chronic respiratory infections which are the primary cause of morbidity and premature mortality (16). Patients with CF are infected with bacterial pathogens on an age-dependent timeline (16). Typically, Staphylococcus aureus and nonencapsulated Haemophilus influenzae are the first isolates from infants with CF (34, 35). However, Pseudomonas aeruginosa infections in children with CF are associated with progressive lung disease (30, 33). Microbiology is used for the diagnosis of P. aeruginosa, but successful P. aeruginosa isolation can be complicated in nonexpectorating populations of infants and young children with CF (4). The diagnosis and eradication of the initial P. aeruginosa infection with antibiotics to prevent chronic infection and mucoid transformation are important, since this diagnosis influences the quality of life and long-term patient survival (1, 2, 7, 11, 29, 30). Non-culture-based tests, like serology, should assist microbiology in the early diagnosis of P. aeruginosa infection.
P. aeruginosa serology continues to be challenging without defined commercially available antigens licensed in the United States that reflect the molecular pathogenesis of P. aeruginosa upon adaptation to the host environment (13). Høiby (24) and Döring and Høiby (10) have detected an antibody response against a pool of antigens from common P. aeruginosa serotypes. Elevating antibody titers against this pool of antigens correlated with worsening P. aeruginosa infections and a poor clinical prognosis. The clinical progression of CF lung disease may be a reflection of the molecular pathogenesis of P. aeruginosa. Recent studies have correlated serological reactivity and known P. aeruginosa virulence factors. West et al. (42) showed that during the initial P. aeruginosa infection of children with CF, detection of serum antibodies to exotoxin A (ETA) and a P. aeruginosa lysate occurred earlier than detection of serum antibodies to elastase or alkaline phosphatase; subsequently, Corech et al. (6) detected antibodies to components of the type III secretion system (TTSS) at a time similar to that of P. aeruginosa Sup and earlier than ETA, showing the potential of measuring the antibody response to components of the TTSS as an indication of initial infection with P. aeruginosa in children with CF. This also indicated a role for TTSS in the initial P. aeruginosa pathogenesis of the CF lung.
In the present study, a proteomic analysis was performed to obtain a global assessment of the host immune response during the initial P. aeruginosa infection of patients with CF. The goal was to identify a cellular component of P. aeruginosa that elicits an early immune response to P. aeruginosa infection to provide a stable immunogenic indication of P. aeruginosa infection relative to P. aeruginosa virulence factors that may fluctuate in expression during the course of P. aeruginosa infection, especially following transition from the acute to the chronic infection phase (41). Outer membrane protein L (OprL), a non-TTSS protein, was identified as an early immunogenic protein in the initial P. aeruginosa infection of patients with CF.
MATERIALS AND METHODS
Study participants.
The Wisconsin CF Neonatal Screening Project is a longitudinal study to assess the potential benefits and risks of newborn screening for CF; its design and purpose have been described elsewhere (12, 20). The present study was performed with a convenience sample that included newborns recruited from April 1985 through June 1994 and comprised longitudinal samples from 14 patients who were followed at the Milwaukee CF Center after being diagnosed with CF. A presumptive diagnosis of CF was confirmed with a positive sweat test. After consent for participation was obtained from their parents, patients were enrolled at the Milwaukee CF Center and managed clinically with an evaluation-and-treatment protocol. During the study, sera were obtained, matched with microbiology in time, and stored at −80°C. The longitudinal analysis was performed with currently available serum samples from these patients. The Research and Publications Committee/Human Rights Board at Children's Hospital of Wisconsin, Milwaukee, WI, and the University of Wisconsin—Madison approved the Wisconsin CF Neonatal Screening Project and the Pseudomonas study reported herein.
Oropharyngeal secretion samples.
Oropharyngeal secretions were obtained and cultured for P. aeruginosa as part of the longitudinal evaluation protocol. Additional samples were obtained as needed at the request of the examining physician. For infants and young children who could not cough on instruction, research nurses swabbed the oropharynx with swabs from the BD Culturette collection and transport system (Becton Dickinson & Co., Franklin Lakes, NJ) until the child coughed. Patients who could cough on instruction were asked to cough, and the nurse swabbed the oropharynx until the patient coughed. Expectorated sputum samples (<10% of the specimens) were obtained from patients who could produce such samples.
Quantification of anti-P. aeruginosa antibodies in serum from children with CF.
The ExoS, PcrV, ExoU, and PopB proteins used in this analysis were prepared as previously described (6). P. aeruginosa cell lysate was prepared from a 6-h or overnight culture supernatant of P. aeruginosa PAO1 that was provided by Steven L. Lory (Harvard Medical School). P. aeruginosa was grown in LB for 6 h or overnight with shaking at 37οC. Cells were pelleted (12,000 × g for 20 min), and the spent culture supernatant was subjected to ammonium sulfate precipitation (65% final concentration). This cell fraction was suspended to ∼1 μg of protein per μl. P. aeruginosa Sup was used as a source of P. aeruginosa proteins for Western blotting and enzyme-linked immunosorbent assay (ELISA). A prior study (6) showed that for a subset of sera from patients with CF, immune reactivity to antigens in the P. aeruginosa Sup was equal to or greater than that to antigens in the membrane or cytosol fraction.
Cloning of the gene encoding P. aeruginosa OprL and expression and purification of recombinant OprL from Escherichia coli.
The oprL gene was PCR amplified from PAO1 DNA with 5′ (5′ GATCGACATATGGAAATGCTGAAATTCGGCAAATTTGCT 3′) and 3′ (5′ AGCTAGGGTACCTTACTTCTTCAGCTCGACGCGACG 3′) oligonucleotide primers, verified, and subcloned into pET28b at the NdeI and KpnI restriction sites (in bold in the primer sequences). pET28b-oprL was transformed into E. coli BL21(DE3), and transformants were maintained as glycerol stocks at −80°C. A liquid culture of E. coli(pET28-oprL) was inoculated into 400 ml LB and incubated for 2 h at 30°C, when 1.0 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was added and the incubation was continued for an additional 2 h at 30°C. Bacteria was pelleted at 6,000 × g for 20 min. The supernatant was discarded, and the pellets were suspended in 5 ml of binding buffer (20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 5 mM imidazole) containing RNase, DNase, and protease inhibitor cocktail. Cells were broken by three passes through a French press; the broken cell suspension was centrifuged at 35,000 × g for 20 min. The pellet was suspended in 10 ml of binding buffer containing 1% Triton X-100 and placed on a rotator overnight at 4°C. This suspension was then centrifuged at 12,000 × g for 30 min, and the soluble fraction containing recombinant OrpL (rOprL) was subjected to size exclusion chromatography (Sephracyl 200, 200 ml column resin, in binding buffer plus 1% Triton X-100, 4°C). Fractions (4 ml) were collected, and the peak fractions containing rOprL were pooled and stored at −80°C. One-dimensional sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) analysis showed that rOprL was a single band by Coomassie staining (data not shown).
PAGE.
SDS-PAGE and two-dimensional (2D) PAGE were performed with normalized protein loads by using a bovine serum albumin (BSA; Pierce Chemicals) standard.
Western blotting.
Proteins were separated by SDS-PAGE (1 μg of ExoS, ExoU, PcrV, PopB, OprL, or P. aeruginosa Sup) or 2D PAGE (P. aeruginosa Sup) and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked in buffer containing 0.1% Tween 20 and 2% dry milk and subjected to Western blotting. Membranes were incubated with the indicated sera (1:4,000 final dilution) in buffer containing 0.1% Tween 20 and 2% dry milk for 1 h at room temperature (RT). Blots were washed three times with buffer containing 0.5% Tween 20 before incubation with a secondary antibody (goat anti-human immunoglobulin G [IgG]-horseradish peroxidase [HRP]) at a 1:100,000 dilution (31410; Pierce Chemicals) for 1 h at RT. Blots were washed three times with buffer containing 0.5% Tween 20, incubated in Super Signal West Pico (Pierce Chemicals) for 5 min, and exposed to X-ray film.
ELISA analysis of serum antibody titers.
An ELISA was performed in a 96-well plate format (9018; Corning, Costar) with antigen amounts of 50 to 200 ng of purified protein in 50 mM sodium carbonate buffer, pH 9.6 (100 μl). Plates were incubated overnight at 4°C, washed four times with 250 μl of phosphate-buffered saline, and blocked with 100 μl of 50 mM sodium carbonate (pH 9.6) with 2% BSA for 1 h at RT. Next, serum (100 μl diluted to 1/250 in phosphate-buffered saline plus 2% BSA) was added and the mixture was incubated for 1 h. After the wells were washed, a secondary antibody (goat anti-human IgG-HRP; 100 μl of a 1:10,000 final dilution plus 1% BSA was added for 1 h of incubation, after which the plates were washed and developed with 3,3′,5,5′-tetramethylbenzidine (Pierce Chemicals). Absorbance was read at 450 nm. Seroconversion was scored positive when the absorbance was 0.2 U above the background (6).
RESULTS
Identification of OprL as an early immunogenic P. aeruginosa protein during the initial P. aeruginosa infection of patients with CF.
A previous study (6) observed the seroconversion to components and cytotoxins of the P. aeruginosa TTSS, specifically, PopB, ExoS, and PcrV, which provided a serological indication of the initial P. aeruginosa infection of patients with CF. To determine the scope of the immune response to this initial P. aeruginosa infection, Western blot assays were performed with PAO1 cell lysates subjected to 2D PAGE by using sera from patients with CF as the primary antibody. An analysis of 14 patient sera showed a heterogeneous antibody response to P. aeruginosa infection, with ∼20 P. aeruginosa proteins eliciting an immune response during the initial stage of infection of children with CF. A representative Western blot assay is shown in Fig. 1. Two immunoreactive spots (no. 10 and 17 in Fig. 1) were identified that did not correlate with previously identified TTSS proteins. Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and Protein Prospector analysis identified the proteins within spots 10 and 17. Two P. aeruginosa proteins were detected in spot 10: outer membrane protein H1, matching nine tryptic peptides with 58% matched peptide coverage (NCBI accession no. AAG04567), and OprL, matching six tryptic peptides with 44% matched peptide coverage (NCBI accession no. NP249664). One P. aeruginosa protein was identified in spot 17, i.e., aconitate hydratase, matching nine tryptic peptides with 15% matched peptide coverage (NCBI accession no. NP250478). Since the oprL gene has been detected by reverse transcriptase PCR during P. aeruginosa infections of patients with CF (37), OprL was subjected to further analysis.
FIG. 1.
Immunoreactivity of sera from a patient with CF. P. aeruginosa Sup (15 μg of protein) was subjected to 2D SDS-PAGE with a pH 3 to 10 isoelectric focusing (IEF) strip, followed by 12% SDS-PAGE. Proteins were transferred to PVDF membranes, blocked, and subjected to Western blotting with serum from a patient with CF. Blots were washed, incubated with a secondary antibody (goat anti-human IgG-HRP), washed, incubated in Super Signal West Pico, and exposed to X-ray film. An image of the X-ray is shown. Blots were also probed for ExoS. Proteins 10 and 17, which migrated differently than known TTSS proteins (arrows) were subjected to MALDI-TOF MS. The serum sample used to generate this figure was chosen based upon the presence of antibodies to numerous P. aeruginosa proteins which could be resolved into ∼20 distinct immunoreactive dots.
Patients with CF show early seroconversion to OprL and TTSS antigens during initial P. aeruginosa infections.
Fourteen sera from children with CF were tested longitudinally on available serum samples for reactivity to OprL and TTSS proteins (Table 1). Thirteen of the 14 sera were seroreactive to ExoS, ExoU, PopB, PcrV, or OprL. Twelve of the 14 sera were reactive to OprL. Of the 12 OprL-positive sera, 5 converted to OprL antibody positivity alone or with ExoS or ExoU before antibodies to other components of the TTSS (PopB or PcrV) were detected. With respect to seroreactivity to type III cytotoxins, 10 of the 14 sera were reactive to ExoS, 1 was reactive to ExoU, and 2 were reactive to ExoU and ExoS, suggesting a mixed initial P. aeruginosa infection, since P. aeruginosa isolates typically possess either the exoU or the exoS cytotoxin-encoding gene but not both (14). Longitudinal analysis of one serum that was seroreactive to ExoS and ExoU (Fig. 2) showed an initial immune reactivity to OprL and the subsequent appearance of an immune response to TTSS proteins, including ExoU. At the next chronological serum sample, an antibody response to ExoS was also detected, suggesting that the patient had been superinfected with a second strain of P. aeruginosa. One patient did not show serum reactivity to either TTSS or OprL, and clinical analysis determined that this patient had no P. aeruginosa cultured during the time of this analysis. This suggests that like the host immune response to the TTSS, that to OprL is early. Serological analysis, along with corresponding time-matched microbiology, is also reported in Table 1.
TABLE 1.
Longitudinal analysis of serum reactivity to TTSS proteins and OprL and P. aeruginosa microbiology of children with CF
| Patient and age (yr) at time of serum collection | Antibody reactivitya
|
P. aeruginosa microbiologyb | ||||
|---|---|---|---|---|---|---|
| ExoS | ExoU | PopB | PerV | OprL | ||
| 1 | ||||||
| 0.47 | − | − | − | − | − | − |
| 1.99 | − | + | − | − | + | − |
| 6.02 | − | + | + | + | + | − |
| 2 | ||||||
| 0.98 | + | − | − | − | − | − |
| 4.11 | + | − | + | + | + | P. aeruginosa |
| 5.59 | + | − | + | + | − | P. aeruginosa |
| 3 | ||||||
| 2.50 | − | − | − | − | − | ND |
| 4.94 | + | − | + | + | − | − |
| 6.70 | + | − | + | + | + | − |
| 4 | ||||||
| 5.02 | + | + | + | + | + | P. aeruginosa |
| 6.50 | + | + | + | + | + | P. aeruginosa |
| 8.05 | + | + | + | + | + | − |
| 5 | ||||||
| 2.03 | + | − | + | + | + | − |
| 5.95 | + | − | + | + | + | P. aeruginosa |
| 7.08 | + | − | + | + | + | P. aeruginosa |
| 6 | ||||||
| 0.47 | − | − | − | − | − | − |
| 2.00 | + | − | + | + | + | − |
| 3.56 | + | − | + | + | + | − |
| 7 | ||||||
| 1.25 | − | − | − | − | + | − |
| 7.02 | + | − | + | + | + | − |
| 9.00 | + | − | + | + | + | ND |
| 8 | S | U | B | V | L | |
| 1.53 | + | − | − | − | + | − |
| 2.51 | + | − | + | − | − | − |
| 3.52 | + | − | + | + | + | − |
| 9 | ||||||
| 4.07 | − | − | − | − | − | − |
| 5.03 | − | − | − | − | − | − |
| 6.12 | − | − | − | − | − | ND |
| 10 | ||||||
| 1.50 | + | − | + | + | + | P. aeruginosa |
| 2.95 | + | − | + | + | + | P. aeruginosa |
| 3.51 | + | − | + | + | + | P. aeruginosa |
| 11 | ||||||
| 2.01 | − | − | − | − | − | − |
| 6.09 | + | − | + | + | − | P. aeruginosa |
| 9.56 | − | − | − | + | − | ND |
| 12 | ||||||
| 1.52 | + | − | + | + | + | − |
| 2.53 | + | − | + | + | + | − |
| 3.99 | + | − | − | − | − | − |
| 13 | ||||||
| 1.24 | − | − | − | − | + | − |
| 3.41 | + | − | + | + | + | − |
| 7.15 | + | − | + | + | + | − |
| 14 | ||||||
| 0.63 | − | − | − | − | + | P. aeruginosa |
| 3.57 | − | + | + | + | + | − |
| 9.53 | + | + | + | + | + | P. aeruginosa |
A 1.0-μg sample of the indicated antigen was probed by Western blotting with the indicated timed serum from the patient indicated and scored for the absence of detectable antibody reactivity (−) or the presence of a visible antibody-reactive band (+). Representative films are shown in Fig. 2.
Microbiology was determined by oropharyngeal secretion culture as described in Materials and Methods. A minus sign indicates that P. aeruginosa was not isolated, P. aeruginosa indicates that nonmucoid P. aeruginosa was isolated, and ND indicates that a culture was not performed.
FIG. 2.
Longitudinal reactivity of serum to Oprl and TTSS proteins. Proteins ExoS (S), ExoU (U), PcrV (V), PopB (B), and OprL (L) and P. aeruginosa Sup (Ly) (1.0 μg of protein) were separated by 12% SDS-PAGE. Proteins were transferred to PVDF membranes, blocked, and subjected to Western blotting with serum from three sequential blood samples drawn from patient 14 (referenced in Table 1). Blots were washed and incubated with a secondary antibody (goat anti-human IgG-HRP), washed, and incubated in Super Signal. The blot was exposed to X-ray film. The upper to lower panels represent early to late times of collection; images are of identically timed exposures to X-ray film. The migration of protein markers is shown to the left of the film.
ELISA reactivity of sera from a patient with CF.
Based on the Western blot analysis, an ELISA was used to measure the titers of the immune responses to OprL and PopB. Figure 3 shows an ELISA from one serum (patient 14) where seroconversion to OprL and PopB was observed. The ELISA showed a dose-dependent antibody response to both OprL and PopB, where the response to PopB appears to plateau at a lower antigen concentration before the response to OprL.
FIG. 3.
ELISA of OprL and PopB in serum from a patient with CF. An ELISA was performed with OprL or PopB (50 to 200 ng). Plates were blocked and incubated with the indicated diluted serum from patient 5 (1/500 to 1/16,000, expressed as a reciprocal number) or without a primary antibody. Wells were washed and incubated with 100 μl of a secondary antibody (goat anti-human at a 1:10,000 final dilution) and then washed and developed with 3,3′,5,5′-tetramethylbenzidine. Absorbance was read at 450 nm (OD 450).
DISCUSSION
The initial detection of P. aeruginosa infection in children with CF provides an opportunity for therapeutic intervention prior to P. aeruginosa transition to mucoidy (9), since there is no approved therapy for the correction of the underlying genetic defect of CF. Serology as a diagnostic tool for nonmucoid P. aeruginosa detection or differentiation of nonmucoid from mucoid P. aeruginosa infection remains controversial, as there is no defined sequence of antigens or non-culture-based tests to aid in this distinction (13). Several studies have propagated serology and various antigens to diagnose initial P. aeruginosa infections (26, 38, 39, 42). Ratjen et al. (38) recently analyzed serum antibodies against alkaline protease, elastase, and ETA to define seroreactivity for the early diagnosis of P. aeruginosa infection in CF patients. The study observed that 43% of patients were positive for at least one of the three serum antibodies at the onset of the initial P. aeruginosa infection. Antibodies against these antigens were significantly higher in patients chronically infected with P. aeruginosa. Tramper-Stranders et al. (39) used the same antigens and reported that these specific antigens are more sensitive for the diagnosis of chronic P. aeruginosa infection and emphasized the need for continued reliance on culture for the detection of nonmucoid P. aeruginosa infection. A recent report (36) addressed the diagnostic significance of the serum reactivity of three serological methods (ETA ELISA, crossed immunoelectrophoresis, and Pseudomonas-CF IgG ELISA) to identify CF patients with different infection statuses. This study observed a high sensitivity and specificity of the three methods for the detection of chronic P. aeruginosa infection and showed the importance of establishing serological methods to diagnose initial P. aeruginosa infections. Fomsgaard et al. (18, 19) used purified lipopolysaccharide in a longitudinal study of antibody responses during chronic P. aeruginosa infection in CF patients and reported that anti-lipopolysaccharide titers increased with the duration of P. aeruginosa infection, while Kronborg et al. (31) reported similar results for the serum antibody response during chronic P. aeruginosa infection. In the present study, P. aeruginosa OprL was observed to elicit an early immune response during the initial infection of children with CF, making the conversion to seropositivity to OprL, along with the detection of seroreactivity to TTSS antigens and P. aeruginosa microbiology, a potentially useful diagnostic tool to detect initial P. aeruginosa infections (6). The data in the present study are preliminary, having been obtained from a small group of patients with CF. A prospective study with OprL, along with TTSS proteins, is needed to identify the optimal antigen panels for the diagnosis of initial P. aeruginosa infections in children with CF.
Quorum sensing (QS), cell-to-cell signaling, may also influence the success of an initial P. aeruginosa infection. QS involves the production of compounds that allow a bacterial population to “sense” its own status, as well as that of other bacteria in the environment (28). Earlier studies have indicated a role for outer membrane proteins in clinical aspects of P. aeruginosa infections. Wu et al. demonstrated that P. aeruginosa outer membrane proteins enhance QS virulence expression by binding to gamma interferon (44), while Bleves et al. showed that P. aeruginosa TTSS expression is regulated by QS mechanisms (3). P. aeruginosa outer membrane proteins were shown to be conserved and immunogenic (5, 32), with an antibody response specific for the diagnosis of P. aeruginosa infections (8, 25, 43, 45). Whiteley et al. reported that QS genes in P. aeruginosa could be divided into genes that are expressed early or late during chronic P. aeruginosa infection (43). In addition, the composition of outer membrane proteins was altered in nonmucoid versus mucoid strains of P. aeruginosa (22, 23, 27).
Feltman et al. (14) studied the prevalence of type III secretion genes in clinical and environmental isolates of P. aeruginosa. Of the 115 isolates examined, all were found to contain PopB and ExoT, while 72% contained ExoS, 28% contained ExoU, and 89% contained ExoY. There was an inverse correlation between the expression of ExoU and that of ExoS in all of the isolates except two (14, 15, 17). Within the present study population, serum antibodies to ExoU, ExoS, or both ExoU and ExoS were detected. This suggested that these patients were infected sequentially with P. aeruginosa strains that expressed ExoS or ExoU. ExoS facilitates invasion and cytotoxicity, while ExoU facilitates acute cytotoxicity (21, 40). Acute infection by clonal P. aeruginosa isolates expressing ExoS or ExoU or a mixed P. aeruginosa infection may contribute to unique progressive structural injury to the airways and lungs in identical CF genotypes. This leads to the hypothesis that type III cytotoxin genetic variability in P. aeruginosa (termed “bacterial gene modifiers”) may represent a bacterial equivalent to host gene modifiers that have been implicated in contributing to the severity and variability of lung disease due to P. aeruginosa infections in patients with CF. This hypothesis needs to be examined prospectively in a larger study with patients with similar genotypes and variable lung disease.
Understanding the molecular pathogenesis of P. aeruginosa infection and identification of additional immunogenic P. aeruginosa proteins will help clinicians diagnose initial P. aeruginosa infections. Our present study identified a non-type-III antigen, OprL, which elicited an early immune response to the initial P. aeruginosa infection of patients with CF. The identification of the initial seroconversion to OprL implies a role for this protein in initial P. aeruginosa infection. Early diagnosis of P. aeruginosa infections may allow antibiotic therapies to eradicate the pathogen and prevent the transformation to mucoid P. aeruginosa and thus slow the progression of lung disease during the transition of children with CF to adulthood.
Acknowledgments
The technical assistance of Risa Corech, Na Li, Amanda Przedpelski, Cherisse Hall, and other members of the Barbieri laboratory is acknowledged. MALDI-TOF MS was performed at the Medical College of Wisconsin Protein Nucleic Acid Facility.
This research was supported by a Cystic Fibrosis Foundation grant (BarbieX) (J.T.B.), National Institutes of Health grants DK 34108 and M01 RR03186 (P.M.F.), Cystic Fibrosis Foundation grant A001-5-01, and Children's Research Institute grant 9203887 (A.R.R.).
Footnotes
Published ahead of print on 24 June 2009.
REFERENCES
- 1.Aebi, C., R. Bracher, S. Liechti-Gallati, H. Tschappeler, A. Rudeberg, and R. Kraemer. 1995. The age at onset of chronic Pseudomonas aeruginosa colonization in cystic fibrosis—prognostic significance. Eur. J. Pediatr. 154S69-S73. [DOI] [PubMed] [Google Scholar]
- 2.Baumann, U., C. Stocklossa, W. Greiner, J. M. von der Schulenburg, and H. von der Hardt. 2003. Cost of care and clinical condition in paediatric cystic fibrosis patients. J. Cyst. Fibros. 284-90. [DOI] [PubMed] [Google Scholar]
- 3.Bleves, S., C. Soscia, P. Nogueira-Orlandi, A. Lazdunski, and A. Filloux. 2005. Quorum sensing negatively controls type III secretion regulon expression in Pseudomonas aeruginosa PAO1. J. Bacteriol. 1873898-3902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Burns, J. L., R. L. Gibson, S. McNamara, D. Yim, J. Emerson, M. Rosenfeld, P. Hiatt, K. McCoy, R. Castile, A. L. Smith, and B. W. Ramsey. 2001. Longitudinal assessment of Pseudomonas aeruginosa in young children with cystic fibrosis. J. Infect. Dis. 183444-452. [DOI] [PubMed] [Google Scholar]
- 5.Chen, Y. H., R. E. Hancock, and R. I. Mishell. 1980. Mitogenic effects of purified outer membrane proteins from Pseudomonas aeruginosa. Infect. Immun. 28178-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Corech, R., A. Rao, A. Laxova, J. Moss, M. J. Rock, Z. Li, M. R. Kosorok, M. L. Splaingard, P. M. Farrell, and J. T. Barbieri. 2005. Early immune response to the components of the type III system of Pseudomonas aeruginosa in children with cystic fibrosis. J. Clin. Microbiol. 433956-3962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Demko, C. A., P. J. Byard, and P. B. Davis. 1995. Gender differences in cystic fibrosis: Pseudomonas aeruginosa infection. J. Clin. Epidemiol. 481041-1049. [DOI] [PubMed] [Google Scholar]
- 8.De Vos, D., A. Lim, Jr., J. P. Pirnay, M. Struelens, C. Vandenvelde, L. Duinslaeger, A. Vanderkelen, and P. Cornelis. 1997. Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. J. Clin. Microbiol. 351295-1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Döring, G., S. P. Conway, H. G. Heijerman, M. E. Hodson, N. Høiby, A. Smyth, and D. J. Touw. 2000. Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur. Respir. J. 16749-767. [DOI] [PubMed] [Google Scholar]
- 10.Döring, G., and N. Høiby. 1983. Longitudinal study of immune response to Pseudomonas aeruginosa antigens in cystic fibrosis. Infect. Immun. 42197-201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Emerson, J., M. Rosenfeld, S. McNamara, B. Ramsey, and R. L. Gibson. 2002. Pseudomonas aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis. Pediatr. Pulmonol. 3491-100. [DOI] [PubMed] [Google Scholar]
- 12.Farrell, P. M. 2000. Improving the health of patients with cystic fibrosis through newborn screening. Adv. Pediatr. 4779-115. [PubMed] [Google Scholar]
- 13.Farrell, P. M., and J. R. Govan. 2006. Pseudomonas serology: confusion, controversy, and challenges. Thorax 61645-647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Feltman, H., G. Schulert, S. Khan, M. Jain, L. Peterson, and A. R. Hauser. 2001. Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiology 1472659-2669. [DOI] [PubMed] [Google Scholar]
- 15.Finck-Barbançon, V., J. Goranson, L. Zhu, T. Sawa, J. P. Wiener-Kronish, S. M. Fleiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997. ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol. Microbiol. 25547-557. [DOI] [PubMed] [Google Scholar]
- 16.FitzSimmons, S. C. 1993. The changing epidemiology of cystic fibrosis. J. Pediatr. 1221-9. [DOI] [PubMed] [Google Scholar]
- 17.Fleiszig, S. M., J. P. Wiener-Kronish, H. Miyazaki, V. Vallas, K. E. Mostov, D. Kanada, T. Sawa, T. S. Yen, and D. W. Frank. 1997. Pseudomonas aeruginosa-mediated cytotoxicity and invasion correlate with distinct genotypes at the loci encoding exoenzyme S. Infect. Immun. 65579-586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Fomsgaard, A., B. Dinesen, G. H. Shand, T. Pressler, and N. Høiby. 1989. Antilipopolysaccharide antibodies and differential diagnosis of chronic Pseudomonas aeruginosa lung infection in cystic fibrosis. J. Clin. Microbiol. 271222-1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Fomsgaard, A., N. Høiby, G. H. Shand, R. S. Conrad, and C. Galanos. 1988. Longitudinal study of antibody response to lipopolysaccharides during chronic Pseudomonas aeruginosa lung infection in cystic fibrosis. Infect. Immun. 562270-2278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Fost, N., and P. M. Farrell. 1989. A prospective randomized trial of early diagnosis and treatment of cystic fibrosis: a unique ethical dilemma. Clin. Res. 37495-500. [PubMed] [Google Scholar]
- 21.Frank, D. W. 1997. The exoenzyme S regulon of Pseudomonas aeruginosa. Mol. Microbiol. 26621-629. [DOI] [PubMed] [Google Scholar]
- 22.Grabert, E., J. Wingender, and U. K. Winkler. 1990. An outer membrane protein characteristic of mucoid strains of Pseudomonas aeruginosa. FEMS Microbiol. Lett. 5683-87. [DOI] [PubMed] [Google Scholar]
- 23.Hanna, S. L., N. E. Sherman, M. T. Kinter, and J. B. Goldberg. 2000. Comparison of proteins expressed by Pseudomonas aeruginosa strains representing initial and chronic isolates from a cystic fibrosis patient: an analysis by 2-D gel electrophoresis and capillary column liquid chromatography-tandem mass spectrometry. Microbiology 146(Pt. 10)2495-2508. [DOI] [PubMed] [Google Scholar]
- 24.Høiby, N. 1977. Pseudomonas aeruginosa infection in cystic fibrosis. Diagnostic and prognostic significance of pseudomonas aeruginosa precipitins determined by means of crossed immunoelectrophoresis. A survey. Acta Pathol. Microbiol. Scand. Suppl. 2621-96. [PubMed] [Google Scholar]
- 25.Jaffe, R. I., J. D. Lane, and C. W. Bates. 2001. Real-time identification of Pseudomonas aeruginosa direct from clinical samples using a rapid extraction method and polymerase chain reaction (PCR). J. Clin. Lab. Anal. 15131-137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Johansen, H. K., L. Nørregaard, P. C. Gøtzsche, T. Pressler, C. Koch, and N. Høiby. 2004. Antibody response to Pseudomonas aeruginosa in cystic fibrosis patients: a marker of therapeutic success?—A 30-year cohort study of survival in Danish CF patients after onset of chronic P. aeruginosa lung infection. Pediatr. Pulmonol. 37427-432. [DOI] [PubMed] [Google Scholar]
- 27.Kelly, N. M., M. H. MacDonald, N. Martin, T. Nicas, and R. E. Hancock. 1990. Comparison of the outer membrane protein and lipopolysaccharide profiles of mucoid and nonmucoid Pseudomonas aeruginosa. J. Clin. Microbiol. 282017-2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Klemm, P., and M. A. Schembri. 2000. Bacterial adhesins: function and structure. Int. J. Med. Microbiol. 29027-35. [DOI] [PubMed] [Google Scholar]
- 29.Koch, C. 2002. Early infection and progression of cystic fibrosis lung disease. Pediatr. Pulmonol. 34232-236. [DOI] [PubMed] [Google Scholar]
- 30.Kosorok, M. R., L. Zeng, S. E. West, M. J. Rock, M. L. Splaingard, A. Laxova, C. G. Green, J. Collins, and P. M. Farrell. 2001. Acceleration of lung disease in children with cystic fibrosis after Pseudomonas aeruginosa acquisition. Pediatr. Pulmonol. 32277-287. [DOI] [PubMed] [Google Scholar]
- 31.Kronborg, G., A. Fomsgaard, C. Galanos, M. A. Freudenberg, and N. Høiby. 1992. Antibody responses to lipid A, core, and O sugars of the Pseudomonas aeruginosa lipopolysaccharide in chronically infected cystic fibrosis patients. J. Clin. Microbiol. 301848-1855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Lam, J. S., L. M. Mutharia, R. E. Hancock, N. Høiby, K. Lam, L. Baek, and J. W. Costerton. 1983. Immunogenicity of Pseudomonas aeruginosa outer membrane antigens examined by crossed immunoelectrophoresis. Infect. Immun. 4288-98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Li, Z., M. R. Kosorok, P. M. Farrell, A. Laxova, S. E. West, C. G. Green, J. Collins, M. J. Rock, and M. L. Splaingard. 2005. Longitudinal development of mucoid Pseudomonas aeruginosa infection and lung disease progression in children with cystic fibrosis. JAMA 293581-588. [DOI] [PubMed] [Google Scholar]
- 34.May, J. R., N. C. Herrick, and D. Thompson. 1972. Bacterial infection in cystic fibrosis. Arch. Dis. Child. 47908-913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Mearns, M. B., G. H. Hunt, and R. Rushworth. 1972. Bacterial flora of respiratory tract in patients with cystic fibrosis, 1950-71. Arch. Dis. Child. 47902-907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Pressler, T., F. Karpati, M. Granstrom, P. K. Knudsen, L. Anders, H. Lena, H. V. Olesen, P. Meyer, and N. Høiby. 2009. Diagnostic significance of measurements of specific IgG antibodies to Pseudomonas aeruginosa by three different serological methods. J. Cyst. Fibros. 837-42. [DOI] [PubMed] [Google Scholar]
- 37.Qin, X., J. Emerson, J. Stapp, L. Stapp, P. Abe, and J. L. Burns. 2003. Use of real-time PCR with multiple targets to identify Pseudomonas aeruginosa and other nonfermenting gram-negative bacilli from patients with cystic fibrosis. J. Clin. Microbiol. 414312-4317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ratjen, F., H. Walter, M. Haug, C. Meisner, H. Grasemann, and G. Döring. 2007. Diagnostic value of serum antibodies in early Pseudomonas aeruginosa infection in cystic fibrosis patients. Pediatr. Pulmonol. 42249-255. [DOI] [PubMed] [Google Scholar]
- 39.Tramper-Stranders, G. A., C. K. van der Ent, and T. F. Wolfs. 2005. Detection of Pseudomonas aeruginosa in patients with cystic fibrosis. J. Cyst. Fibros. 4(Suppl. 2)37-43. [DOI] [PubMed] [Google Scholar]
- 40.Vallis, A. J., V. Finck-Barbancon, T. L. Yahr, and D. W. Frank. 1999. Biological effects of Pseudomonas aeruginosa type III-secreted proteins on CHO cells. Infect. Immun. 672040-2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg. Infect. Dis. 4551-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.West, S. E., L. Zeng, B. L. Lee, M. R. Kosorok, A. Laxova, M. J. Rock, M. J. Splaingard, and P. M. Farrell. 2002. Respiratory infections with Pseudomonas aeruginosa in children with cystic fibrosis: early detection by serology and assessment of risk factors. JAMA 2872958-2967. [DOI] [PubMed] [Google Scholar]
- 43.Whiteley, M., K. M. Lee, and E. P. Greenberg. 1999. Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 9613904-13909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wu, L., O. Estrada, O. Zaborina, M. Bains, L. Shen, J. E. Kohler, N. Patel, M. W. Musch, E. B. Chang, Y. X. Fu, M. A. Jacobs, M. I. Nishimura, R. E. Hancock, J. R. Turner, and J. C. Alverdy. 2005. Recognition of host immune activation by Pseudomonas aeruginosa. Science 309774-777. [DOI] [PubMed] [Google Scholar]
- 45.Xu, J., J. E. Moore, P. G. Murphy, B. C. Millar, and J. S. Elborn. 2004. Early detection of Pseudomonas aeruginosa—comparison of conventional versus molecular (PCR) detection directly from adult patients with cystic fibrosis (CF). Ann. Clin. Microbiol. Antimicrob. 321. [DOI] [PMC free article] [PubMed] [Google Scholar]