Abstract
The p53 tumor suppressor serves as a crucial barrier against cancer development. In tumor cells and their progenitors, p53 suppresses cancer in a cell-autonomous manner. However, p53 also possesses non-cell-autonomous activities. For example, p53 of stromal fibroblasts can modulate the spectrum of proteins secreted by these cells, rendering their microenvironment less supportive of the survival and spread of adjacent tumor cells. We now report that epithelial tumor cells can suppress p53 induction in neighboring fibroblasts, an effect reproducible by tumor cell-conditioned medium. The ability to suppress fibroblast p53 activation is acquired by epithelial cells in the course of neoplastic transformation. Specifically, stable transduction of immortalized epithelial cells by mutant H-Ras and p53-specific short inhibitory RNA endows them with the ability to quench fibroblast p53 induction. Importantly, human cancer-associated fibroblasts are more susceptible to this suppression than normal fibroblasts. These findings underscore a mechanism whereby epithelial cancer cells may overcome the non-cell-autonomous tumor suppressor function of p53 in stromal fibroblasts.
Keywords: p53, stroma, tumor suppression, CAFs, genotoxic stress
The cancer microenvironment is important in the initiation, progression and spread of cancer (Tlsty, 2001). Fibroblasts are a major component of this microenvironment (Kalluri and Zeisberg, 2006). Normal resident fibroblasts converted into cancer-associated fibroblasts (CAFs) (Elenbaas and Weinberg, 2001), or bone-marrow-derived mesenchymal stem cells may contribute to the stromal compartment (Karnoub et al., 2007). The fibroblasts residing in a tumoral tissue are ‘activated’, and exhibit similarities to fibroblasts found within a wound, for example myofibroblast features (Radisky et al., 2001; Kalluri and Zeisberg, 2006).
The p53 gene (TP53) encodes a transcription factor that functions as a tumor suppressor in mammals. In cells harboring functional p53, it can be activated in response to oncogenic stress signals (Vousden and Lane, 2007). Once activated, p53 may bring about apoptosis or replicative senescence, thereby preventing the propagation of potentially malignant cells. p53 modulates the expression of a plethora of target genes, whose concerted induction or repression underlies much of the biological impact of p53 activation.
Past work has focused on cell-autonomous functions of p53. However, p53 also possesses non-cell-autonomous functions, which contribute to tumor suppression. For instance, p53-dependent secreted factors such as PTGF, a transforming growth factor-β (TGF-β) family member (Tan et al., 2000), IGF-BP3 (Buckbinder et al., 1995) and other factors, might be involved in inhibition of cancer growth by stromal cells (Komarova et al., 1998). p53 can repress the expression of the chemokine SDF1 (CXCL12) in fibroblasts (Moskovits et al., 2006), probably rendering the microenvironment less conducive to tumor cell migration and survival. When tumor cells were inoculated in parallel into normal and p53-null mice, the latter displayed markedly accelerated tumor growth rates (Kiaris et al., 2005). Thus, p53 activity in the host stroma exerts an inhibitory influence on cancer progression. Accordingly, attenuation of p53 activity in the tumor stroma may favor tumor progression. Indeed, p53 gene mutations were reported to occur in the fibroblastic stroma of colon and breast cancers (Wernert et al., 2001; Kurose et al., 2002; Patocs et al., 2007), although this conclusion is still subject to debate (Campbell et al., 2008). Furthermore, CAFs were recently shown to possess a nonmutated but functionally deficient p53 (Dudley et al., 2008; Hawsawi et al., 2008). We therefore investigated whether tumor cells may acquire an ability to suppress p53 function in adjacent stromal cells.
To explore the impact of cancer cells on p53 activity in neighboring stromal cells, human non-small cell lung cancer p53-null H1299 cells were cocultured with mouse embryonic fibroblasts (MEFs) stably expressing green fluorescent protein. Cisplatin (Cis-DDP), a DNA-damaging agent, was employed to induce p53. Mouse p53 protein was evaluated using GFP as an internal control for the amount of MEF-derived protein in each sample. Remarkably, coculture with cancer-derived cells attenuated the induction of p53 by Cis-DDP (Figure 1a, compare lanes 4 and 5). In agreement with the compromised accumulation of p53 protein, transcriptional induction of the p21 gene, a canonical p53 target, was also attenuated (Figure 1b, compare bars 2 and 4). Cocultured H1299 cells did not compromise basal p21 mRNA levels in MEFs (bars 1 and 3). As expected, very little p21 mRNA was present in MEFs derived from p53 knockout mice (bars 5–8).
Figure 1.
Human cancer cells inhibit the induction of p53 by genotoxic agents in adjacent fibroblasts. (a) Green fluorescent protein (GFP)-expressing mouse embryonic fibroblasts (MEFs) (GFP-MEFs), grown as described (Bar et al., 2004), were plated alone (370 000 cells per 6 cm dish; lanes 2 and 5) or cocultured for 48 h with a twofold excess of p53-null human lung cancer H1299 cells (ATCC; lanes 1 and 4). Cis-DDP (4 μg/ml; Abic, Netanya, Israel) treatment was for 18 h. Cocultures were harvested as is, whereas pure GFP-MEFs control cultures were co-harvested with separately grown, similarly treated cultures of H1299 cells to load similar protein amounts in each lane. Protein was extracted, run on SDS–polyacrylamide gel electrophoresis (PAGE), western blotted for mouse p53 (CM5; Novocastra, Newcastle, UK), and for GFP (clones 7.1 + 13.1; Roche Diagnostics, Mannheim, Germany) as a loading control for MEF-derived proteins. As an additional control, pure cultures of H1299 cells were also similarly processed (lanes 3 and 6). All cell cultures used in this study were routinely tested and found to be mycoplasma free (Logunov et al., 2008). (b) Wild-type (WT) GFP-MEFs (columns 1–4) or p53 knockout GFP-MEFs (columns 5–8) were plated alone or with H1299 cells for 48 h as in (a). Cis-DDP treatment (4 μg/ml) was for 16 h. Total RNA was extracted and p21 mRNA levels determined with mouse-specific primers (s: GGCCCGGAACATCTCAGG, as: AAATCTGTCAGGCTGGTCTGC). Real-time RT-PCR was performed as described (Moskovits et al., 2006). Levels of p21 mRNA were normalized to GFP mRNA (s: GAGCTGAAGGGCATCGACTT, as: CTTGTGCCCCAGGATGTTG). (c) WI-38 fibroblasts stably expressing GFP were cultured alone (3.2 million cells per 10cm dish) or cocultured for 30 h with a threefold access of H1299 cells stably expressing H2B-FLAG CPT (Sigma, Rehovot, Israel; 1 μg/ml) was added for 16 h. GFP-positive cells were fluorescence-activated cell sorting (FACS) sorted either from pure WI-38 cultures (lanes 1 and 4) or from cocultures (lanes 2 and 5). Pure H1299 cultures were collected without GFP gating (lane 3). Extracts loaded correspond to equivalent numbers of cells in each lane. Following SDS–PAGE, western blot analysis was performed for human p53 (mixture of PAb1801 and DO1), p21 (C-19; Santa Cruz Biotechnology, CA, USA), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (MAB374; Chemicon International, Chandlers Ford, UK) as a protein loading control. Anti-FLAGantibodies (M2; Sigma-Aldrich, St Louis, MO, USA) were used to confirm the absence of H1299 cells in the fractions collected as pure WI-38 cells.
To extend these observations to a more relevant context, a similar analysis was performed with H1299 cells and WI-38 human embryonic lung fibroblasts. H1299 and WI-38 cells were separately stably transduced with FLAG-H2B and GFP, respectively. Both cell types were then placed in coculture, with or without subsequent treatment with the genotoxic agent camptothecin (CPT). WI-38 cells were then isolated by preparative fluorescence-activated cell sorting (FACS) sorting, gated for GFP fluorescence. Western blot analysis was performed on the sorted populations (Figure 1c); probing for FLAG-H2B (positive control in lane 3) served to ascertain the effective removal of H1299 cells (lanes 2, 4, 5). As seen, coculture with cancer cells attenuated the induction of p53 and p21 by genotoxic stress also here (compare lanes 1 and 2). No significant effect on basal p53 levels was observable (lanes 4 and 5). Together, these data imply that tumor-derived cells can blunt the p53 response to genotoxic stress in adjacent stromal fibroblasts.
To assess whether this inhibitory effect could be exerted also in the absence of direct cell–cell contact, we tested the effect of conditioned medium (CM) from H1299 cells on p53 induction by genotoxic stress in WI-38 cells. As seen in Figure 2, incubation with H1299 CM was able to reduce p53 induction (lanes 2 and 4), suggesting the involvement of a cancer cell-derived soluble p53-inhibitory factor(s).
Figure 2.
Cancer cell-conditioned medium inhibits p53 induction. Conditioned medium (CM) was collected from H1299 cells cultured for 48 h in serum-free medium (lanes 3 and 4). Control medium was collected after 48 h incubation without cells (control, lanes 1 and 2). The CM was filtered (0.45 μm) and placed on WI-38 cells, concomitantly with camptothecin treatment (CPT, 1 μg/ml, 19 h) where indicated. Cells were then harvested and subjected to western blot analysis for human p53, p21 (F-5; Santa Cruz Biotechnology) and GAPDH as in Figure 1c.
To investigate whether epithelial cells acquire the ability to suppress p53 induction in adjacent stromal cells in the course of neoplastic transformation, we took advantage of normal primary human bronchial epithelial cells immortalized with human telomerase (NHBET) and their in vitro transformed derivatives stably expressing mutant H-Ras and short-hairpin RNA specific for p53, which strongly downregulates their p53 protein levels (Figure 3b). NHBET and the transformed subline grew in vitro at a similar rate (data not shown). As seen in Figure 3a, CM from the transformed cells suppressed p53 induction in WI-38 cells when compared to CM from NHBET (lanes 2 and 4). Basal p53 levels were also repressed, albeit less strongly, by the transformed cell CM (lanes 1 and 3). Thus, oncogenic events such as constitutive Ras activation and loss of p53 function equip epithelial cells with the ability to quench p53 activation in stromal fibroblasts.
Figure 3.
In vitro-transformed epithelial cells acquire the ability to inhibit p53 in fibroblasts. (a) Normal human bronchial epithelial cells (NHBE; Clonetics-BioWhittaker, San Diego, CA, USA), manipulated to express hTERT either alone (NHBET) or together with mutant H-Ras and p53 short-hairpin RNA (shRNA) (+ Ras + sip53), were generated as described (Milyavsky et al., 2003). Cells were grown with keratinocyte-SFM a serum-free medium supplemented with rEGF and pituitary extract (Gibco Invitrogen Cell Culture, Carlsbad, CA, USA). CM was collected over 48 h with rEGF at 10% the recommended concentration, and placed on WI-38 cells with or without CPT, as in Figure 2. Cells were extracted and western blotted as in Figure 2. (b) Western blot analysis of the epithelial cells, confirming the expression of mutant Ras (C-20; Santa Cruz Biotechnology) and reduction in p53 protein levels by p53 shRNA.
The fibroblasts employed in the experiments described above were derived from healthy human or mouse embryos. In the course of tumor progression, stromal fibroblasts undergo substantial changes; consequently, CAFs are more supportive of tumor development than normal fibroblasts (NFs) (reviewed in Elenbaas and Weinberg, 2001; Radisky et al., 2001; Kalluri and Zeisberg, 2006). For instance, CAFs inoculated into nude mice together with nontumorigenic prostate epithelial cells allow the development of the latter into overt cancer (Olumi et al., 1999).We therefore compared CAFs and NFs with regard to the ability of their p53 to be affected by epithelial cell CM. CAFs were obtained from a breast cancer metastasis to the lung; NFs were obtained in parallel from a noncancerous part of the same lung. The robust induction of p53 by DNA damage in the presence of NHBET CM, is consistent with a wild-type p53 gene status in NFs and CAFs (Figure 4, lanes 1, 2, 5 and 6). Both basal and genotoxic damage-induced p53 levels in adult lung fibroblasts were selectively attenuated by CM from transformed epithelial cells (compare lane 3 to 1 and 4 to 2). Remarkably, this effect was more prominent in CAFs (compare lane 7 to 3 and 8 to 4). This pattern was reproduced with an additional pair of NFs and CAFs, derived from another breast cancer patient (data not shown). These observations suggest that, in the course of presumably undergoing continuous selection within the tumor microenvironment, CAFs acquire an enhanced ability to have their p53 activity suppressed by adjacent tumor cells.
Figure 4.
Cancer-associated fibroblasts (CAFs) are more susceptible than normal fibroblasts (NFs) to inhibition of their p53 by CM of transformed epithelial cells. NFs and CAFs were obtained from a surgically resected lung metastasis or from a grossly normal part of the same specimen, of a patient who gave signed informed consent as approved by the Institutional Review Board (IRB). Tissues were cut to small pieces, shaken overnight at 37 °C in collagenase type 4 (250 U/ml; S3J6523; Worthington Biochemical, Lakewood, NJ, USA) in Dulbecco's modified Eagle's medium (DMEM), filtered (100 μm cell strainer; BD Biosciences, San Jose, CA, USA), and plated (DMEM, 20% fetal bovine serum (FBS), 1 mM sodium pyruvate, 2 mM L-glutamine, MEM non-essential amino acid, antibiotics (Beit Haemek, Kibbutz Beit Haemek, Israel) and 60 μM β-mercaptoethanol). After 7–14 days the FBS was reduced to 10%. Fibroblast identity was confirmed by typical morphology, positive vimentin staining and negative cytokeratin staining (data not shown). CM was collected as in Figure 3 from NHBET (lanes 1, 2, 5, 6) and Ras + sip53 (lanes 3, 4, 7, 8) cells, and placed on NFs (lanes 1–4) or CAFs (lanes 5–8) with or without CPT as in Figure 3. Cell extracts were subjected to western blot analysis as in Figure 2.
We report here that tumor cells can inhibit p53 induction in adjacent fibroblasts by a mechanism that is independent of direct cell–cell contacts, suggesting the involvement of factor(s) secreted by the tumor cells. Furthermore, CAFs are more susceptible to this inhibitory mechanism than their normal counterparts. In some combinations of tumor cells and fibroblasts, the inhibitory effect was already exerted on basal p53 levels, whereas in other cases it was seen only after exposure to genotoxic agents. Inhibition of stromal p53 might thus be a protective mechanism that tumor cells evolve against the paracrine p53-dependent inhibitory influence of stromal fibroblasts.
It is of note that normal epithelial cells gained the ability to inhibit p53 induction, after being artificially transformed in culture, without ever being exposed to positive selection in an in vivo tumor microenvironment. This implies that Ras mutational activation and loss of p53 function, both occurring frequently during human tumorigenesis, are sufficient to equip epithelial cells with the capacity to quench stromal p53. Nevertheless, it is likely that this capacity is further augmented through positive selection in the course of tumor progression.
The mechanism whereby tumor cells suppress stromal p53 remains to be elucidated. It will be important to uncover the identity and regulation of the secreted factors that are released by tumor cells and inhibit p53 induction. This knowledge is of potential importance, as it may provide clues towards blocking the inhibitory effect of cancer cells on stromal p53, thereby restoring the functionality of the latter and perhaps attenuating tumor progression.
Acknowledgments
We thank Dr J Schachter and Dr B Kaufman for helpful discussions. This work was supported in part by a Center of Excellence grant from the Flight Attendant Medical Research Institute (FAMRI), and by grant R37 CA40099 from the National Cancer Institute. JB was supported also by the Koschitzky family donation to the breast cancer unit of CSMC, and by a Van Bates grant from the Tel Aviv University Cancer Biology Research Center.
References
- Bar J, Cohen-Noyman E, Geiger B, Oren M. Attenuation of the p53 response to DNA damage by high cell density. Oncogene. 2004;23:2128–2137. doi: 10.1038/sj.onc.1207325. [DOI] [PubMed] [Google Scholar]
- Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR, et al. Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature. 1995;377:646–649. doi: 10.1038/377646a0. [DOI] [PubMed] [Google Scholar]
- Campbell IG, Qiu W, Polyak K, Haviv I. Breast-cancer stromal cells with TP53 mutations. N Engl J Med. 2008;358:1634–1635. doi: 10.1056/NEJMc086024. author reply 1636. [DOI] [PubMed] [Google Scholar]
- Dudley AC, Shih SC, Cliffe AR, Hida K, Klagsbrun M. Attenuated p53 activation in tumour-associated stromal cells accompanies decreased sensitivity to etoposide and vincristine. Br J Cancer. 2008;99:118–125. doi: 10.1038/sj.bjc.6604465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elenbaas B, Weinberg RA. Heterotypic signaling between epithelial tumor cells and fibroblasts in carcinoma formation. Exp Cell Res. 2001;264:169–184. doi: 10.1006/excr.2000.5133. [DOI] [PubMed] [Google Scholar]
- Hawsawi NM, Ghebeh H, Hendrayani SF, Tulbah A, Al-Eid M, Al-Tweigeri T, et al. Breast carcinoma-associated fibroblasts and their counterparts display neoplastic-specific changes. Cancer Res. 2008;68:2717–2725. doi: 10.1158/0008-5472.CAN-08-0192. [DOI] [PubMed] [Google Scholar]
- Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer. 2006;6:392–401. doi: 10.1038/nrc1877. [DOI] [PubMed] [Google Scholar]
- Karnoub AE, Dash AB, Vo AP, Sullivan A, Brooks MW, Bell GW, et al. Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature. 2007;449:557–563. doi: 10.1038/nature06188. [DOI] [PubMed] [Google Scholar]
- Kiaris H, Chatzistamou I, Trimis G, Frangou-Plemmenou M, Pafiti-Kondi A, Kalofoutis A. Evidence for nonautonomous effect of p53 tumor suppressor in carcinogenesis. Cancer Res. 2005;65:1627–1630. doi: 10.1158/0008-5472.CAN-04-3791. [DOI] [PubMed] [Google Scholar]
- Komarova EA, Diatchenko L, Rokhlin OW, Hill JE, Wang ZJ, Krivokrysenko VI, et al. Stress-induced secretion of growth inhibitors: a novel tumor suppressor function of p53. Oncogene. 1998;17:1089–1096. doi: 10.1038/sj.onc.1202303. [DOI] [PubMed] [Google Scholar]
- Kurose K, Gilley K, Matsumoto S, Watson PH, Zhou XP, Eng C. Frequent somatic mutations in PTEN and TP53 are mutually exclusive in the stroma of breast carcinomas. Nat Genet. 2002;32:355–357. doi: 10.1038/ng1013. [DOI] [PubMed] [Google Scholar]
- Logunov DY, Scheblyakov DV, Zubkova OV, Shmarov MM, Rakovskaya IV, Gurova KV, et al. Mycoplasma infection suppresses p53, activates NF-kappaB and cooperates with oncogenic Ras in rodent fibroblast transformation. Oncogene. 2008;27:4521–4531. doi: 10.1038/onc.2008.103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Milyavsky M, Shats I, Erez N, Tang X, Senderovich S, Meerson A, et al. Prolonged culture of telomerase-immortalized human fibroblasts leads to a premalignant phenotype. Cancer Res. 2003;63:7147–7157. [PubMed] [Google Scholar]
- Moskovits N, Kalinkovich A, Bar J, Lapidot T, Oren M. p53 Attenuates cancer cell migration and invasion through repression of SDF-1/CXCL12 expression in stromal fibroblasts. Cancer Res. 2006;66:10671–10676. doi: 10.1158/0008-5472.CAN-06-2323. [DOI] [PubMed] [Google Scholar]
- Olumi AF, Grossfeld GD, Hayward SW, Carroll PR, Tlsty TD, Cunha GR. Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res. 1999;59:5002–5011. doi: 10.1186/bcr138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Patocs A, Zhang L, Xu Y, Weber F, Caldes T, Mutter GL, et al. Breast-cancer stromal cells with TP53 mutations and nodal metastases. N Engl J Med. 2007;357:2543–2551. doi: 10.1056/NEJMoa071825. [DOI] [PubMed] [Google Scholar]
- Radisky D, Hagios C, Bissell MJ. Tumors are unique organs defined by abnormal signaling and context. Semin Cancer Biol. 2001;11:87–95. doi: 10.1006/scbi.2000.0360. [DOI] [PubMed] [Google Scholar]
- Tan M, Wang Y, Guan K, Sun Y. PTGF-beta, a type beta transforming growth factor (TGF-beta) superfamily member, is a p53 target gene that inhibits tumor cell growth via TGF-beta signaling pathway. Proc Natl Acad Sci USA. 2000;97:109–114. doi: 10.1073/pnas.97.1.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tlsty TD. Stromal cells can contribute oncogenic signals. Semin Cancer Biol. 2001;11:97–104. doi: 10.1006/scbi.2000.0361. [DOI] [PubMed] [Google Scholar]
- Vousden KH, Lane DP. p53 in health and disease. Nat Rev Mol Cell Biol. 2007;8:275–283. doi: 10.1038/nrm2147. [DOI] [PubMed] [Google Scholar]
- Wernert N, Locherbach C, Wellmann A, Behrens P, Hugel A. Presence of genetic alterations in microdissected stroma of human colon and breast cancers. Anticancer Res. 2001;21:2259–2264. [PubMed] [Google Scholar]