Skip to main content
The FASEB Journal logoLink to The FASEB Journal
. 2008 Aug;22(8):2740–2746. doi: 10.1096/fj.08-110759

Evidence for defective mesolimbic dopamine exocytosis in obesity-prone rats

Brenda M Geiger *, Gerald G Behr *, Lauren E Frank *, Angela D Caldera-Siu *, Margery C Beinfeld *, Efi G Kokkotou ‡, Emmanuel N Pothos *,†,1
PMCID: PMC2728544  PMID: 18477764

Abstract

The association between dietary obesity and mesolimbic systems that regulate hedonic aspects of feeding is currently unresolved. In the present study, we examined differences in baseline and stimulated central dopamine levels in obesity-prone (OP) and obesity-resistant (OR) rats. OP rats were hyperphagic and showed a 20% weight gain over OR rats at wk 15 of age, when fed a standard chow diet. This phenotype was associated with a 50% reduction in basal extracellular dopamine, as measured by a microdialysis probe in the nucleus accumbens, a projection site of the mesolimbic dopamine system that has been implicated in food reward. Similar defects were also observed in younger animals (4 wk old). In electrophysiology studies, electrically evoked dopamine release in slice preparations was significantly attenuated in OP rats, not only in the nucleus accumbens but also in additional terminal sites of dopamine neurons such as the accumbens shell, dorsal striatum, and medial prefrontal cortex, suggesting that there may be a widespread dysfunction in mechanisms regulating dopamine release in this obesity model. Moreover, dopamine impairment in OP rats was apparent at birth and associated with changes in expression of several factors regulating dopamine synthesis and release: vesicular monoamine transporter-2, tyrosine hydroxylase, dopamine transporter, and dopamine receptor-2 short-form. Taken together, these results suggest that an attenuated central dopamine system would reduce the hedonic response associated with feeding and induce compensatory hyperphagia, leading to obesity.—Geiger, B. M., Behr, G. G., Frank, L. E., Caldera-Siu, A. D., Beinfeld, M. C., Kokkotou, E. G., Pothos, E. N. Evidence for defective mesolimbic dopamine exocytosis in obesity-prone rats.

Keywords: body weight, nucleus accumbens, striatum, prefrontal cortex, vesicular monoamine transporter 2, tyrosine hydroxylase


The midbrain dopamine pathways (nigrostriatal, mesoaccumbens, and corticolimbic) include the majority of central nervous system dopamine neurons and constitute the circuits that mediate mostly hedonic aspects of feeding in interaction with hypothalamic circuits that regulate energy balance (1). We and others have shown increased dopamine release and turnover in the rat nucleus accumbens, dorsal striatum, and medial prefrontal cortex in response to acute feeding (2,3,4,5). However, chronic food deprivation in rats resulting in a 20% decrease in body weight leads to a decrease in basal nucleus accumbens dopamine (6, 7). Thus, it is reasonable to hypothesize that in both underweight and overweight animals increased food intake could be at least partly attributed to a compensatory attempt to restore basal mesolimbic dopamine levels. In support of this theory, we have shown that extracellular accumbens dopamine is low in outbred dietary obese rats (8) and that stimulated dopamine release in the accumbens of leptin-deficient mice is severely attenuated (9). Furthermore, the availability of dopamine D2 receptors is decreased in obese individuals in proportion to their body mass index (BMI) (10). However, it is not known whether this deficit is in D2 presynaptic [D2 short form (D2S)] or D2 postsynaptic receptors (D2 long form) and how it affects dopamine release. It is also not known whether such changes in central dopamine neurochemistry are a result of diet history or body weight differences.

Although a small number of humans become obese because of single-gene mutations, >99.9% of human obesity is the result of an interaction between predisposing genes and diet history (11). To address potential altered brain neural circuitry associated with a predisposition to obesity, we studied the mesolimbic dopaminergic system in inbred obesity-prone rats before and after the onset of obesity. The rat model that we studied has been developed by selective breeding of high and low weight gainers among outbred Sprague-Dawley rats after 2 wk of feeding with a high-energy diet (12,13,14). By the F5 generation, the obesity-prone rats fed a standard chow gain 31% (males) and 22% (females) more weight than the obesity-resistant rats and exhibit metabolic abnormalities similar to those in obese humans.

Our study of the rat mesolimbic system at different ages has shown that obesity-prone rats have lower basal extracellular dopamine levels, lower evoked dopamine release, and lower dopamine quantal size, most likely due to intrinsic differences in the expression of genes that regulate dopamine exocytosis.

MATERIALS AND METHODS

Experimental animals

Fifteen- and 4-wk-old female (for slice recordings and microdialysis) inbred obesity-resistant and obesity-prone rats (13) from Charles River Laboratories, Inc. (Cambridge, MA, USA) were housed in reverse light-dark cycle (lights off at 8:00 AM and on at 8:00 PM) and used in the middle of the dark cycle when rodents are normally active. Laboratory chow intake was measured in individually housed animals at the following time points: 1, 2, 3, 6, and 12 h after the onset of the dark cycle and 12 h after the onset of the light cycle.

Stereotactic surgery and microdialysis

Guide cannulas (12 mm; BAS Bioanalytical Systems, Indianapolis, IN, USA) were implanted according to a Tufts institutional animal care and use committee-approved animal protocol. The stereotactic coordinates used for the nucleus accumbens were 1.0 mm anterior to bregma, 1.2 mm lateral to midsagittal sinus, and 6.0 mm ventral to the skull surface (15). The dialysis probe extended another 2 mm ventral to the guide cannula. Correct probe placement was verified by histology at the completion of the study. After a 1-wk recovery from surgery, microdialysis probes were implanted into the guide cannulas 15 h before the start of the microdialysis session, at which point food was removed. Artificial cerebrospinal fluid (ACSF) (149 mM NaCl, 1 mM NaH2PO4, 3 mM KCl, 1 mM MgCl2, and 1.4 mM CaCl2, pH 7.4) was pumped through the probe to allow equilibration. Samples of the interstitial fluid were taken every 30 min for 2 h and analyzed using HPLC-electrochemical detection.

The estrous cycle of these animals was measured using the EC-40 vaginal impedance instrument (Fine Science Tools, Inc., Foster City, CA, USA). Based on the correlation of impedance to estrous cycle stage, the animals tested were in proestrous or diestrous, and no difference was detected in basal dopamine levels between the estrous cycle stages (data not shown). Furthermore, no cycle-induced changes in evoked dopamine release were detected when stimulated dopamine release was measured in acute striatal slices of normal females by fast-scan cyclic voltammetry (16).

Brain slice electrophysiology

Disk carbon fiber electrodes were manufactured as described elsewhere (17). Coronal brain slices (300 μm) were generated by a Leica VT1000S Vibratome (Leica Microsystems, Wetzlar, Germany) and placed in the recording chamber with 1 ml/min perfusion of oxygenated ACSF at 37°C. Electrodes were placed in the accumbens shell, dorsal striatum, or medial prefrontal cortex. Voltage was set to +700 mV (Axopatch 200B; Axon Instruments Inc., Union City, CA, USA) in a circuit with an Ag/AgCl reference electrode. The bipolar stimulating electrode (Plastics One, Inc., Roanoke, VA, USA) was placed 100–200 μm away from the carbon fiber electrode. A current stimulus of +500 μA was applied 5 times per site for 2 ms every 5 min.

Amperometric recordings from dissociated neuronal cultures

Postnatally derived (P0–P1) primary dissociated cultures of ventral tegmental area (VTA) neurons were prepared from obesity-prone and obesity-resistant pups as described elsewhere (17). Cells were plated at a density of 100,000 cells/well. They were used 7 days postplating for expression experiments and 3–8 wk postplating for amperometry.

Recordings were performed in physiological saline and maintained at 37°C. Cells were stimulated using 40 mM potassium and 6 mM calcium iso-osmotically substituted for sodium in the normal medium. Current was acquired at 160 kHz. Quantal events within 20 s after stimulation were included in the analysis. Amperometric peaks were identified as events greater than 3.5 times the root mean square baseline noise and quantified in terms of event amplitude and number of dopamine molecules (integral) as described in previous work (17).

Real-time polymerase chain reaction (PCR)

RNA from primary dissociated cell cultures was isolated using the RNAqueous Mag 96 kit (Ambion, Austin, TX, USA). The purified RNA was reverse transcribed using the mMulv reverse transcriptase kit and random primers containing 12 nucleotides (New England Biolabs, Beverly, MA, USA). Real-time PCR was performed for tyrosine hydroxylase (TH) using previously published PCR primers (18) and the SYBR Green detection system. For all other genes, PCR was performed using PCR primers in combination with FAM-labeled MGB probes (Applied Biosystems, Inc., Foster City, CA, USA) and the TaqMan detection system. Primer sets and probes were as follows: cyclophilin: forward AATGGCACTGGTGGCAAGTC, reverse GCCAGGACCTGTATGCTTCAG, and probe TCTACGGAGAGAAATT; TH: forward GCCATGAGCTGTTGGGACAT and reverse CCCCAGAGATGCAAGTCCAAT (18); VMAT2: forward CTACCAGCACACAGCACACT, reverse TCATTCAGAAGGTCTCTGTCTTCACT, and probe CCACTGTCCCTTCGGACTG; Gαq: forward ACAACAAGATGTGCTTAGAGTTCGA, reverse GACCATTCTGAAGATGACACTCTGT, and probe CAGGGATCATTGAGTACCC; and D2 presynaptic receptor: forward GTCAGAAGGGAAGGCAGACA, reverse GCACATTGCCAAAGACGATGATAAA, and probe CAGCATGGCATAGTAGTTG. Forty-five cycles of real-time PCR were performed using an Applied Biosystems 7700 sequence detector and Platinum QPCR Supermix UDG reagents (Invitrogen, Carlsbad, CA, USA). Specific gene expression was calculated relative to levels in the obesity-resistant group and normalized to cyclophilin.

Immunohistochemistry

Cultures were fixed using 4% paraformaldehyde solution and then washed with PBS containing 0.1% Triton X-100. After blocking with 10% horse serum, cultures were probed with a mouse monoclonal antibody for TH (1:200; Chemicon International, Temecula, CA, USA) or a rabbit polyclonal antibody against the C terminus of VMAT2 (1:100; Chemicon International), followed by incubation with a secondary biotinylated antibody and an avidin-biotin-horseradish peroxidase complex (Vector Laboratories, Burlingame, CA, USA). The antibody complex was visualized using 3,3′-diaminobenzidine and hydrogen peroxide.

Statistical analysis

One-way ANOVA (Excel; Microsoft, Redmond, WA) was used to compare obesity-prone and obesity-resistant rats in all experiments. Results are expressed as mean ± sem.

RESULTS

Extracellular dopamine levels in the nucleus accumbens of adult obesity-prone and obesity-resistant rats

At 15 wk of age, obesity-prone female rats consumed 14% more food when fed a diet of normal chow (16.34±1.24 vs. 14.25±0.17 g; P<0.05) (Fig. 1A) and were 20% heavier (263±13.5 vs. 220.5±10.5 g; P<0.01) (Fig. 1B) than the obesity-resistant rats. When basal extracellular dopamine levels in the nucleus accumbens were measured during a 2-hour period in the middle of the dark cycle and in the absence of food, they were almost 2-fold lower in obesity-prone animals than in obesity-resistant animals (0.024±0.005 vs. 0.042±0.003 pmol, respectively; P<0.02) (Fig. 1C).

Figure 1.

Figure 1.

Elevated body weight of adult obesity-prone rats is linked to increased chow intake and decreased extracellular dopamine levels in the nucleus accumbens. A) Food intake during the dark cycle of obesity-prone (OP) animals (n=4 in triplicate) is greater than food intake of obesity-resistant (OR) animals (n=6 in triplicate). B) Body weight of the young adult OP rats (n=3) used for microdialysis was significantly higher than the body weight of OR rats (n=4). C) Basal accumbens extracellular dopamine in freely moving OP rats (n=3) was significantly lower than that in OR rats (n=4). *P < 0.01; #P < 0.05.

Stimulated dopamine release is low in obesity-prone rats

The lower extracellular dopamine levels in obesity-prone rats could be the direct result of a reduction in dopamine release by the accumbens neuronal terminals. To examine this possibility in obesity-prone vs. obesity-resistant rats we measured electrically evoked dopamine release ex vivo in acute coronal slice preparations of the following brain regions: posterior nucleus accumbens shell, mediodorsal striatum, and medial prefrontal cortex. The selected regions exhibit dense TH staining in nerve terminals, showing rich innervation from the dopamine cell bodies of the midbrain (15). This ex vivo approach is advantageous because it isolates the dopaminergic nerve terminals and, consequently, can directly point to presynaptic mechanisms that might be responsible for any observed differences in dopamine release.

In the nucleus accumbens shell, the mean amplitude of the evoked dopamine signal was ∼3-fold lower in obesity-prone rats than in obesity-resistant rats (9±1 vs. 30±6 pA respectively; P<0.01) (Fig. 2A, B). The integration of the dopamine signal yielded an average of 36.8 × 106 ± 4.8 × 106 dopamine molecules released per stimulation in obesity-prone animals vs. 78.6 × 106 ± 11.5 × 106 dopamine molecules in obesity-resistant animals (P<0.01) (Fig. 2C).

Figure 2.

Figure 2.

Stimulated dopamine release is attenuated in the nucleus accumbens, dorsal striatum, and prefrontal cortex of adult obesity-prone rats. A) Representative amperometric traces of stimulated dopamine release from acute coronal slices. B, C) Average peak amplitude (pA) (B) and number of molecules released after stimulation of dopamine release (C) were significantly lower in obesity-prone (OP) rats than in obesity-resistant (OR) rats in the nucleus accumbens (NAc) [OP (n=45) stimulations in 9 slices; OR (n=53) stimulations in 11 slices], dorsal striatum (DS) [OP (n=40) stimulations in 8 slices; OR (n=40) stimulations in 8 slices], and prefrontal cortex (PFC) [OP (n=32) stimulations in 7 slices; OR (n=35) stimulations in 9 slices]. D) In 4- to 5-wk-old rats, the average peak amplitude after stimulation of dopamine release was also significantly lower in OP rats than in OR rats [OP (n=37) stimulations in 10 slices; OR (n=56) stimulations in 13 slices]. *P < 0.01.

In the dorsal striatum, the mean amplitude of the evoked dopamine signal was 15 ± 3 pA in obesity-prone rats vs. 22 ± 2 pA in obesity-resistant rats (P<0.01) (Fig. 2B). The integration of the dopamine signal yielded an average of 34.7 × 106 ± 4.3 × 106 dopamine molecules released per stimulation in obesity-prone vs. 116.9 × 106 ± 12.9 × 106 dopamine molecules in obesity-resistant animals (P<0.01) (Fig. 2C).

In the medial prefrontal cortex, the mean amplitude of the evoked dopamine signal was 7 ± 1 pA in obesity-prone vs. 15 ± 2 pA in obesity-resistant rats (P<0.01) (Fig. 2B). The integration of the dopamine signal yielded an average of 21.9 × 106 ± 3.0 × 106 dopamine molecules released per stimulation in obesity-prone animals vs. 40.4 × 106 ± 3.8 × 106 dopamine molecules in obesity-resistant animals (P<0.01) (Fig. 2C). Similar results were obtained in younger (4-wk-old) rats. At this age, the average body weight of obesity-prone rats was not statistically different from that of obesity-resistant rats (79.9±7.3 vs. 66.1±4.4 g, respectively). The mean amplitude of the evoked dopamine signal was 4.7 ± 0.3 pA in obesity-prone rats vs. 12.3 ± 1.9 pA in obesity-resistant rats (P<0.01) (Fig. 2D).

Taken together, these results indicate that stimulated dopamine release is significantly lower in obesity-prone rats and may account for their lower levels of basal extracellular dopamine in the nucleus accumbens (Fig. 1C). In addition, this deficit in dopamine release appears to be global for all central dopamine systems, which suggests an anomaly in presynaptic mechanisms regulating dopamine release.

Dopamine quantal size is reduced in obesity-prone rats

To determine whether differences in dopamine release were related to differences in dopamine exocytosis from individual vesicles, we measured the quantal size of dopamine in cultures of primary dissociated dopamine neurons from obesity-prone and obesity-resistant neonates (P0–P1). These neurons were isolated from the VTA where the dopamine cell bodies reside and project to the nucleus accumbens. Representative amperometric traces are shown in Fig. 3A and the quantal size distribution is shown in Fig. 3B. The average quantal size in cultures derived from obesity-prone rats was 1131 ± 99 molecules, which was significantly lower than the average quantal size in cultures from obesity-resistant rats (2032±152 molecules; P<0.01) (Fig. 3C, left panel). The average event amplitude was significantly lower in cultures from obesity-prone neonates (6.59±0.35 vs. 10.56±0.66 pA; P<0.01) (Fig. 3C, right panel). Not only does this finding provide a potential mechanism for lower dopamine release; it also indicates that this attenuation in dopamine signal is present at birth.

Figure 3.

Figure 3.

Reduced dopamine quantal size in VTA-derived neurons from P0–P1 obesity-prone pups. A) Representative amperometric traces from VTA cultures of obesity-resistant (OR) (top) and obesity-prone (OP) (bottom) neonates. Individual events are shown at higher resolution below. B) Quantal size distribution in cultures from neonatal OP and OR animals. Note that the OP distribution is skewed to the left due to lack of events in the higher quantal size bins. C) Quantal size (left panel) and amplitude (right panel) of stimulated dopamine release from VTA-derived neuronal cultures from OP pups (gray bars, n=110 events) is lower than that in cultures derived from OR pups (black bars, n=182 events). *P < 0.01.

Altered expression of regulators of dopamine synthesis and release in obesity-prone rats

Potential mechanisms for the decreased dopamine signal seen in Figs. 1and 2 could be decreased dopamine biosynthesis and decreased vesicular loading (18, 19). Two key proteins involved in these processes are TH, the rate-limiting enzyme for dopamine synthesis, and VMAT2, the neuronal transporter responsible for packaging dopamine into vesicles. The relative amount of TH mRNA expression in cultures from the obesity-prone animals was 50-fold lower than that in the obesity-resistant group (0.019±0.002 vs. 1.00±0.12; P<0.01) (Fig. 4A). Consistent with the mRNA data, TH protein expression was reduced by 2-fold in cultures from the obesity-prone rats (206±19 TH-positive cells in obesity-prone rats vs. 434±104 TH-positive cells in obesity-resistant rats; P<0.01) (Fig. 4B), indicating reduced dopamine synthesis. In the same cultures, the relative VMAT2 mRNA expression was significantly lower in obesity-prone rats (0.62±0.03 vs. 1.62±0.15; P<0.01) (Fig. 4C), which would indicate decreased vesicular packaging of dopamine. Moreover, the mRNA expression of Gαq, an endogenous negative regulator of VMAT2 activity (20) was significantly higher in cultures from obesity-prone neonates than in cultures from obesity-resistant neonates (1.02±0.01 vs. 0.58±0.1; P<0.01) (Fig. 4C). These changes in VMAT2 mRNA expression correlate to changes in VMAT2 protein expression. The mean count of VMAT2-immunopositive sites in cultures derived from obesity-prone pups was significantly lower than that in cultures from obesity-resistant pups (248±29 vs. 658±47 positive cells; P<0.01) (Fig. 4D, E).

Figure 4.

Figure 4.

Lower mRNA and protein expression regulators of dopamine synthesis and exocytosis VTA cell cultures from obesity-prone neonatal animals. A) mRNA expression of TH was significantly lower in dopamine neuronal cultures derived from obesity-prone (OP) rats (gray bar) than in those from obesity-resistant (OR) rats (black bar, n=5 pooled cultures/group in triplicate). B) TH-immunopositive cells in cultures from OP rats (n=11 cultures) were significantly less than those in cultures from OR rats (n=6 cultures). C) mRNA expression of VMAT2 was significantly lower while mRNA expression of endogenous VMAT2 down-regulator Gαq was significantly higher in cultures from OP rats than in those from OR rats (n=5 cultures/group). D) VMAT2-immunopositive sites in cultures from OP rats (n=12 cultures) were significantly less than those in sites from OR rats (n=16 cultures). E) Representative VMAT2 immunostaining in VTA cultures from OR and OP pups, 7 days postplating. Arrows point to VMAT2-positive sites. Scale bar = 100 μm; ×20 view. F) Lower mRNA expression of the DAT transporter and the presynaptic dopamine autoreceptor D2S in cultures from OP (gray bars) than OR neonates (black bars, n=5 cultures/group). *P < 0.01.

Additional regulators of dopamine signaling were also found to have significantly lower expression in cultures from obesity-prone neonates than in cultures from obesity-resistant neonates (Fig. 4F). Dopamine plasma membrane transporter (DAT) expression was 0.82 ± 0.06 vs. 1.5 ± 0.2 (P<0.01) and D2S presynaptic autoreceptor expression was 0.49 ± 0.05 vs. 1.26 ± 0.21 (P<0.01).

DISCUSSION

This report represents the first demonstration that there are impairments in all midbrain dopamine systems in obesity-prone rats and that these deficiencies are distinctly in place early in postnatal life. The pathophysiological mechanisms responsible for this dopamine phenotype involve a significant reduction in basal and stimulated dopamine release and in dopamine quantal size in obesity-prone animals.

Most of the data presented here focus on the changes in dopamine availability in the nucleus accumbens and the underlying regulatory mechanisms in obesity-prone animals. Interestingly, we also show decreased stimulated dopamine in the dorsal striatum and prefrontal cortex, indicating a global presynaptic deficit in central dopamine in animals with predisposition to obesity. Such a non-site-specific defect apparently implies deficits in universal presynaptic regulators of dopamine neurotransmission. Indeed, TH, VMAT2, the DAT plasma membrane transporter, and D2-type receptor message were reduced in obesity-prone rats. However, TH and VMAT2 directly regulate dopamine exocytosis through lower biosynthesis (TH) and vesicular packaging (VMAT2), whereas DAT and dopamine receptors respond to changes in exocytosis. Therefore, low TH and VMAT2 expression constitutes the most likely underlying mechanism accounting for the central dopamine deficits observed in obesity-prone rats. It was shown previously that VMAT2 activity is down-regulated through vesicle-associated G proteins (i.e., trimeric GTPase Go2 and Gαq) (20, 21). The same molecules (VMAT2, Gαq, and Go2) are involved in the mechanism of action of amphetamine and other psychostimulants that are also VMAT2 substituents and displace dopamine from vesicles (22). Furthermore, we have previously shown that VMAT2 directly regulates dopamine quantal size through vesicular filling (23, 24). Overexpression of the transporter leads to higher quantal size and quantal content (frequency of release), whereas mice deficient for VMAT2 have correspondingly deficient synaptic dopamine release. It is thus quite tempting to speculate that genetic polymorphisms in this gene (VMAT2) may negatively correlate with BMI in humans and account for at least some forms of human obesity.

What signal could contribute as a common denominator in the TH, VMAT2, and dopamine deficiencies observed in obesity-prone animals? Is this signal extrinsic or intrinsic to the dopamine neuron? One possibility is leptin. Other studies have suggested that systemic inputs from neurons expressing LepRB receptors in the lateral hypothalamus (25) modulate TH expression. In patients with congenital leptin deficiency, leptin administration reverses their blunted ability to discriminate between the rewarding properties of food and, at the neuronal level, alters activation in the ventral striatum. This interaction suggests that leptin could modulate feeding-related mesolimbic sensitivity to the visual presentation of food stimuli (26). Others point to neuroanatomical links between the nucleus accumbens and the lateral hypothalamic nuclei via melanin-concentrating hormone or orexin signaling (27, 28). However, the deficits reported in the present study have been maintained in preparations (coronal slices and dissociated cell cultures) without systemic input from elsewhere in the brain. Furthermore, the regulation of the VMAT2 transporter appears to be intrinsic to the dopamine neuron through heterotrimeric G protein endogenous down-regulators (20, 21), one of which (Gαq) was found to be elevated in neurons from obesity-prone animals in the present study. Therefore, it is evident that the defects in mesolimbic dopamine exocytosis in obesity-prone animals are due at least partly to aberrant intrinsic signaling in VTA dopamine neurons that is independent from lateral hypothalamic or other systemic inputs. Leptin receptors on VTA neurons (9, 29) could trigger this intrinsic deficit.

How do the present findings fit with what is known about the role of mesolimbic dopamine in feeding? The role of mesolimbic dopamine in food and drug reward and addiction has been the subject of much investigation (30,31,32). Interestingly, underweight food-deprived adult rats also have lower levels of basal extracellular accumbens dopamine than normal weight rats (6,7,8). Overall, it appears that low basal accumbens dopamine levels, irrespective of nutritional status or body weight, are linked to enhanced motivation for food intake. In the case of underweight animals, enhanced motivation for not only food intake but also other dopamine-releasing agents such as drugs of abuse has been established (33). In addition, sugar binging in rats potentiates accumbens dopamine release similarly to drugs of abuse (34). Those studies focused on the link between mesoaccumbens dopamine and normal feeding showed that mesolimbic dopamine mediates the appetitive or consummatory phase of feeding. Others and we have observed a dopamine increase in the nucleus accumbens after a meal (6, 19, 35,36,37). One interpretation of such findings is that mesoaccumbens dopamine release is a signal that pertains to satiation. When the dopamine signal is attenuated, satiation is not achieved, and hyperphagia ensues as a compensatory response to elevate depressed dopamine levels.

Evidence directly linking mesoaccumbens dopamine signaling to obesity is limited. However, we have reported low extracellular dopamine levels in the nucleus accumbens of rats fed a high-energy cafeteria-type diet and low dopamine signal after electrical stimulation of the accumbens in ob/ob mice (8, 9). Furthermore, functional inhibition of the nucleus accumbens shell via the GABAergic inhibitory interneurons induces hyperphagia in ad libitum fed animals (32). These observations are consistent with our findings that hyperphagic obesity-prone rats have reduced dopamine signaling in the nucleus accumbens, although this deficit has now been established to precede the expression of the obesity phenotype. The notion that decreased nucleus accumbens dopamine signaling leads to increased feeding is compatible with the finding that obese humans have reduced central D2 receptor levels (10) and that administration of dopamine agonists to ob/ob mice normalizes hyperphagia (38, 39).

In conclusion, this article describes the first direct evidence that a low midbrain dopamine signal is present in animals with a predisposition to dietary obesity. Deficits in mesolimbic dopamine neurotransmission are an essential component of a neurochemical phenotype of obesity predisposition that induces a compensatory behavioral response, hyperphagia, to elevate central dopamine release. Taken together, these results underscore the importance of motivational and hedonic pathways in addition to hypothalamic homeostatic pathways in the regulation of appetite and feeding behavior; and strengthen the argument that obesity could be approached as an addictive disorder and not only as a metabolic imbalance. Targeting presynaptic components of the mesolimbic dopamine system may provide an approach to both screen for and effectively treat obesity predisposition.

Acknowledgments

The work was supported by DK065872 (E.N.P.), DA023760 (B.M.G.), P30 NS047243 (Tufts Center for Neuroscience Research), P30 DK34928 (Tufts GRASP Center), and a Smith Family New Investigator award through the Medical Foundation (E.N.P.).

References

  1. Berthoud H R, Morrison C. The brain, appetite, and obesity. Annu Rev Psychol. 2008;59:55–92. doi: 10.1146/annurev.psych.59.103006.093551. [DOI] [PubMed] [Google Scholar]
  2. Hernandez L, Hoebel B G. Feeding can enhance dopamine turnover in the prefrontal cortex. Brain Res Bull. 1990;25:975–979. doi: 10.1016/0361-9230(90)90197-8. [DOI] [PubMed] [Google Scholar]
  3. Hernandez L, Hoebel B G. Feeding and hypothalamic stimulation increase dopamine turnover in the accumbens. Physiol Behav. 1988;44:599–606. doi: 10.1016/0031-9384(88)90324-1. [DOI] [PubMed] [Google Scholar]
  4. Yoshida M, Yokoo H, Mizoguchi K, Kawahara H, Tsuda A, Nishikawa T, Tanaka M. Eating and drinking cause increased dopamine release in the nucleus accumbens and ventral tegmental area in the rat: measurement by in vivo microdialysis. Neurosci Lett. 1992;139:73–76. doi: 10.1016/0304-3940(92)90861-z. [DOI] [PubMed] [Google Scholar]
  5. Mark G P, Rada P, Pothos E, Hoebel B G. Effects of feeding and drinking on acetylcholine release in the nucleus accumbens, striatum, and hippocampus of freely behaving rats. J Neurochem. 1992;58:2269–2274. doi: 10.1111/j.1471-4159.1992.tb10973.x. [DOI] [PubMed] [Google Scholar]
  6. Pothos E N, Creese I, Hoebel B G. Restricted eating with weight loss selectively decreases extracellular dopamine in the nucleus accumbens and alters dopamine response to amphetamine, morphine, and food intake. J Neurosci. 1995;15:6640–6650. doi: 10.1523/JNEUROSCI.15-10-06640.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Pothos E N, Hernandez L, Hoebel B G. Chronic food deprivation decreases extracellular dopamine in the nucleus accumbens: implications for a possible neurochemical link between weight loss and drug abuse. Obes Res. 1995;3:525S–529S. doi: 10.1002/j.1550-8528.1995.tb00222.x. [DOI] [PubMed] [Google Scholar]
  8. Pothos E N, Sulzer D, Hoebel B G. Plasticity of quantal size in ventral midbrain dopamine neurons: possible implications for the neurochemistry of feeding and reward. Appetite. 1998;31:405. doi: 10.1006/appe.1998.0210. [DOI] [PubMed] [Google Scholar]
  9. Fulton S, Pissios P, Manchon R P, Stiles L, Frank L, Pothos E N, Maratos-Flier E, Flier J S. Leptin regulation of the mesoaccumbens dopamine pathway. Neuron. 2006;51:811–822. doi: 10.1016/j.neuron.2006.09.006. [DOI] [PubMed] [Google Scholar]
  10. Wang G J, Volkow N D, Logan J, Pappas N R, Wong C T, Zhu W, Netusil N, Fowler J S. Brain dopamine and obesity. Lancet. 2001;357:354–357. doi: 10.1016/s0140-6736(00)03643-6. [DOI] [PubMed] [Google Scholar]
  11. Mutch D M, Clément K. Unraveling the genetics of human obesity. PLoS Genet. 2006;2:e188. doi: 10.1371/journal.pgen.0020188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Considine R V, Sinha M K, Heiman M L, Kriauciunas A, Stephens T W, Nyce M R, Ohannesian J P, Marco C C, McKee L J, Bauer T L, Caro J F. Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med. 1996;334:292–295. doi: 10.1056/NEJM199602013340503. [DOI] [PubMed] [Google Scholar]
  13. Levin B E, Dunn-Meynell A A, Balkan B, Keesey R E. Selective breeding for diet-induced obesity and resistance in Sprague-Dawley rats. Am J Physiol. 1997;273:R725–R730. doi: 10.1152/ajpregu.1997.273.2.R725. [DOI] [PubMed] [Google Scholar]
  14. Levin B E, Dunn-Meynell A A. Reduced central leptin sensitivity in rats with diet-induced obesity. Am J Physiol. 2002;283:R941–R948. doi: 10.1152/ajpregu.00245.2002. [DOI] [PubMed] [Google Scholar]
  15. Paxinos G, Watson C. Amsterdam: Academic Press; The Rat Brain in Stereotaxic Coordinates. 2007 [Google Scholar]
  16. Walker Q D, Rooney M B, Wightman R M, Kuhn C M. Dopamine release and uptake are greater in female than male rat striatum as measured by fast cyclic voltammetry. Neuroscience. 2000;95:1061–1070. doi: 10.1016/s0306-4522(99)00500-x. [DOI] [PubMed] [Google Scholar]
  17. Pothos E N, Davila V, Sulzer D. Presynaptic recording of quanta from midbrain dopamine neurons and modulation of the quantal size. J Neurosci. 1998;18:4106–4118. doi: 10.1523/JNEUROSCI.18-11-04106.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dijk F, van Leeuwen S, Kamphuis W. Differential effects of ischemia/reperfusion on amacrine cell subtype-specific transcript levels in the rat retina. Brain Res. 2004;1026:194–204. doi: 10.1016/j.brainres.2004.08.034. [DOI] [PubMed] [Google Scholar]
  19. Hernandez L, Lee F, Hoebel B G. Microdialysis in the nucleus accumbens during feeding or drugs of abuse: amphetamine, cocaine and phencyclidine. Kalivas P W, Nemeroff C B, editors. New York: New York Academy of Sciences; The Mesocorticolimbic Dopamine System. 1988:508–511. [Google Scholar]
  20. Holtje M, Winter S, Walther D, Pahner I, Hortnagl H, Ottersen O P, Bader M, Ahnert-Hilger G. The vesicular monoamine content regulates VMAT2 activity through Gαq in mouse platelets: evidence for autoregulation of vesicular transmitter uptake. J Biol Chem. 2003;278:15850–15858. doi: 10.1074/jbc.M212816200. [DOI] [PubMed] [Google Scholar]
  21. Höltje M, von Jagow B, Pahner I, Lautenschlager M, Hörtnagl H, Nürnberg B, Jahn R, Ahnert-Hilger G. The neuronal monoamine transporter VMAT2 is regulated by the trimeric GTPase Go2. J Neurosci. 2000;20:2131–2141. doi: 10.1523/JNEUROSCI.20-06-02131.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sulzer D, Rayport S. Amphetamine and other psychostimulants reduce pH gradients in midbrain dopaminergic neurons and chromaffin granules: a mechanism of action. Neuron. 1990;5:797–808. doi: 10.1016/0896-6273(90)90339-h. [DOI] [PubMed] [Google Scholar]
  23. Fon E A, Pothos E N, Sun B C, Killeen N, Sulzer D, Edwards R H. Vesicular transport regulates monoamine storage and release but is not essential for amphetamine action. Neuron. 1997;19:1271–1283. doi: 10.1016/s0896-6273(00)80418-3. [DOI] [PubMed] [Google Scholar]
  24. Pothos E N, Larsen K E, Krantz D E, Liu Y, Haycock J W, Setlik W, Gershon M D, Edwards R H, Sulzer D. Synaptic vesicle transporter expression regulates vesicle phenotype and quantal size. J Neurosci. 2000;20:7297–7306. doi: 10.1523/JNEUROSCI.20-19-07297.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Leinninger G M, Myers M G., Jr LRb signals act within a distributed network of leptin-responsive neurones to mediate leptin action. Acta Physiol (Oxf) 2008;192:49–59. doi: 10.1111/j.1748-1716.2007.01784.x. [DOI] [PubMed] [Google Scholar]
  26. Farooqi I S, Bullmore E, Keogh J, Gillard J, O'Rahilly S, Fletcher P C. Leptin regulates striatal regions and human eating behavior. Science. 2007;317:1355. doi: 10.1126/science.1144599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Harris G C, Wimmer M, Randall-Thompson J F, Aston-Jones G. Lateral hypothalamic orexin neurons are critically involved in learning to associate an environment with morphine reward. Behav Brain Res. 2007;183:43–51. doi: 10.1016/j.bbr.2007.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Berthoud H R. Brain, appetite and obesity. Physiol Behav. 2005;85:1–2. doi: 10.1016/j.physbeh.2005.04.006. [DOI] [PubMed] [Google Scholar]
  29. Hommel J D, Trinko R, Sears R M, Georgescu D, Liu Z W, Gao X B, Thurmon J J, Marinelli M, DiLeone R J. Leptin receptor signaling in midbrain dopamine neurons regulates feeding. Neuron. 2006;51:801–810. doi: 10.1016/j.neuron.2006.08.023. [DOI] [PubMed] [Google Scholar]
  30. Salamone J D, Correa M, Mingote S M, Weber S M. Beyond the reward hypothesis: alternative functions of nucleus accumbens dopamine. Curr Opin Pharmacol. 2005;5:34–41. doi: 10.1016/j.coph.2004.09.004. [DOI] [PubMed] [Google Scholar]
  31. Di Chiara G, Bassareo V, Fenu S, De Luca M A, Spina L, Cadoni C, Acquas E, Carboni E, Valentini V, Lecca D. Dopamine and drug addiction: the nucleus accumbens shell connection. Neuropharmacology. 2004;47:227–241. doi: 10.1016/j.neuropharm.2004.06.032. [DOI] [PubMed] [Google Scholar]
  32. Kelley A E, Baldo B A, Pratt W E, Will M J. Corticostriatal-hypothalamic circuitry and food motivation: integration of energy, action and reward. Physiol Behav. 2005;86:773–795. doi: 10.1016/j.physbeh.2005.08.066. [DOI] [PubMed] [Google Scholar]
  33. Carroll M E. The role of food deprivation in the maintenance and reinstatement of cocaine-seeking behavior in rats. Drug Alcohol Depend. 1985;16:95–109. doi: 10.1016/0376-8716(85)90109-7. [DOI] [PubMed] [Google Scholar]
  34. Avena N M, Rada P, Hoebel B G. Evidence for sugar addiction: behavioral and neurochemical effects of intermittent, excessive sugar intake. Neurosci Biobehav Rev. 2008;32:20–39. doi: 10.1016/j.neubiorev.2007.04.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ahn S, Phillips A G. Modulation by central and basolateral amygdalar nuclei of dopaminergic correlates of feeding to satiety in the rat nucleus accumbens and medial prefrontal cortex. J Neurosci. 2002;22:10958–10965. doi: 10.1523/JNEUROSCI.22-24-10958.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Bassareo V, Di Chiara G. Modulation of feeding-induced activation of mesolimbic dopamine transmission by appetitive stimuli and its relation to motivational state. Eur J Neurosci. 1999;11:4389–4397. doi: 10.1046/j.1460-9568.1999.00843.x. [DOI] [PubMed] [Google Scholar]
  37. Martel P, Fantino M. Mesolimbic dopaminergic system activity as a function of food reward: a microdialysis study. Pharmacol Biochem Behav. 1996;53:221–226. doi: 10.1016/0091-3057(95)00187-5. [DOI] [PubMed] [Google Scholar]
  38. Bina K G, Cincotta A H. Dopaminergic agonists normalize elevated hypothalamic neuropeptide Y and corticotropin-releasing hormone, body weight gain, and hyperglycemia in ob/ob mice. Neuroendocrinology. 2000;71:68–78. doi: 10.1159/000054522. [DOI] [PubMed] [Google Scholar]
  39. Scislowski P W, Tozzo E, Zhang Y, Phaneuf S, Prevelige R, Cincotta A H. Biochemical mechanisms responsible for the attenuation of diabetic and obese conditions in ob/ob mice treated with dopaminergic agonists. Int J Obes Relat Metab Disord. 1999;23:425–431. doi: 10.1038/sj.ijo.0800893. [DOI] [PubMed] [Google Scholar]

Articles from The FASEB Journal are provided here courtesy of The Federation of American Societies for Experimental Biology

RESOURCES