Dietary Resistant Starch Increases Hypothalamic POMC Expression in Rats

Abstract

Resistant starch (RS) is fermentable dietary fiber. Inclusion of RS in the diet causes decreased body fat accumulation and altered gut hormone profile. This study investigates the effect of feeding RS on the neuropeptide messenger RNA (mRNA) expressions in the arcuate nucleus (ARC) of the hypothalamus and whether vagal afferent nerves are involved. The rats were injected intraperitoneally with capsaicin to destroy unmyelinated small vagal afferent nerve fibers. The cholecystokinin (CCK) food suppression test was performed to validate the effectiveness of the capsaicin treatment. Then, capsaicin-treated rats and vehicle-treated rats were subdivided into a control diet or a RS diet group, and fed the corresponding diet for 65 days. At the end of study, body fat, food intake, plasma peptide YY (PYY) and glucagon-like peptide 1 (GLP-1), and hypothalamic pro-opiomelanocortin (POMC), neuropeptide Y (NPY), agouti-related peptide (AgRP) gene expressions were measured. RS-fed rats had decreased body fat, increased POMC expression in the hypothalamic ARC, and elevated plasma PYY and GLP-1 in both the capsaicin and vehicle-treated rats. Hypothalamic NPY and AgRP gene expressions were not changed by RS or capsaicin. Therefore, destruction of the capsaicin-sensitive afferent nerves did not alter the response to RS in rats. These findings suggest that dietary RS might reduce body fat through increasing the hypothalamic POMC expression and vagal afferent nerves are not involved in this process. This is the first study to show that dietary RS can alter hypothalamic POMC expression.

INTRODUCTION

Resistant starches (RSs) are nondigestible fermentable dietary fibers that resist digestion in the small intestine, but are fermented in the large intestine. Adding RS to diets produces several health benefits, including lower body fat storage (1,2). Some human studies claim that diets containing RS increase satiety and decrease food intake (3–5) and the opposite result has also been reported (6). These equivocal results are due to the lack of direct comparisons in these studies, as dietary texture and energy content used in those studies are different. In contrast to human studies, we previously reported that body fat is consistently lower in RS-fed animals compared to control animals fed the same dietary texture and energy density diet (7–9). Thus, RS might be an alternative dietary carbohydrate for developing weight control diets.

The mechanism of decreased body fat by RS is not completely understood. As dietary fiber, RS dilutes the energy density of the diet, which previously was considered the main mechanism for decreased body fat by RS. Another assumption is that fermentation of RS causes discomfort in the gut, which leads to decreased food intake and body weight. However, RS-fed animals eat the same or more food than controls (9), which indicates at most only minor effects of gut discomfort in decreased body fat. We recently found that RS-fed animals also have significantly higher levels of peptide YY (PYY) and glucagon-like peptide-1 (GLP-1) (9,10). PYY and GLP-1 are gut-secreted hormones and candidates for antiobesity drugs (11,12). Administration of PYY or GLP-1 reduces food intake and body weight in animals and humans (13–15). These two hormones alter energy balance by sending signals from the gut to the brain, and result in brain neuropeptide expression changes (16). Therefore, the mechanism of decreased body fat by RS may also relate to the similar gut–brain connection and the regulation of brain neuropeptides.

Neuropeptides expressed in the brain hypothalamic area are key factors in regulation of energy homeostasis. In the arcuate nucleus (ARC) of the hypothalamus, there are two sets of neurons: neuropeptide Y/agouti-related peptide (NPY/AgRP) and pro-opiomelanocortin (POMC) neurons. These neurons respond to peripheral signals, such as hormones and nutrients and regulate energy homeostasis. Activation of POMC neurons increases energy expenditure, and activation of NPY/AgRP neurons increases food intake (17,18). Studies show PYY and GLP-1 affect the activities of hypothalamic NPY/AgRP and POMC neurons (19–22). Peripheral injection of PYY decreases NPY messenger RNA (mRNA) (13,23) and increases POMC mRNA in the hypothalamus (23). The modulation of NPY/AgRP and POMC neurons by PYY or GLP-1 can be direct or through vagal nerves (24–26). The modulation of brain neuropeptides, NPY, AgRP, and POMC, by RS is unknown, except the most recent report showing that RS-fed mice have high activity in the hypothalamus measured by neuronal magnetic resonance imaging (27).

This study investigates the role of hypothalamic neuropeptides and vagal nerves on decreasing body fat by RS. We hypothesize that (i) the hypothalamic NPY/AgRP and POMC mRNA expression are altered in RS-fed rats; and (ii) afferent vagal nerves are involved in this process. Rats’ visceral afferent nerves were destroyed with a neurotoxin, capsaicin to examine whether the effect of RS would be abolished. NPY, AgRP, and POMC mRNA expressions in ARC of hypothalamus were measured in rats fed RS and control diets.

METHODS AND PROCEDURES

Animals and diet

Fifty-two male Sprague-Dawley rats aged 7–8 weeks and weighing 150–200 g at the beginning of the study, were obtained from Harlan Industries (Indianapolis, IN). They were housed individually in hanging wire-mesh cages in a temperature-controlled room (22 ± 1 °C) on a 12 h/12 h light/dark cycle with the light on at 7 AM. Rats were acclimated for 1 week to a powdered diet and to the cages. Water and assigned diet were available ad libitum during the experiment except as noted. The protocols were approved by Pennington Biomedical Research Institutional Animal Care and Use Committee.

The composition of the two experimental diets used in this study is listed in Table 1. The RS diet contained 30% (wt/wt) RS (Hi-Maize cornstarch; National Starch & Chemical, Bridgewater, NJ). The equal energy density control diet had 100% amylopectin cornstarch (Amioca; National Starch and Chemical) as the carbohydrate source and equal energy density as RS diet (3.3 kcal/g) by using nonfermentable cellulose (Dyets, Bethlehem, PA) to dilute the energy density.

Table 1.

Experimental diet composition

	Control		RS
Ingredients	Grams (1,000 g/kg)	kcal (3.3 kcal/g)	Grams (1,000 g/kg)	kcal (3.3 kcal /g)
100% Amylopectin	424.5	1,485.8	0	0
High amylose starch
60% amylose/40% amylopectin	0	0	530.7	1,486
Sucrose	100	400	100	400
Casein	200	716	200	716
Soybean oil	70	591.5	70	591.5
Cellulose	156.2	0	50	0
Mineral mix	35	30.8	35	30.8
Vitamin mix	10	38.7	10	38.7
Choline chloride	1.3	0	1.3	0
L-cystine	3.0	12	3.0	12

Capsaicin treatment

After 1 week of acclimation, rats were grouped according to weight with a randomized block design. Two groups of rats were injected intraperitoneally with either capsaicin or vehicle under inhalation anesthesia (isoflurane). The total capsaicin dose (117.5 mg/kg; Sigma Chemical, St Louis, MO) was administered as a series of injections on 3 consecutive days in increasing doses (12.5, 30, and 75 mg/kg) (28). Capsaicin was dissolved in a mixed solution of 10% ethanol, 10% Tween 80, and 80% sterile saline. The injection volume is 0.5 ml/100 g body weight. During the injection of capsaicin, artificial ventilation and chest massage were provided to all rats who exhibited respiratory arrest, which typically occurred in the first few minutes after injection. The survival rate during the capsaicin treatment was 70%.

The effectiveness of the capsaicin treatment was validated using the cholecystokinin (CCK) feeding-suppression test, a capsaicin-sensitive vagal nerve dependent response (28).

CCK feeding-suppression test

Four days after the last capsaicin or vehicle injection, all rats were injected intraperitoneally with either CCK or saline after an overnight fasting. Half of the capsaicin and vehicle-treated rats received CCK (6 μg/kg, Sigma Chemical), and the other half received the same volume of saline 5 min prior to given access to food. Then food intake was measured for the following 30 min. Three days later, the same test was repeated except that the rats receiving CCK previously were injected with saline, and the rats that received saline previously were injected with CCK. In the vehicle-treated rats, the administration of CCK significantly suppressed 30-min food intakes in overnight fasted rats (5.22 ± 0.14g vs. 2.86 ± 0.17 g; P < 0.001). But all capsaicin-treated rats failed to respond to CCK and did not reduce food intake (4.63 ± 0.19 g vs. 4.18 ± 0.15 g; P = 0.12).

Experimental design

Nine days after the capsaicin treatment, both capsaicin and vehicle-treated rats were divided into two diet treatment groups, RS and energy control, by randomized block design based on their weight. The four groups of rats were fed their assigned diets for 65 days. Food intake and body weight were measured three times per week throughout the experiment. After 65 days, the animals were killed through decapitation. Different fat pads (epididymal fat, perirenal fat, and remaining fat in the abdominal area, defined as abdominal fat) were removed and weighed. Total body fat used for body fat calculation was the sum of epididymal fat, perirenal fat, and abdominal fat. The gastrointestinal tract was removed and weighed after removal of mesenteric fat. Disemboweled weight was calculated by subtracting gastrointestinal weight from body weight.

Plasma assays

Blood was collected in EDTA tubes and centrifuged at 4,000 g for 20 min to extract plasma. Plasma PYY, GLP-1, and leptin were measured by radioimmunoassay with RIA kits from Linco Research (St. Louis, MO). The intraassay and interassay coefficients of variation are 3.2and 9.4% for PYY, 29 and 10% for GLP-1, and 4.1 and 3.0% for leptin respectively.

Microdissection of the ARC in the hypothalamus

Brains from decapitated rats were quickly removed, frozen on dry ice and stored at −70 °C. The middle brain was dissected using a cryostat. Microdissection of the ARC was performed using the procedure described by Palkovits (29). Five continuous coronal sections were collected starting from Bregma −2.12 to −3.4 mm for the ARC micropunch. The thicknesses of sections were 300 μm each. The micropunch was performed bilaterally under a microscope, using a needle (Stoelting, Chicago, IL) with an inner diameter of 0.51 mm.

Measurements of NPY, AGRP, and POMC mRNA expression

RNA was extracted from dissected ARC using Absolutely RNA microprep kit from Stratagene (La Jolla, CA). The gene transcription for AgRP, NPY, and POMC in the ARC of the hypothalamus was determined using real-time reverse transcriptase PCR, and results were expressed as a ratio to the expression of the constitutive gene cyclophilin. The sequences of TaqMan probes and primers for cyclophilin (GenBank accession no. M15933) were: (5′-3′) forward primer, CCCACCGTGTTCTTCGACAT; reverse primer, TGCAAACAGCTCGAAGCAGA; and probe, CAAGGGCTCGCCATCAGCCG. For NPY (GenBank accession no. M20373), they were: forward primer, TCTGCCTGTCCCACCAATG; reverse primer, CAACGACAACAAGGGAAATGG, and probe, CCACCACCAGGCTGGATTCCGA. For AGRP, they were: forward primer, TTGGCAGAGGTGCTAGATCCA, reverse primer, AGGACTCGTGCAGCCTTACAC, and probe, CGAGTCTCGTTCTCCGCGTCGC. The probe and primers for POMC (assay identification no. Rn00595020_ml) were purchased from Applied Biosystems (Foster City, CA). The detailed real-time reverse transcriptase PCR conditions and data analysis are the same as published previously (30).

Statistical analysis

Data are presented as means ± s.e.m. Statistical analyses were performed using the Statistical Analysis System (SAS 9.1). A factorial arrangement of the treatments (two-way ANOVA) was used to examine the influence of the two main effects of diet and capsaicin/vehicle treatment on all measurements. Subgroup means were compared by Tukey's method.

RESULTS

POMC, NPY, and AgRP mRNA expression in ARC of hypothalamus

POMC expression in the ARC (Figure 1) was significantly upregulated by dietary RS (P < 0.05). Capsaicin treatment did not affect the influence of RS on POMC expression (P > 0.05). There were no effects of dietary RS or capsaicin injection on expression of NPY and AgRP (Figure 1).

Figure 1.

Dietary Resistant Starch increases (a) pro-opiomelanocortin (POMC), but not (b) neuropeptide Y (NPY), and (c) agouti-related peptide (AgRP) messenger RNA (mRNA) expressions in arcuate nucleus of Resistant Starch–fed rats treated with vehicle or capsaicin. Data are mean ± s.e.m. for group of 7–9 rats. For POMC mRNA expression, diet: P < 0.05, capsaicin: P > 0.05, Interaction: P > 0.05 by two-way ANOVA. For NPY and AgRP, there were no significant effects on diet, capsaicin, and interaction. *P < 0.05 vs. controls within the same treatment (vehicle or capsaicin).

Fat pads weights

Compared with rats fed the control diet, dietary RS significantly decreased total body fat and fat/disemboweled weight in both the vehicle and capsaicin groups. There was no interaction between diet and treatment (P > 0.05), although both diet and treatment had an effect on these two measures (diet P < 0.001, treatment P < 0.01) (Figure 2).

Figure 2.

(a) Total body fat and (b) percentage of body fat/disemboweled body weight were decreased in Resistant Starch–fed rats treated with vehicle or capsaicin. Data are mean ± s.e.m. for group of 10–11 rats. Two-way ANOVA analysis indicates there were significant diet (P < 0.001) and a significant capsaicin treatment effects (P < 0.01), with no interaction effect. *P < 0.05 vs. controls within the same treatment (vehicle or capsaicin).

Plasma PYY, GLP-1, and leptin concentrations

Plasma PYY and GLP-1 were increased by RS feeding in both vehicle- and capsaicin-treated rats (treatment P > 0.05, diet P < 0.001, interaction P > 0.05. Figure 3). Plasma leptin was decreased in RS-fed rats (treatment P > 0.05, diet P < 0.05, interaction P > 0.05. Table 2).

Figure 3.

(a) Plasma total peptide YY (PYY) and (b) total glucagon-like peptide 1 (GLP-1) concentrations were increased in rats fed Resistant Starch. Data are mean ± s.e.m. for group of 10–11 rats. For both a and b, there was a significant diet effect (P < 0.001) but not a capsaicin treatment effect (P > 0.05) and no interaction effect (P > 0.05). *P < 0.05 vs. controls within the same treatment (vehicle or capsaicin). PM, pmol/l.

Table 2.

Food intake, body weight, and plasma leptin in Resistant Starch–fed rats treated with capsaicin or vehicle

	Cumulative food intake (g)	Body weighta(g)	Plasma leptin (ng/ml)
Vehicle-C	1,256.6 ± 9.0	391.3 ± 7.2	1.85 ± 0.41
Vehicle-RS	1,302.6 ± 9.8	379.1 ± 9.6	1.16 ± 0.26
Capsaicin-C	1,380.5 ± 15.6	377.8 ± 7.5	2.17 ± 0.47
Capsaicin-RS	1,403.9 ± 9.8	360.3 ± 11.7	1.27 ± 0.18

There were no significant differences in food intake and disemboweled body weight between control and RS-fed rats. However, rats treated with capsaicin had lower disemboweled body weights and higher cumulative food intake compare to vehicle-treated rats (P < 0.05). RS-fed rats had lower plasma leptin than the rats fed control diet (treatment P > 0.05, diet P < 0.05, interaction P > 0.05). Data are mean ± s.e.m. for group of 10–11 rats.

Vehicle-C, vehicle-treated rats fed control diet. Vehicle-RS, vehicle-treated rats fed Resistant Starch diet. Capsaicin-C, capsaicin-treated rats fed control diet.

Capsaicin-RS, capsaicin-treated rats fed Resistant Starch diet.

^aBody weight represents disemboweled body weight.

Food intake and disemboweled weight

Rats treated with capsaicin had lower disemboweled body weights and higher cumulative food intake compared with vehicle-treated rats (treatment P < 0.05 by two-way ANOVA). There were no statistical differences of food intake between control and RS-fed rats within capsaicin or vehicle treatment groups, demonstrating no or minimal discomfort with the consumption of RS at the levels in their diet. Because RS-fed rats had significantly heavier gastrointestinal contents, the disemboweled body weight was used to exclude gastrointestinal contents from body weight. There was no significant difference for disemboweled body weight between control and RS-fed rats within capsaicin or vehicle treatment groups (Table 2).

DISCUSSION

In this study, we investigate the mechanism of decreased body fat by dietary RS. We demonstrate that dietary RS increases hypothalamic POMC expression independent of capsaicin-sensitive neurons in rats. Specifically, we measured mRNA expressions of POMC, NPY, and AgRP in the ARC in the context of RS feeding and capsaicin treatment. To our knowledge, our finding provides the first direct evidence that dietary RS alters brain neuropeptide expression in rats.

Feeding RS significantly upregulated the expression of POMC, but had no effect on the expressions of NPY and AgRP in rats. These results are consistent with the observation that food intake is similar between control and RS-fed rats in our study. Actually, RS-fed rats have a tendency to eat more food. Although studies show that RS-fed animals decrease energy intake compared to the control diet–fed animals, we noticed that the control diet used in those studies had higher energy density than the RS diet (27). In human subjects, there are uncertain and contradictive reports on the satiety effects of RS (2), but fatty acid oxidation is significantly increased after consumption of RS (2). Thus, the decreased body fat in RS-fed rats is most likely the result of increased energy expenditure and activation of POMC neurons, rather than from decreased food intake via altering NPY/AgRP neurons.

The increased POMC and decreased body fat in RS-fed rats are independent of capsaicin-sensitive vagal nerves because the capsaicin treatment did not block any RS effects tested in this study. In vehicle-treated rats, dietary RS decreased body fat and increased plasma PYY and GLP-1 levels, which is consistent with our previous publications (9,10). Interestingly, the effect of RS was retained in rats when their vagal nerves were destroyed by capsaicin, implying the signals generated from the gut act directly on the brain, not via the vagal nerve. Still, there is a small chance that noncapsaicin sensitive vagal nerves can convey signals from the gut to the brain, because capsaicin only destroys small, unmyelinated primary sensory vagal afferent nerves (31). Capsaicin treatment also induces the axon and terminal degeneration in several discrete forebrain and hindbrain areas, besides primary sensory vagal afferent nerves (32). Regardless, our results indicate that the effects of RS on body fat and hypothalamic POMC gene expression do not rely on the involvement of capsaicin-sensitive nerves and those brain areas.

Our results bring an interesting question: what causes the increased POMC expression in RS-fed rats? RS potentially has three major effects as a part of the diet: metabolizable energy dilution, a bulking effect, and fermentation to produce short-chain fatty acids and increase PYY and GLP-1 (9). In our study, control and RS diets have the same energy density, so the energy dilution effect can be excluded. The bulking effect is due to the high fiber content in RS diet. If the bulking causes the changes in POMC, destroying vagal afferent nerves should prevent the changes, as distension signals from the gut to the brain are vagal afferent nerve dependent (33). But our results indicate otherwise. Thus, the mechanism of increased POMC was narrowed down to the fermentation of RS and the subsequent increases of PYY and GLP-1. There is also a concern that leptin may play a role in the change of neuronpeptide mRNA expression in consideration that RS-fed rats have lower body fat. We measured the plasma leptin level and found RS-fed rats had lower leptin levels. Therefore, leptin will not be a factor contributing to the increased POMC expression. Further studies are needed for a conclusive determination for the cause of increased POMC in RS-fed animals.

Another question raised from our results is why RS-fed rats do not decrease food intake despite having higher PYY and GLP-1? Our previous unpublished results indicate a broader gut-secreted hormone profile is changed by dietary RS. We suspect that the other hormones/factors modulated by RS may oppose the effects of PYY and GLP-1 on food intake. Additionally, both PYY and GLP-1 have active and inactive forms (16,34). Total PYY and GLP-1 were increased in our study, while PYY and GLP-1 reduction of food intake is based on injecting active forms of PYY and GLP-1 (15,35).

PYY has two forms: PYY 1–36 and PYY3–36. When PYY1–36 is released from L-cells of the ileum and large intestine, it is quickly converted to PYY3-36 by the enzyme dipeptidyl peptidase-IV (16). PYY1–36 and PYY3–36 have counteracting effects on food intake. PYY3-36 has been shown to inhibit appetite and decrease food intake by binding to Y2-receptors and exerting a negative impact on the NPY neuron (13). In contrast, central injection of PYY1–36 prompts food intake through an Y1-receptor-mediated action (36). Our unpublished data have showed that the consistent higher plasma total PYY was observed over 24 h in RS-fed rats, suggesting a continuously-released pattern for PYY in RS-fed rats. This release pattern is different from meal-stimulated PYY releases. Thus, the ratio of PYY1-36 and PYY3-36 may be high in RS-fed animals and the counteracting effects of these two peptides would account for the lack of food intake differences between RS-fed rats and controls.

We noticed that capsaicin-treated rats had a higher cumulative food intake compared to vehicle-treated rats. It has been reported that both the Y2-receptor and GLP-1 receptor are present on vagal afferent fibers (37,38). These receptors could be destroyed by the capsaicin treatment by which contributes to increased food intake in capsaicin-treated rats. Even so, it is unlikely that capsaicin interferes with food intake in RS-fed rats because their food intake is similar to the controls in both vehicle- and capsaicin-treated groups.

PYY3-36 and GLP-1 can also directly affect POMC neuron activity (23,39). Two studies suggested that PYY3–36 can stimulate POMC neuron activity (13,23). However, the effect of PYY3–36 on POMC neuron activity still remains controversial: other groups have shown that PYY3–36 inhibits rather than activates hypothalamic POMC neurons (20,22). Moreover, peripheral PYY injection still induces a normal anorectic response in POMC knockout mice (40). Therefore, effects of RS on stimulating POMC expression are more likely explained by elevated GLP-1 in RS-fed animals. This deduction is based on a combination of our results and the following evidence. First, GLP-1 receptors are found located in the ARC where they overlap hypothalamic POMC neurons’ residency (41). Second, GLP-1 excites POMC neurons postsynaptically through interaction with GLP-1 receptors in POMC cells from mouse ARC brain slices (39). Third, our RS-fed rats had decreased body fat without reduced energy intake compared to controls. This indicates that there was increased energy expenditure in RS-fed rats, and GLP-1 increased energy expenditure (26). Further studies are needed to block the GLP-1 action to determine if changes on POMC in RS-fed rats could also be blocked.

In conclusion, the mechanism of decreased body fat by RS is linked to increased neuropeptide POMC gene expression in the hypothalamus and such an effect is independent of involvement of visceral afferent capsaicin-sensitive neurons. Our findings provide a further understanding of how RS works as a dietary ingredient to reduce body fat.