Abstract
Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, a mold suggested to play an etiologic role in damp building-related illnesses. Acute intranasal exposure of mice to SG specifically induces apoptosis in olfactory sensory neurons of the nose. The PC-12 rat pheochromocytoma cell model was used to elucidate potential mechanisms of SG-induced neuronal cell death. Agarose gel electrophoresis revealed that exposure to SG at 10 ng/ml or higher for 48-h induced DNA fragmentation characteristic of apoptosis in PC-12 cells. SG-induced apoptosis was confirmed by microscopic morphology, hypodiploid fluorescence and annexin V-fluorescein isothiocyanate (FITC) uptake. Messenger RNA expression of the proapoptotic genes p53, double-stranded RNA–activated protein kinase (PKR), BAX, and caspase-activated DNAse was significantly elevated from 6 to 48 h after SG treatment. SG also induced apoptosis and proapoptotic gene expression in neural growth factor-differentiated PC-12 cells. Although SG-induced caspase-3 activation, caspase inhibition did not impair apoptosis. Moreover, SG induced nuclear translocation of apoptosis-inducing factor (AIF), a known contributor to caspase-independent neuronal cell death. SG-induced apoptosis was not affected by inhibitors of oxidative stress or mitogen-activated protein kinases but was suppressed by the PKR inhibitor C16 and by PKR siRNA transfection. PKR inhibition also blocked SG-induced apoptotic gene expression and AIF translocation but not caspase-3 activation. Taken together, SG-induced apoptosis in PC-12 neuronal cells is mediated by PKR via a caspase-independent pathway possibly involving AIF translocation.
Keywords: apoptosis, PC-12, PKR, C16, Satratoxin G, Stachybotrys, cell culture, cytotoxicity, RT-PCR, natural products
The black mold Stachybotrys chartarum grows on cellulose-containing building materials such as gypsum board, ceiling tiles and wood following water damage and is detectable in indoor air samples taken during air quality investigations (Pestka et al., 2007). Chronic indoor exposures to S. chartarum in water-damaged homes and workplaces following water damage have been postulated to contribute to debilitating respiratory (Croft et al., 2002; Hodgson et al., 1998; Johanning et al., 1996) and nonrespiratory symptoms involving immune and neurological impairment (Gordon et al., 2004; Johanning et al., 1996). Although in vitro and in vivo research on S. chartarum and its mycotoxins suggests that adverse effects in humans are biologically plausible, establishing an etiologic role in building-related illnesses requires further investigation of mechanisms of action and dose response relationships as well as accurate measurement of exposure in water-damaged buildings (Institute of Medicine, 2004).
The trichothecenes are a family of over 200 fungal sesquiterpenoid metabolites that are extremely potent translational inhibitors (Grove, 2007). Trichothecenes can further activate mitogen-activated protein kinases (MAPKs) and initiate both inflammatory gene expression and apoptosis in vitro and in vivo in a process known as the ribotoxic stress response (Pestka et al., 2004). Because Stachybotrys conidiospores and submicron mycelial fragments contain satratoxin G (SG) and other macrocyclic trichothecenes (Brasel et al., 2005; Gregory et al., 2004), understanding the cellular targets and mechanisms of these toxins is of critical importance.
We have recently observed that single intranasal instillations with SG or two other related macrocyclic trichothecenes, isosatratoxin F, and roridin A, cause apoptosis in the murine nose after 24 h with olfactory sensory neurons (OSNs) and the olfactory bulb (OB) being prominent targets (Islam et al., 2006, 2007). The onset of OSN apoptosis and atrophy correspond with increases of proapoptotic gene expression in the nasal turbinates, but the upstream mechanisms remain unclear.
Double-stranded RNA (dsRNA)–activated protein kinase (PKR) is a widely expressed dual specificity (serine/theonine and tyrosine) protein kinase that is activated by dsRNA, interferon, trichothecene mycotoxins and other agents (Williams, 2001; Zhou et al., 2003). PKR associates with the ribosome (Wu et al., 1998) and can selectively shut down translation via phosphorylation of eukaryotic initiation factor 2α as well as activate nuclear factor kappa B (NF-κB) (Garcia et al., 2007). Furthermore, PKR has been demonstrated to mediate apoptosis induced by dsRNA, lipopolysaccharide (LPS), and tumor necrosis factor (TNF)-α (Der et al., 1997; Gil and Esteban, 2000; Yeung and Lau, 1998; Yeung et al., 1996). Our laboratory has previously shown that MAPK activation and apoptosis induction by trichothecene deoxynivalenol (DON) and other translational inhibitors is downregulated in monocyte and macrophage cultures treated with PKR inhibitors as well as in PKR-deficient monocyte cultures (Zhou et al., 2003). These findings imply that a potential critical role exists for this kinase in trichothecene-induced apoptosis. Interestingly, following intranasal instillation of mice to SG (Islam et al., 2006) or roridin A (Islam et al., 2007), PKR messenger RNA (mRNA) concentrations in nasal turbinates are upregulated in parallel with OSN apoptosis.
The observation that macrocyclic trichothecenes can selectively target OSN and OB is of particular interest because diminution of olfactory function has been associated with early stages of neurodegenerative illnesses such as Parkinson's and Alzheimer's diseases (Demarquay et al., 2007; Hawkes, 2003; Takeda et al., 2007). Several investigations of SG's effects in vitro have been conducted in leukocytes (Chung et al., 2003; Gregory et al., 2004; Sorenson et al., 1987; Yang et al., 2000), however, understanding the mechanisms for induction of OSN death by macrocyclic trichothecenes requires study of their direct effects in neuronal cell cultures.
In general, primary cell neuronal cultures present major problems relative to their inability to maintain cell division and heterogeneity (Slotkin et al., 2007). Although there have been several reports of cloned OSN cell cultures (Coronas et al., 1997; Illing et al., 2002; Lakard et al., 2007), these are as yet not generally available and their robustness for mechanistic toxicology studies has not been established. The neural crest-derived pheochromocytoma cell line (PC-12) (Greene and Tischler, 1976) is well-characterized and is widely employed to model undifferentiated, dividing neuronal cultures and in differentiated cells with phenotypic and functional characteristics of sympathetic and sensory neuronal cells (Aykin-Burns and Ercal, 2006; Hegg and Miletic, 1998; Henck et al., 2001; Westerink and Ewing, 2008). PC-12 cells have been useful in studies of neurotoxic chemicals (Brenneman et al., 2000; Walkinshaw and Waters, 1994) and recently, Nusuetrong et al. (2005) reported that satratoxin H (SH)–induced apoptosis occurs in PC-12 cells.
The purpose of this study was to characterize mechanisms of SG-induced apoptosis in PC-12 cultures relative to gene expression and intracellular signaling. The results strongly suggest that SG-induced neuronal cell death is mediated by PKR via a caspase-independent pathway.
MATERIALS AND METHODS
Cells and reagents.
PC-12 cells were obtained from American Type Culture Collection (Manassas, VA). All chemicals were purchased from Sigma Chemical Co. (St Louis, MO) unless otherwise noted. SG was purified from S. chartarum cultures as previously described (Hinkley and Jarvis, 2001) and identity confirmed by electrospray ionization/collision-induced dissociation tandem mass spectroscopy (Tuomi et al., 1998). Inhibitors of oxidative stress (L-N-acetylcysteine (NAC), L-N-nitro-arginine methyl ester (NAME), quercetin), MAPKs (SB203580, p38; PD98059, extracellular-signal regulated kinases (ERK); C-jun N-terminal kinases (JNK) inhibitor I, JNK), PKR (C16 and PKR inhibitor negative control), and caspase-3 (cell-permeable, DEVD-CHO) were obtained from Calbiochem (San Diego, CA).
Experimental design
PC-12 cells were cultured in 100 mm × 20 mm dishes (Corning, NY) with 10 ml of F-12K medium (ATCC) supplemented with 2.5% (vol/vol) fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA), 15% (vol/vol) horse serum (Atlanta Biologicals), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco-BRL, Rockville, MD) at 37°C with 6% CO2. Cells were harvested by centrifugation at 250 × g for 10 min and resuspended in 10 ml of culture medium in a 50-ml culture tube (Corning, NY). The cell suspensions were passaged through a 22-gauge 1.5-inch needle four to five times to yield single cells and these were then reconstituted in culture medium to 5 × 105 cells/ml.
For experiments with naïve (undifferentiated) PC-12 cells, single cell suspensions (5 × 105/ml) were transferred to six-well (2 ml/well) or 12-well (1 ml per well) collagen-coated plates (BD Biosciences Pharmingen, San Diego, CA) where they grew adherently. Prior to toxin treatment, cells were cultured for 24 h to minimize background stress activation. SG was dissolved in pyrogen-free water (Sigma Chemical Co.) and added to supplemented F-12K medium for addition to cell cultures. For inhibition studies, cells were preincubated with various pharmacologic inhibitors for 30 min prior to SG treatment. For some experiments, PC-12 cells were differentiated to the neuronal phenotype by incubation with 100 ng/ml of nerve growth factor (NGF) for 5 days prior to treatment with SG and/or inhibitors (Levi et al., 1985).
DNA fragmentation analysis by agarose gel electrophoresis.
PC-12 cells were extracted and analyzed for DNA fragmentation as described previously (Islam et al., 2002). In brief, cells were harvested by scraping with a disposable cell lifter (Fisher brand), suspended in phosphate-buffered saline (PBS), centrifuged for 10 min (250 × g) at 4°C and the pellet suspended in 0.1 ml of hypotonic lysing buffer (10mM Tris, pH 7.4, 10mM ethylenediaminetetraacetic acid [EDTA], pH 8.0, 0.5% [vol/vol] Triton X-100). Cells were incubated for 10 min at 4°C and the resultant lysate was centrifuged for 30 min (13,000 × g) at 4°C. The supernatant, which contained fragmented DNA, was digested for 1 h at 37°C with 0.4 μg/ml of RNase A (Roche, Indianapolis, IN) and then incubated 1 h at 37°C with 0.4 μg/ml of proteinase K (Roche). DNA was precipitated with 50% (vol/vol) isopropanol in 0.5M NaCl at −20°C overnight. The precipitate was centrifuged at 13,000 × g for 30 min at 4°C. The resultant pellet was air dried and resuspended in 10mM Tris (pH 7.4), 1mM EDTA (pH 8.0). An aliquot equivalent to 1 × 106 cells was electrophoresed at 70 V for 2 h in 2% (wt/vol) agarose gel in 90mM Tris–borate buffer containing 2mM EDTA (pH 8.0). After electrophoresis, the gel was stained with ethidium bromide (0.5 μg/ml), and the nucleic acids were visualized with a ultraviolet transilluminator. A 100-bp DNA ladder (GIBCO-BRL) was used for molecular sizing.
Light microscopy.
Cells were fixed with 4% (vol/vol) formaldehyde in Dulbecco's phosphate buffer (PBS) (Sigma) for microscopic visualization of apoptotic morphology. Light microscopic photographs were obtained using a Nikon epifluorescent microscope equipped with a SPOT-RT digital camera (Diagnostic Instruments, Detroit, MI).
Flow cytometry.
Apoptotic cells were assayed by flow cytometric measurement of hypodiploid cell fluorescence following propidium iodide (PI) staining (Islam et al., 2002). Culture media was repeatedly pipetted onto plate surface to release cells and cells centrifuged for 10 min (250 × g) at 4°C. Cells (1 × 106) were resuspended in 0.2 ml of PBS, mixed with 0.2 ml of heat-inactivated fetal bovine serum, and fixed immediately by dropwise addition of 1.2 ml of ice-cold 70% (vol/vol) ethanol with gentle mixing. Cells were held at 4°C overnight, washed and incubated in 1 ml PI DNA staining reagent (PBS containing 50 μg/ml PI, 50 μg/ml RNase A, 0.1mM EDTA disodium, and 0.1% [vol/vol] Triton X-100) on ice until analysis. Cell cycle distribution for single cells was measured with a Becton Dickinson FACS Vantage (San Jose, CA). Data from 5000 cells were collected in list mode. The 488 line of an argon laser was used to excite PI and fluorescence was detected at 615–645 nm. The cell cycle of individual cells was performed using doublet discrimination gating to eliminate doublet and cell aggregate based on DNA fluorescence. A gate was selected to include hypofluorescent cells. Cells in the DNA histogram with hypofluorescent DNA were designated apoptotic. All other cells distributed in a normal cell cycle profile.
Apoptosis was further assessed by a second flow cytometric method employing an annexin V-fluorescein isothiocyanate (FITC) Apoptosis Detection Kit (BD-Pharmingen, San Diego, CA) which detects early redistribution of phosphatidylserine from the inner to the outer layer of the cell membrane of apoptotic cells. Briefly, treated cells were released from the plate surface, washed twice with ice-cold PBS and cells (1 × 105) then resuspended in 100 μl of binding buffer. Annexin V-FITC (5 μl) and PI (5 μl) solutions were added, and the cell suspension vortexed gently. The cell suspension was held on ice for 10 min, and then mixed with 400 μl of binding buffer. Stained cell suspensions were immediately analyzed by flow cytometry using the Becton Dickinson FACS Vantage.
Real-time PCR.
Total RNA was isolated from PC-12 cells using RNeasy Protect Mini kit (Qiagen Inc. Valencia, CA). Real-time PCR for apoptosis-related genes (Caspase-3, p53, PKR, BAX, CAD) was performed on an ABI PRISM 7900HT Sequence Detection System using Taqman One-Step RT-PCR Master Mix and Assays-on-Demand primer/probe gene expression products according to the manufacturer's protocols (Applied Biosystems, Foster City, NY). Relative quantification of apoptotic and cytokine gene expression was carried out using an 18S RNA control and an arithmetic formula method (Audige et al., 2003).
Caspase-3 assay.
PC-12 cells were suspended in 200 μl of 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) buffer (100mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [pH 7.5] containing 10% [vol/vol] sucrose, 0.5% [wt/vol] CHAPS, 1mM EDTA, 10mM dithiotreitol, and 1% [vol/vol] protease inhibitor cocktail [Sigma]) and subjected to four repeated freeze-thaw cycles. Cell lysates were centrifuged at 10,000 × g for 10 min at 4°C. Following protein assay using a DC Protein Quantitation Kit (Bio-Rad), lysates were adjusted to 50 μg/100 μl CHAPS buffer and then incubated at 37°C for 30 min with an equal volume of fluorogenic substrate consisting of 25μM DEVD-AMC (Calbiochem, San Diego, CA) dissolved in CHAPS buffer. Substrate cleavage was measured using a Cyto Fluor II microplate fluorescence reader (Biosearch, Bedford, MA) at excitation and emission wavelengths of 360 and 460 nm, respectively.
Confocal microscopic analysis of apoptosis-inducing factor translocation.
PC-12 cells were grown to approximately 80% confluency on collagen-coated eight-well slide (BD Biosciences Pharmingen, San Diego, CA) containing 400 μl of medium. Cells were then incubated with PKR C16 inhibitor, PKR negative inhibitor or DMSO vehicle. SG (10 ng/ml) was added 30 min later and the culture incubated for 12–24 h. Cells were washed twice with PBS and fixed with 3% (vol/vol) formaldehyde in PBS for 15 min at room temperature. Cells were washed twice with PBS and permeabilized by incubation with 400 μl of Triton (2% Triton X-100 in PBS) per well for 15 min at 25°C. The cells were blocked with 400 μl of Odyssey blocking buffer (Li-Cor Biosciences, Lincoln, NE) per well for 1 h. For immunostaining, slides were incubated with rabbit AIF polyclonal antibody (eBioscience Inc., San Diego, CA) diluted (1:100) in Odyssey blocking buffer (100 μl per well) at 25°C for 1 h. Wells were washed four times with PBS and then incubated with 100 μl per well FITC-conjugated goat anti-rabbit antibody (Sigma) diluted (1:100) in Odyssey blocking buffer for 1 h at 25°C in the dark. Wells were washed four times with PBS and then incubated with 100 μl of 4′,6-diamidino-2-phenylindole (DAPI) (0.5 μg/ml), a marker for cell nuclei, for 5 min. Unbound DAPI was washed away and slides were mounted in Vectashield mounting media for fluorescence (Vector labs, Burlingame, CA). Control slides included omission of the primary antibody or omission of the secondary antibody. PC-12 cells were visualized on a multichannel confocal laser-scanning microscope (Olympus FluoView 1000 LSCM; LUMPlanFl × 40W water-immersion objective; NA 0.8) equipped with imaging analysis software (FV10-ASW 1.5; Olympus). FITC dye was excited at 488 nm and band pass filtered from 505 to 605 nm, and DAPI was excited at 405 nm and band pass filtered from 430 to 470 nm. Images were collected sequentially to minimize fluorescent bleedthrough between emission channels.
PKR siRNA transfection.
Rat PKR and control siRNA cocktails (PKR ON-TARGETplus SMARTpool or ON-TARGETplus siCONTROL Nontargeting Pool) were purchased from Dharmacon RNA Technologies (Chicago, IL). The four target sequences for the PKR pool were (1) sense-GAUGGAAAUCCUCGAACAAUU and antisense 5′-PUUGUUCGAGGAUUUCCAUCUU, (2) sense-GGAUUAUAQUACACUCGAAAUU and antisense-5′-PUUUCGAGUGUAUAUAAUCCUU, (3) sense-GAACAAAAGUCAUCGUUAGUU and antisense-5′-PCUAACGAUGACUUUUGUUCUU, (4) sense-GGAAAAGAGAAAUCGGAGUUU and antisense-5′-PACUCCGAUUUCUCUUUUCCUU. Cells were cultured on 100 mm × 20 mm dishes with 10 ml of F-12K medium as described above until approximately 80% confluency was reached and then collected, centrifuged (250 × g) for 10 min at 25°C and resuspended in 10 ml of culture medium. Cell suspensions were passed through 22G 1.5-inch needle four to five times and then diluted in culture medium (2 × 106 cells/ml) for nucleofection. Cells were centrifuged and resuspended in 100 μl of Nucleofector solution, mixed with siRNAs and electroporated using program U-029 and the Amaxa Nucleofector (Amaxa Biosystems, Gaithersburg, MD). Transfected cells were cultured for 48 h on collagen-coated plates as described above prior to SG treatment.
Detection of PKR protein.
Cells were collected by centrifugation, washed with PBS, lysed in 50 μl of hot lysis buffer (1% [wt/vol] sodium dodecylsulfate, 1mM sodium ortho-vanadate and 10mM Tris, pH 7.4) and then boiled for 5 min. The lysate was vortexed and centrifuged at 12,000 × g for 15 min at 4°C. Total cellular proteins were resolved by 12% (wt/vol) acrylamide gel and transferred to a polyvinylidene difluoride membrane (Amersham, Arlington Heights, IL). Blots were incubated in Odyssey blocking buffer (LI-COR Biosciences) for 1 h at room temperature with gentle shaking. The membrane was then incubated for another 1 h with primary mouse anti-rat PKR monoclonal antibody (B-10; Santa Cruz Biotechnology Inc., Santa Cruz, CA) and mouse anti-rat β-actin monoclonal antibody (Sigma) diluted in Odyssey blocking buffer (1:1000 and 1:10,000, respectively). The blot was washed four times for 5 min each at 25°C in 0.1% Tween-20 in PBS and then incubated for 1 h with IRdye 800CW-labeled secondary goat polyclonal anti-mouse IgG (LI-COR Biosciences). The membrane was washed four times for 5 min each at 25°C in 0.1% Tween-20 in PBS, rinsed with PBS to remove residual Tween-20 and then scanned with an Odyssey Infrared Imaging System (LI-COR Biosciences). Anti-PKR and anti-actin antibodies binding evoked fluorescent bands that resolved at 68 and 42 kDa, respectively.
Statistics.
Data were statistically analyzed with SigmaStat v 3.1 (Jandel Scientific, San Rafael, CA) with the criterion for significance set at p < 0.05. Morphometric and RT-PCR data were compared using one-way ANOVA with Student-Newman-Keuls post-test.
RESULTS
SG Induces Apoptosis in Undifferentiated PC-12 Cells
The capacity of SG to induce apoptosis in undifferentiated PC-12 cells was first assessed by monitoring DNA fragmentation. SG concentrations of 10 ng/ml (18.4nM) or higher of SG after 48 h induced DNA fragmentation into 200-kb fragments (Fig. 1A). The characteristic morphological features of apoptosis were detectable microscopically 48 h after SG treatment (Fig. 1B). When frequencies of hypodiploid fluorescent apoptotic cells were quantitated following PI staining of DNA, apoptotic cell percentages were also found to be significantly increased after 48 h incubation with SG at 10 ng/ml or higher (Fig. 1C). Annexin V-FITC/PI staining of live cells revealed that the number of annexin V-FITC+/PI− cells increased (lower right quadrant, Fig. 1D) by 10-fold following SG treatment compared with control cells, thus suggesting the presence of the apoptotic marker phosphoserine. Taken together, the resultant data from these four approaches suggested that SG induced characteristic features of apoptosis in undifferentiated PC-12 neuronal cells.
SG Induces Apoptotic Gene Expression in Undifferentiated PC-12 Cells
Expression of mRNAs for the proapoptotic genes caspase-3, p53, PKR, BAX, and CAD were measured by real-time PCR in control and SG-treated cells at several time intervals (Fig. 2). The tumor suppressor gene p53, which is involved in cell cycle arrest after DNA damage, was significantly upregulated from 6 to 48 h after SG treatment, as was CAD, which targets and damages DNA, and PKR. Expression of BAX, which induces mitochondrial-related proteins with proapoptotic activity, was upregulated at 18 and 48 h. mRNA expression for caspase-3, which activates CAD, was not significantly affected by the treatment at any time during the 48 h period.
SG Induces Apoptosis and Proapoptotic Gene Expression in NGF-Differentiated PC-12 Cells
The ability of SG to evoke apoptosis in NGF-differentiated PC-12 cells was also determined. SG induced DNA fragmentation in naïve PC-12 cells at 5, 10, and 25 ng/ml and NGF-differentiated cells at 10 and 25 ng/ml (Fig. 3A). SG upregulated expression of two representative proapoptotic genes, p53 and CAD similarly in naïve and differentiated PC-12 cells (Fig. 3B). Thus, NGF-differentiated PC-12 cells were also susceptible to SG-induced apoptosis and proapoptotic gene expression. Based on these findings, undifferentiated cells were used for remaining experiments unless otherwise noted.
SG-Induced Apoptosis is Caspase-3 Independent
The role of caspase-3 in SG-induced apoptosis was assessed in PC-12 cells. Incubation with 10 ng/ml SG markedly induced caspase-3 activity after 18 h and thereafter (Fig. 4A). However, although incubation with the caspase inhibitor DEVD-CHO effectively blocked caspase-3 activation (Fig. 4B), SG-induced apoptosis was unaffected (Fig. 4C). These results suggest that SG-induced apoptosis was caspase-3-independent.
SG Induces AIF Translocation
Nuclear translocation of AIF reportedly contributes to caspase-independent apoptosis in PC-12 neuronal cells (Liou et al., 2005) as well as in mouse neurodegeneration models (Wang et al., 2003). Immunofluorescence detection of AIF in conjunction with confocal microscopy revealed markedly increased AIF immunoreactivity in the nuclei of PC-12 cells 12 h after SG addition as compared with vehicle-treatment (Fig. 5). Elevated AIF immunoreactivity in SG-treated cells was still detectable after 24 h but at markedly lower levels than at 12 h. These data indicate that SG induced AIF translocation into the nucleus by 12 h and to a lesser extent after 24 h.
SG-Induced Apoptosis and Proapoptotic Gene Expression is Suppressed by PKR Inhibition
PC-12 cells were pretreated with a panel of pharmacologic inhibitors to assess potential upstream roles of oxidative stress, MAPKs and PKR in SG-induced apoptosis. Cells were harvested 48 h after SG treatment and hypodiploid fluorescent cells measured by flow cytometry (Fig. 6A). Neither inhibitors of oxidative stress, (L-NAC, L-NAME, and quercetin) nor inhibitors of p38, ERK, and JNK modulated SG-induced apoptosis. In contrast, SG-induced apoptosis was completely inhibited by the PKR inhibitor C16 (Jammi et al., 2003). When a structural analog of the PKR inhibitor was used as a negative control, SG-induced apoptosis was not affected (Fig. 6B). Consistent with the aforementioned findings, C16 suppressed expression of the proapoptotic genes p53, PKR, BAX, and CAD at 18 h (Fig. 7A). SG-induced proapoptotic gene expression in NGF-differentiated PC-12 cells was similarly suppressed by the PKR inhibitor (Fig. 7B).
PKR siRNA Knockdown Inhibits SG-Induced Apoptosis
The role of PKR in SG-induced PC-12 cell apoptosis was confirmed by knockdown with PKR siRNAs. Electroporation with a PKR siRNA cocktail at 0.1, 1, 5, and 10μM followed by a 48 h incubation markedly suppressed expression of PKR protein as compared with that for negative control siRNA (Fig. 8A). SG-induced apoptosis was significantly reduced in cells treated with PKR-siRNA at all concentrations (Figs. 8B and 8C). SG similarly induced apoptosis in cells electroporated in the presence and absence of negative control siRNA suggesting the absence of off-target effects (Fig. 8C). Collectively, the siRNA data indicated that SG-induced apoptosis in PC-12 cells is likely to be a PKR-dependent process.
PKR Mediates SG-Induced AIF Translocation but not Caspase-3 Activation
Preincubation with C16 did not inhibit SG-induced caspase-3 activity indicating that activation of this enzyme was a PKR-independent effect (Fig. 9). However, PKR inhibition blocked AIF translocation to the nucleus (Fig. 10) at 12 h, whereas the PKR negative inhibitor control or vehicle alone had no effect. PKR-dependent SG-induced apoptosis in PC-12 thus appeared to be linked to AIF nuclear translocation but not caspase-3 activation.
DISCUSSION
The capacity of macrocyclic trichothecenes to selectively target neurons in the nose and in the brain of mice following intranasal instillation is of fundamental importance because olfactory function loss often occurs with early stages of neurodegenerative illnesses such as Parkinson's and Alzheimer's diseases (Demarquay et al., 2007; Hawkes, 2003; Takeda et al., 2007). Understanding how SG causes apoptosis in PC-12 cells can provide insight how this and other macrocyclic trichothecenes induce apoptosis in OSNs following intranasal instillation (Islam et al., 2006, 2007). The results presented here indicate that SG induced apoptosis in both naïve and differentiated PC-12 cells within 48 h. Prior to and during apoptosis onset, SG markedly upregulated expression of PKR, BAX, and p53, all three of which have been previously reported to mediate apoptosis in murine OSNs (Chang et al., 2002a; Ge et al., 2002; Huang et al., 1995). Expression of these genes is consistent with observations made previously in turbinates of mice within 24 h after single nasal instillations with macrocyclic trichothecenes (Islam et al., 2006, 2007). Although oxidative stress and MAPK were not observed here to contribute to SG-induced apoptosis, the process appeared to be mediated by PKR in a caspase-independent manner.
Relatively rapid apoptotic cell death (6–24 h) in PC-12 cells has been previously reported to be induced by SH, a macrocyclic trichothecene closely related to SG, at concentrations approximating 5–50 ng/ml (Nusuetrong et al., 2005). SH exposure induced phosphorylation of ERK 1/2, p38, and JNK 1/2, but in contradistinction to our findings, inhibition of p38 and JNK 1/2 blocked apoptosis. In further contrast, SH-induced p38 activation and apoptosis were suppressed by NAC, glutathione and glutathione reductase suggesting oxidative stress to be an underlying mechanism for the toxin's effects. A fundamental difference between the two studies was that the PC-12 cells were subjected to 24 h serum deprivation prior to inhibitor and SH treatment, whereas our study did not employ serum deprivation. Serum deprivation alone can evoke PC-12 apoptosis and this is mediated by oxidative stress (Ferrari et al., 1995; Liu et al., 2003; Maroto and Perez-Polo, 1997). Thus, oxidative stress might have exacerbated SH effects, making it difficult to discern the toxin's underlying mechanisms. Nevertheless, the aforementioned findings are important because they demonstrate that macrocyclic trichothecenes have the potential to interact with other stressors to evoke neuronal death.
Consistent with SG's effects on PC-12 cells, our laboratory has previously demonstrated in cloned macrophages that induction of apoptosis by the simple trichothecene DON is regulated by PKR (Pestka et al., 2004; Zhou et al., 2003). Although the role of PKR in mediating apoptosis in virus-infected cells is well-established (Garcia et al., 2007), PKR can be activated in the absence of viruses by the PKR-activating protein PACT and by its mouse homologue RAX (Bennett et al., 2004; Ito et al., 1999; Patel and Sen, 1998). PKR also mediates apoptosis induction by dsRNA, TNF-α, LPS, tunicamycin, or serum starvation (Cole, 2007).
Of particular significance to the present study, PKR has been linked to neuronal apoptosis. Chang et al. (2002a) demonstrated that PKR and eIF2α phosphorylation play a significant role in apoptosis of neuroblastoma cells and primary neuronal cultures induced by β-amyloid peptides, calcium ionophores and flavanoids. PKR activation has been associated with degenerating neurons in Alzheimer's (Chang et al., 2002b; Onuki et al., 2004; Peel, 2004), Parkinson's and Huntington's (Bando et al., 2005) diseases as well as amyotrophic lateral sclerosis (Garcia et al., 2006; Hu et al., 2003), HIV-associated dementia (Alirezaei et al., 2007), and retinal ganglion cell death (Shimazawa et al., 2007).
There are several possible downstream mechanisms by which PKR might mediate apoptosis. First, phosphorylation of eIF2α with accompanying translational inhibition have been proposed to be sufficient for PKR-induced apoptotic responses simply by inhibiting synthesis of anti-apoptotic factors such as inhibitor of protein synthesis (IAP) (Scheuner et al., 2006). Second, PKR-mediated phosphorylation has been demonstrated to induce the eIF2α/ATF4/CHOP pathway which drives expression of apoptotic genes (Lee et al., 2007). Finally, NF-κB activation by PKR has also been suggested to mediate apoptosis (Gil and Esteban, 2000). Proapoptotic genes regulated by NF-κB include p53, caspase 1, IRF-1, Fas L, and Fas (Garcia et al., 2006). Understanding involvement of NF-κB in the PC-12 model described here is complicated by this transcription factor's capacity to regulate expression of both proapoptotic and anti-apoptotic genes. Overall, clarification is needed on the mechanisms by which PKR mediates SG-induced apoptosis in neuronal cells.
Conventional apoptosis is generally considered to involve initiation of execution resulting from activation of caspases (Krantic et al., 2007). Caspase-3 is widely recognized to be a critical central mediator of apoptosis in many types of cells (Turk and Stoka, 2007) and has been specifically shown to mediate apoptosis in OSNs (Cowan and Roskams, 2004). Although caspase-3 is inactive in adult neuronal cells, it is reactivated upon injury and can contribute to normal apoptotic death (Stoka et al., 2006; Yakovlev et al., 2001). Caspase-3 and CAD can be activated by binding of death ligands to TNF-receptor family or in response to stress-induced mitochondrial proteins such as BAX (Green, 2000). Although SG did not induce caspase-3 gene expression, it did activate caspase-3. Thus, it was surprising that caspase-3 inhibition by DEVD-CHO did not inhibit SG-induced apoptosis. Relatedly, it was observed that the PKR inhibitor C16 did not inhibit SG-induced caspase-3 activity, even though it suppressed SG-induced apoptosis. Because DEVD-CHO also blocks caspase-6, caspase-7, caspase-8, and caspase-10 activity, caspases per se do not appear to be integral to SG-induced apoptosis.
Both caspase-dependent and caspase-independent neuronal cell death pathways have been described (Stefanis, 2005). The mitochondrial flavoprotein AIF is a primary mediator of caspase-independent apoptosis-like programmed cell death and has been linked to neurodegeneration (Cao et al., 2007; Krantic et al., 2007). Translocation of AIF from mitochondria to the nucleus acts as a proapoptotic trigger possibly by binding to DNA, stimulating DNAse activity and evoking DNA fragmentation (Cande et al., 2002; Martinou and Green, 2001; Ye et al., 2002). Both p53 and BAX have been shown to have upstream roles in AIF translocation (Cheung et al., 2005; Stambolsky et al., 2006). The possibility therefore exists that SG-induced p53 and BAX gene expression drives AIF translocation in PC-12 cells.
Taken together, the results presented herein indicate that SG induces PKR-dependent cell death in PC-12 cells that has the characteristics of apoptosis but does not appear to require caspases. Consistent with these observations, SG induces nuclear translocation of AIF, a known mediator of caspase-independent apoptosis-like programmed cell death. There is a need for improved understanding of both the mechanisms by which PKR drives SG-induced cell death and the role of AIF in this process. The relevance to these findings to previously observed SG-induced OSN cell death in mouse nasal turbinates will require further exploration using specific in vitro and in vivo models for this neuronal cell-type.
FUNDING
Michigan State University Foundation Strategic Partnership Grant and Public Health Service Grant (ES03358) to J.J.P. from the National Institute for Environmental Health Sciences.
Acknowledgments
We thank Dr Jack Harkema for advice as well as Sherry Shi, Sarah Godbehere, and Mary Rosner for technical support.
References
- Alirezaei M, Watry DD, Flynn CF, Kiosses WB, Masliah E, Williams BR, Kaul M, Lipton SA, Fox HS. Human immunodeficiency virus-1/surface glycoprotein 120 induces apoptosis through RNA-activated protein kinase signaling in neurons. J. Neurosci. 2007;27:11047–11055. doi: 10.1523/JNEUROSCI.2733-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Audige A, Yu ZR, Frey BM, Uehlinger DE, Frey FJ, Vogt B. Epithelial sodium channel (ENaC) subunit mRNA and protein expression in rats with puromycin aminonucleoside-induced nephrotic syndrome. Clin. Sci. (Lond) 2003;104:389–395. doi: 10.1042/. [DOI] [PubMed] [Google Scholar]
- Aykin-Burns N, Ercal N. Effects of selenocystine on lead-exposed Chinese hamster ovary (CHO) and PC-12 cells. Toxicol. Appl. Pharmacol. 2006;214:136–143. doi: 10.1016/j.taap.2005.12.002. [DOI] [PubMed] [Google Scholar]
- Bando Y, Onuki R, Katayama T, Manabe T, Kudo T, Taira K, Tohyama M. Double-strand RNA dependent protein kinase (PKR) is involved in the extrastriatal degeneration in Parkinson's disease and Huntington's disease. Neurochem. Int. 2005;46:11–18. doi: 10.1016/j.neuint.2004.07.005. [DOI] [PubMed] [Google Scholar]
- Bennett RL, Blalock WL, May WS. Serine 18 phosphorylation of RAX, the PKR activator, is required for PKR activation and consequent translation inhibition. J Biol. Chem. 2004;279:42687–42693. doi: 10.1074/jbc.M403321200. [DOI] [PubMed] [Google Scholar]
- Brasel TL, Douglas DR, Wilson SC, Straus DC. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia. Appl. Environ. Microbiol. 2005;71:114–122. doi: 10.1128/AEM.71.1.114-122.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brenneman KA, Wong BA, Buccellato MA, Costa ER, Gross EA, Dorman DC. Direct olfactory transport of inhaled manganese ((54)MnCl(2))? to the rat brain: Toxicokinetic investigations in a unilateral nasal occlusion model. Toxicol Appl Pharmacol. 2000;169:238–48. doi: 10.1006/taap.2000.9073. [DOI] [PubMed] [Google Scholar]
- Cande C, Cecconi F, Dessen P, Kroemer G. Apoptosis-inducing factor (AIF): Key to the conserved caspase-independent pathways of cell death? J. Cell Sci. 2002;115:4727–4734. doi: 10.1242/jcs.00210. [DOI] [PubMed] [Google Scholar]
- Cao G, Xing J, Xiao X, Liou AK, Gao Y, Yin XM, Clark RS, Graham SH, Chen J. Critical role of calpain I in mitochondrial release of apoptosis-inducing factor in ischemic neuronal injury. J. Neurosci. 2007;27:9278–9293. doi: 10.1523/JNEUROSCI.2826-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chang RC, Suen KC, Ma CH, Elyaman W, Ng HK, Hugon J. Involvement of double-stranded RNA-dependent protein kinase and phosphorylation of eukaryotic initiation factor-2alpha in neuronal degeneration. J. Neurochem. 2002a;83:1215–1225. doi: 10.1046/j.1471-4159.2002.01237.x. [DOI] [PubMed] [Google Scholar]
- Chang RC, Wong AK, Ng HK, Hugon J. Phosphorylation of eukaryotic initiation factor-2α (eIF2α) is associated with neuronal degeneration in Alzheimer's disease. Neuroreport. 2002b;13:2429–2432. doi: 10.1097/00001756-200212200-00011. [DOI] [PubMed] [Google Scholar]
- Cheung EC, Melanson-Drapeau L, Cregan SP, Vanderluit JL, Ferguson KL, McIntosh WC, Park DS, Bennett SA, Slack RS. Apoptosis-inducing factor is a key factor in neuronal cell death propagated by BAX-dependent and BAX-independent mechanisms. J. Neurosci. 2005;25:1324–1334. doi: 10.1523/JNEUROSCI.4261-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chung YJ, Jarvis B, Pestka J. Modulation of lipopolysaccharide-induced proinflammatory cytokine production by satratoxins and other macrocyclic trichothecenes in the murine macrophage. J. Toxicol. Environ. Health A. 2003;66:379–391. doi: 10.1080/15287390306363. [DOI] [PubMed] [Google Scholar]
- Cole JL. Activation of PKR: An open and shut case? Trends Biochem. Sci. 2007;32:57–62. doi: 10.1016/j.tibs.2006.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coronas V, Feron F, Hen R, Sicard G, Jourdan F, Moyse E. In vitro induction of apoptosis or differentiation by dopamine in an immortalized olfactory neuronal cell line. J. Neurochem. 1997;69:1870–1881. doi: 10.1046/j.1471-4159.1997.69051870.x. [DOI] [PubMed] [Google Scholar]
- Cowan CM, Roskams AJ. Caspase-3 and caspase-9 mediate developmental apoptosis in the mouse olfactory system. J. Comp Neurol. 2004;474:136–148. doi: 10.1002/cne.20120. [DOI] [PubMed] [Google Scholar]
- Croft WA, Jastromski BM, Croft AL, Peters HA. Clinical confirmation of trichothecene mycotoxicosis in patient urine. J. Environ. Biol. 2002;23:301–320. [PubMed] [Google Scholar]
- Demarquay G, Ryviln P, Royet JP. Olfaction and neurological diseases: A review of the literature. Revue Neurologique. 2007;163:155–167. doi: 10.1016/s0035-3787(07)90387-2. [DOI] [PubMed] [Google Scholar]
- Der SD, Yang YL, Weissmann C, Williams BR. A double-stranded RNA-activated protein kinase-dependent pathway mediating stress-induced apoptosis. Proc. Natl. Acad. Sci. U. S. A. 1997;94:3279–3283. doi: 10.1073/pnas.94.7.3279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferrari G, Yan CY, Greene LA. N-acetylcysteine (D- and L-stereoisomers) prevents apoptotic death of neuronal cells. J. Neurosci. 1995;15:2857–2866. doi: 10.1523/JNEUROSCI.15-04-02857.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garcia MA, Gil J, Ventoso I, Guerra S, Domingo E, Rivas C, Esteban M. Impact of protein kinase PKR in cell biology: From antiviral to antiproliferative action. Microbiol. Mol. Biol. Rev. 2006;70:1032–1060. doi: 10.1128/MMBR.00027-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garcia MA, Meurs EF, Esteban M. The dsRNA protein kinase PKR: Virus and cell control. Biochimie. 2007;89:799–811. doi: 10.1016/j.biochi.2007.03.001. [DOI] [PubMed] [Google Scholar]
- Ge Y, Tsukatani T, Nishimura T, Furukawa M, Miwa T. Cell death of olfactory receptor neurons in a rat with nasosinusitis infected artificially with Staphylococcus. Chem Senses. 2002;27:521–7. doi: 10.1093/chemse/27.6.521. [DOI] [PubMed] [Google Scholar]
- Gil J, Esteban M. Induction of apoptosis by the dsRNA-dependent protein kinase (PKR): Mechanism of action. Apoptosis. 2000;5:107–114. doi: 10.1023/a:1009664109241. [DOI] [PubMed] [Google Scholar]
- Gordon WA, Cantor JB, Johanning E, Charatz HJ, Ashman TA, Breeze JL, Haddad L, Abramowitz S. Cognitive impairment associated with toxigenic fungal exposure: A replication and extension of previous findings. Appl. Neuropsychol. 2004;11:65–74. doi: 10.1207/s15324826an1102_1. [DOI] [PubMed] [Google Scholar]
- Green DR. Apoptotic pathways: Paper wraps stone blunts scissors. Cell. 2000;102:1–4. doi: 10.1016/s0092-8674(00)00003-9. [DOI] [PubMed] [Google Scholar]
- Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. U. S. A. 1976;73:2424–2428. doi: 10.1073/pnas.73.7.2424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gregory L, Pestka JJ, Dearborn DG, Rand TG. Localization of satratoxin-G in Stachybotrys chartarum spores and spore-impacted mouse lung using immunocytochemistry. Toxicol. Pathol. 2004;32:26–34. doi: 10.1080/01926230490260790. [DOI] [PubMed] [Google Scholar]
- Grove JF. The trichothecenes and their biosynthesis. Fortschr. Chem. Org. Naturst. 2007;88:63–130. [PubMed] [Google Scholar]
- Hawkes C. Olfaction in neurodegenerative disorder. Movement Disorders. 2003;18:364–372. doi: 10.1002/mds.10379. [DOI] [PubMed] [Google Scholar]
- Hegg CC, Miletic V. Diminished blocking effect of acute lead exposure on high-threshold voltage-gated calcium currents in PC12 cells chronically exposed to the heavy metal. Neurotoxicology. 1998;19:413–420. [PubMed] [Google Scholar]
- Henck JW, Reindel JF, Anderson JA. Growth and development in rats given recombinant human epidermal growth factor (1-48) as neonates. Toxicol Sci. 2001;62:80–91. doi: 10.1093/toxsci/62.1.80. [DOI] [PubMed] [Google Scholar]
- Hinkley SF, Jarvis BB. Chromatographic method for Stachybotrys toxins. Methods Mol. Biol. 2001;157:173–194. [PubMed] [Google Scholar]
- Hodgson MJ, Morey P, Leung WY, Morrow L, Miller D, Jarvis BB, Robbins H, Halsey JF, Storey E. Building-associated pulmonary disease from exposure to Stachybotrys chartarum and Aspergillus versicolor. J. Occup. Environ. Med. 1998;40:241–249. doi: 10.1097/00043764-199803000-00006. [DOI] [PubMed] [Google Scholar]
- Hu JH, Zhang H, Wagey R, Krieger C, Pelech SL. Protein kinase and protein phosphatase expression in amyotrophic lateral sclerosis spinal cord. J Neurochem. 2003;85:432–442. doi: 10.1046/j.1471-4159.2003.01670.x. [DOI] [PubMed] [Google Scholar]
- Huang CC, Chen K, Huang TY. Immunohistochemical studies of sensory neurons in rat olfactory epithelium. Eur. Arch. Otorhinolaryngol. 1995;252:86–91. doi: 10.1007/BF00168026. [DOI] [PubMed] [Google Scholar]
- Illing N, Boolay S, Siwoski JS, Casper D, Lucero MT, Roskams AJ. Conditionally immortalized clonal cell lines from the mouse olfactory placode differentiate into olfactory receptor neurons. Molecular and Cellular Neuroscience. 2002;20:225–243. doi: 10.1006/mcne.2002.1106. [DOI] [PubMed] [Google Scholar]
- Institute of Medicine. Damp Indoor Spaces and Health. Washington, D.C.: National Academies Press; 2004. pp. 1–355. [PubMed] [Google Scholar]
- Islam Z, Amuzie CJ, Harkema JR, Pestka JJ. Neurotoxicity and inflammation in the nasal airways of mice exposed to the macrocyclic trichothecene mycotoxin roridin A: Kinetics and potentiation by bacterial lipopolysaccharide co-exposure. Toxicol. Sci. 2007;98:526–541. doi: 10.1093/toxsci/kfm102. [DOI] [PubMed] [Google Scholar]
- Islam Z, Harkema JR, Pestka JJ. Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and brain. Environ. Health Perspect. 2006;114:1099–1107. doi: 10.1289/ehp.8854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Islam Z, Moon YS, Zhou HR, King LE, Fraker PJ, Pestka JJ. Endotoxin potentiation of trichothecene-induced lymphocyte apoptosis is mediated by up-regulation of glucocorticoids. Toxicol. Appl. Pharmacol. 2002;180:43–55. doi: 10.1006/taap.2002.9374. [DOI] [PubMed] [Google Scholar]
- Ito T, Yang M, May WS. RAX, a cellular activator for double-stranded RNA-dependent protein kinase during stress signaling. J Biol. Chem. 1999;274:15427–15432. doi: 10.1074/jbc.274.22.15427. [DOI] [PubMed] [Google Scholar]
- Jammi NV, Whitby LR, Beal PA. Small molecule inhibitors of the RNA-dependent protein kinase. Biochem. Biophys. Res. Commun. 2003;308:50–57. doi: 10.1016/s0006-291x(03)01318-4. [DOI] [PubMed] [Google Scholar]
- Johanning E, Biagini R, Hull D, Morey P, Jarvis B, Landsbergis P. Health and immunology study following exposure to toxigenic fungi (Stachybotrys chartarum) in a water-damaged office environment. Int. Arch. Occup. Environ. Health. 1996;68:207–218. doi: 10.1007/BF00381430. [DOI] [PubMed] [Google Scholar]
- Krantic S, Mechawar N, Reix S, Quirion R. Apoptosis-inducing factor: A matter of neuron life and death. Prog. Neurobiol. 2007;81:179–196. doi: 10.1016/j.pneurobio.2006.12.002. [DOI] [PubMed] [Google Scholar]
- Lakard S, Lesniewska E, Michel G, Lakard B, Morrand-Villeneuve N, Versaux-Botteri C. In vitro induction of differentiation by retinoic acid in an immortalized olfactory neuronal cell line. Acta Histochem. 2007;109(2):111–121. doi: 10.1016/j.acthis.2006.10.001. [DOI] [PubMed] [Google Scholar]
- Lee ES, Yoon CH, Kim YS, Bae YS. The double-strand RNA-dependent protein kinase PKR plays a significant role in a sustained ER stress-induced apoptosis. FEBS Lett. 2007;581:4325–4332. doi: 10.1016/j.febslet.2007.08.001. [DOI] [PubMed] [Google Scholar]
- Levi A, Eldridge JD, Paterson BM. Molecular cloning of a gene sequence regulated by nerve growth factor. Science. 1985;229:393–395. doi: 10.1126/science.3839317. [DOI] [PubMed] [Google Scholar]
- Liou AK, Zhou Z, Pei W, Lim TM, Yin XM, Chen J. BimEL up-regulation potentiates AIF translocation and cell death in response to MPTP. FASEB J. 2005;19:1350–1352. doi: 10.1096/fj.04-3258fje. [DOI] [PubMed] [Google Scholar]
- Liu H, Nowak R, Chao W, Bloch KD. Nerve growth factor induces anti-apoptotic heme oxygenase-1 in rat pheochromocytoma PC12 cells. J. Neurochem. 2003;86:1553–1563. doi: 10.1046/j.1471-4159.2003.01978.x. [DOI] [PubMed] [Google Scholar]
- Maroto R, Perez-Polo JR. BCL-2-related protein expression in apoptosis: Oxidative stress versus serum deprivation in PC12 cells. J. Neurochem. 1997;69:514–523. doi: 10.1046/j.1471-4159.1997.69020514.x. [DOI] [PubMed] [Google Scholar]
- Martinou JC, Green DR. Breaking the mitochondrial barrier. Nat. Rev. Mol. Cell Biol. 2001;2:63–67. doi: 10.1038/35048069. [DOI] [PubMed] [Google Scholar]
- Nusuetrong P, Yoshida M, Tanitsu MA, Kikuchi H, Mizugaki M, Shimazu K, Pengsuparp T, Meksuriyen D, Oshima Y, Nakahata N. Involvement of reactive oxygen species and stress-activated MAPKs in satratoxin H-induced apoptosis. Eur. J Pharmacol. 2005;507:239–246. doi: 10.1016/j.ejphar.2004.11.046. [DOI] [PubMed] [Google Scholar]
- Onuki R, Bando Y, Suyama E, Katayama T, Kawasaki H, Baba T, Tohyama M, Taira K. An RNA-dependent protein kinase is involved in tunicamycin-induced apoptosis and Alzheimer's disease. EMBO J. 2004;23:959–968. doi: 10.1038/sj.emboj.7600049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Patel RC, Sen GC. PACT, a protein activator of the interferon-induced protein kinase, PKR. EMBO J. 1998;17:4379–4390. doi: 10.1093/emboj/17.15.4379. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peel AL. PKR activation in neurodegenerative disease. J. Neuropathol. Exp. Neurol. 2004;63:97–105. doi: 10.1093/jnen/63.2.97. [DOI] [PubMed] [Google Scholar]
- Pestka JJ, Yike I, Dearborn DG, Ward MD, Harkema JR. Stachybotrys chartarum, trichothecene mycotoxins, and damp building-related illness: New insights into a public health enigma. Toxicol. Sci. 2007 doi: 10.1093/toxsci/kfm284. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
- Pestka JJ, Zhou HR, Moon Y, Chung YJ. Cellular and molecular mechanisms for immune modulation by deoxynivalenol and other trichothecenes: Unraveling a paradox. Toxicol. Lett. 2004;153:61–73. doi: 10.1016/j.toxlet.2004.04.023. [DOI] [PubMed] [Google Scholar]
- Scheuner D, Patel R, Wang F, Lee K, Kumar K, Wu J, Nilsson A, Karin M, Kaufman RJ. Double-stranded RNA-dependent protein kinase phosphorylation of the alpha-subunit of eukaryotic translation initiation factor 2 mediates apoptosis. J. Biol. Chem. 2006;281:21458–21468. doi: 10.1074/jbc.M603784200. [DOI] [PubMed] [Google Scholar]
- Shimazawa M, Ito Y, Inokuchi Y, Hara H. Involvement of double-stranded RNA-dependent protein kinase in ER stress-induced retinal neuron damage. Invest Ophthalmol. Vis. Sci. 2007;48:3729–3736. doi: 10.1167/iovs.06-1122. [DOI] [PubMed] [Google Scholar]
- Slotkin TA, MacKillop EA, Ryde IT, Tate CA, Seidler FJ. Screening for developmental neurotoxicity using PC12 cells: Comparisons of organophosphates with a carbamate, an organochlorine, and divalent nickel. Environ. Health Perspect. 2007;115:93–101. doi: 10.1289/ehp.9527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sorenson WG, Frazer DG, Jarvis BB, Simpson J, Robinson VA. Trichothecene mycotoxins in aerosolized conidia of Stachybotrys atra. Appl. Environ. Microbiol. 1987;53:1370–1375. doi: 10.1128/aem.53.6.1370-1375.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stambolsky P, Weisz L, Shats I, Klein Y, Goldfinger N, Oren M, Rotter V. Regulation of AIF expression by p53. Cell Death. Differ. 2006;13:2140–2149. doi: 10.1038/sj.cdd.4401965. [DOI] [PubMed] [Google Scholar]
- Stefanis L. Caspase-dependent and -independent neuronal death: Two distinct pathways to neuronal injury. Neuroscientist. 2005;11:50–62. doi: 10.1177/1073858404271087. [DOI] [PubMed] [Google Scholar]
- Stoka V, Turk V, Bredesen DE. Differential regulation of the intrinsic pathway of apoptosis in brain and liver during ageing. FEBS Lett. 2006;580:3739–3745. doi: 10.1016/j.febslet.2006.05.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takeda A, Kikuchi A, Matsuzaki-Kobayashi M, Sugeno N, Itoyama Y. Olfactory dysfunction in Parkinson's disease. Journal of Neurology. 2007;254:2–7. [Google Scholar]
- Tuomi T, Saarinen L, Reijula K. Detection of polar and macrocyclic trichothecenes from indoor environments. Analyst. 1998;9:1835–1841. doi: 10.1039/a803813i. [DOI] [PubMed] [Google Scholar]
- Turk B, Stoka V. Protease signalling in cell death: Caspases versus cysteine cathepsins. FEBS Lett. 2007;581:2761–2767. doi: 10.1016/j.febslet.2007.05.038. [DOI] [PubMed] [Google Scholar]
- Walkinshaw G, Waters CM. Neurotoxin-induced cell death in neuronal PC12 cells is mediated by induction of apoptosis. Neuroscience. 1994;63:975–987. doi: 10.1016/0306-4522(94)90566-5. [DOI] [PubMed] [Google Scholar]
- Wang H, Shimoji M, Yu SW, Dawson TM, Dawson VL. Apoptosis inducing factor and PARP-mediated injury in the MPTP mouse model of Parkinson's disease. Ann. N. Y. Acad. Sci. 2003;991:132–139. doi: 10.1111/j.1749-6632.2003.tb07471.x. [DOI] [PubMed] [Google Scholar]
- Westerink RH, Ewing AG. The PC12 cell as model for neurosecretion. Acta Physiol (Oxf) 2008;192:273–285. doi: 10.1111/j.1748-1716.2007.01805.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams BR. Signal integration via PKR. Sci. STKE. 2001;2001:RE2. doi: 10.1126/stke.2001.89.re2. [DOI] [PubMed] [Google Scholar]
- Wu S, Kumar KU, Kaufman RJ. Identification and requirement of three ribosome binding domains in dsRNA-dependent protein kinase (PKR) Biochemistry. 1998;37:13816–13826. doi: 10.1021/bi981472h. [DOI] [PubMed] [Google Scholar]
- Yakovlev AG, Ota K, Wang G, Movsesyan V, Bao WL, Yoshihara K, Faden AI. Differential expression of apoptotic protease-activating factor-1 and caspase-3 genes and susceptibility to apoptosis during brain development and after traumatic brain injury. J. Neurosci. 2001;21:7439–7446. doi: 10.1523/JNEUROSCI.21-19-07439.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang GH, Jarvis BB, Chung YJ, Pestka JJ. Apoptosis induction by the satratoxins and other trichothecene mycotoxins: Relationship to ERK, p38 MAPK, and SAPK/JNK activation. Toxicol. Appl. Pharmacol. 2000;164:149–160. doi: 10.1006/taap.1999.8888. [DOI] [PubMed] [Google Scholar]
- Ye H, Cande C, Stephanou NC, Jiang S, Gurbuxani S, Larochette N, Daugas E, Garrido C, Kroemer G, Wu H. DNA binding is required for the apoptogenic action of apoptosis inducing factor. Nat. Struct. Biol. 2002;9:680–684. doi: 10.1038/nsb836. [DOI] [PubMed] [Google Scholar]
- Yeung MC, Lau AS. Tumor suppressor p53 as a component of the tumor necrosis factor-induced, protein kinase PKR-mediated apoptotic pathway in human promonocytic U937 cells. J. Biol. Chem. 1998;273:25198–25202. doi: 10.1074/jbc.273.39.25198. [DOI] [PubMed] [Google Scholar]
- Yeung MC, Liu J, Lau AS. An essential role for the interferon-inducible, double-stranded RNA-activated protein kinase PKR in the tumor necrosis factor-induced apoptosis in U937 cells. Proc. Natl. Acad. Sci. U. S. A. 1996;93:12451–12455. doi: 10.1073/pnas.93.22.12451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou HR, Lau AS, Pestka JJ. Role of double-stranded RNA-activated protein kinase R (PKR) in deoxynivalenol-induced ribotoxic stress response. Toxicol. Sci. 2003;74:335–344. doi: 10.1093/toxsci/kfg148. [DOI] [PubMed] [Google Scholar]