Skip to main content
Mutagenesis logoLink to Mutagenesis
. 2009 Jun 10;24(5):425–431. doi: 10.1093/mutage/gep025

RUNX2 mutations in Chinese patients with cleidocranial dysplasia

Yalin Li 1,2, Wei Pan 2, Wanfeng Xu 3, Nan He 4, Xuewu Chen 5, Hong Liu 6, L Darryl Quarles 4, Honghao Zhou 2, Zhousheng Xiao 2,4,*
PMCID: PMC2734498  PMID: 19515746

Abstract

Cleidocranial dysplasia (CCD) is an autosomal dominant bone disease in humans caused by haploinsufficiency of the RUNX2 gene. The RUNX2 has two major isoforms derived from P1 and P2 promoters. Over 90 mutations of RUNX2 have been reported associated with CCD. In our study, DNA samples of nine individuals from three unrelated CCD families were collected and screened for all exons of RUNX2 and 2 kb of P1 and P2 promoters. We identified two point mutations in the RUNX2 gene in Case 1, including a nonsense mutation (c.577C>T) that has been reported previously and a silent substitution (c.240G>A). In vitro studies demonstrated that c.577C>T mutation led to truncated RUNX2 protein production and diminished stimulating effects on mouse osteocalcin promoter activity when compared with full-length Runx2-II and Runx2-I isoforms. These results confirm that loss of function RUNX2 mutation (c.577C>T) in Case 1 family is responsible for its CCD phenotype.

Introduction

Cleidocranial dysplasia (CCD; MIM 119600) is a human autosomal dominant skeletal disorder characterized by persistently open or delayed closure of fontanelles, wormian bones, wide cranial sutures, absent and/or hypoplastic clavicles, wide pubic symphysis, cone-shaped thorax, short stature, late dentition, supernumerary teeth and other skeletal anomalies (13). It has been demonstrated that haploinsufficiency of the RUNX2 gene (MIM 600211) on human chromosome 6p21 is responsible for CCD (4,5). The transcription factor RUNX2 is a major regulator of osteoblastic differentiation and bone formation and has been shown to regulate a number of bone-related genes by binding to the DNA sequence element called RUNX-binding site (PyGPyGGT) (6,7), including Type I collagen, osteocalcin, osteopontin, bone sialoprotein, collagenase-3, vascular endothelial growth factorand Type X collagen (816). Several functional domains have been identified in RUNX2 proteins (17). The Runt domain is a highly conserved 128 amino acid region that shares a high degree of homology with the Drosophila pair-rule gene Runt and mediates DNA binding and protein heterodimerization with RUNX2 partner core binding factor-beta (CBF-β) (18,19). Toward the C-terminus is a nuclear localization signal domain and a region rich in proline–serine–threonine, which is necessary for RUNX2-mediated transcriptional regulation and which is involved in functional interactions with various other transcription factors, co-activators and co-repressors (17). RUNX2 also contains a region of glutamine–alanine repeats with potential transactivation function in the N-terminal region (17,20,21). As a whole, the RUNX2 gene contains eight coding exons spanning a genomic region of 130 kb and encodes two major isoforms by its two promoters P1 and P2. Furthermore, several other minor splice variants have been described recently (21,22).

Full deletion of Runx2 in mice leads to defective endochondral and membranous bone formation characterized by the maturational arrest of osteoblasts, no ossification, no vascular invasion of cartilage and newborn death from breathing difficulties due to lack of a mineralized rib cage (23,24). The heterozygous Runx2 mutant mouse possesses a similar phenotype to human CCD, including open fontanelles and hypoplastic clavicles but no dental anomalies (25). Moreover, radiation-induced Runx2 mutant mice also carry all the hallmarks of CCD (26).

Therefore, characterization of RUNX2 mutations in CCD patients is important for RUNX2 functional studies; over 90 mutations have been identified with CCD, including familial and sporadic cases (1,2,27). To investigate new pathogenic mutations associated with CCD, we compiled nine Chinese patients clinically diagnosed with CCD from three unrelated families and analysed the coding regions and the promoters of RUNX2 by direct sequencing and identified two nucleotide variations of RUNX2 in Case 1 from Mengyin, Shandong, including a reported nonsense mutation that converted arginine to a stop codon (c.577C>T, p.Arg193X) (1,5,2830) and a silent polymorphism causing no amino acid alteration (c.240G>A). Our data add to the repertoire of RUNX2 mutations in CCD patients of China.

Subjects and methods

Patient sample collection

Nine patients from three unrelated families of different ethnic backgrounds with the clinical diagnosis of CCD due to a number of radiological and clinical signs, including persistently open fontanelles, multiple wormian bones in lambdoid and sagittal sutures, clavicular hypoplasia, short stature, wide pubic symphysis, cone-shaped thorax, articulation of humerus forms a pseudarthrosis, hypoplasia of duplex ribs and supernumerary teeth [more detailed diagnostic criteria, see (31)] were enrolled in this study after they provided written informed consent. The study was approved by the Ethics Committee Board of Xiangya School of Medicine, Central South University, Hunan, China. Following the guidelines of the ethics committee, radiographs were only taken if necessary for diagnosis confirmation.

Mutation detection

Exons 1–8, 2 kb of P1 and P2 promoters of the human RUNX2 gene, were amplified by polymerase chain reaction (PCR) from genomic DNA (gDNA) in a thermal cycler (GeneAmp PCR System 9600; Perkin Elmer, Oak Brook, IL) with the specific primers [all showed in Table I; some are reported by Quack et al. (5), others are designed in our laboratory; all directly synthesized by Yingjun Co., Shanghai, China]. The PCR conditions were optimized and the amplification products were checked by agarose gel electrophoresis and purified with the PCR purification kit (Qiagen N.V., Hilden, Germany) according to the manufacturer's protocols. Sequencing process was performed by Yingjun Biotechnology Co. Ltd (Shanghai, China) and the sequencing results were analysed by means of DNAssist 2.0 software. Every mutation was confirmed by twice-repeated PCR of the gDNA products and twice-repeated sequencing. Base-pair numbers used refer to GenBank entries AF001443–AF001450.

Table I.

Primer pairs used to amplify eight exons and seven promoter fragments (P1 A and B; P2 A–E) of RUNX2 and respective annealing temperatures and products length

RUNX2 gene Positions Forward primer (5′→3′) Reverse primer (5′→3′) Tm (°C) Products (bp)
Exons 1 and 3–8 Exon 1 GTTTGGGTATGGTTTGTATT TTTTCTTCTGGTGAGGGTTA 54 477
Exon 3 AACACTAAGTCCTGATAAGAC GAAGGTGCTGATTTGTATACA 54 354
Exon 4 TCATTGCCTCCTTAGAGATGC GGACATGAAAGTGACACTAAC 50 310
Exon 5 TATAAAGCAATTTGAAATGGAAGG GTTTTGAAGTGAACACATCTCC 57 428
Exon 6 TAAGGCTGCAATGGTTGCTAT GTCACTGTGAGCATGGATGAG 57 306
Exon 7 CTCTGGGAAATACTAATGAGGGAT AGTGCCATGATGTGCATTTGTAAT 55 351
Exon 8 TGTGGCTTGCTGTTCCTTTATG GATACCACTGGGCCACTGCT 58 631
Exon 2 and promoters P1 A ACAAAGCAATGGAGAAGC GTTGGGAGCGATGGAGTA 55 1573
P1 B CTTACCTCCCTGCACAT TGATGCCATAGTCCCTC 60 1930
P2 A ACCCACTGTGCCAGATAC GCGAGAACCCATTTAGCC 55 1021
P2 B GTCTGTGGAGGGATTTGG GCATAGCTGGACATTTCTTT 60 1412
P2 C ATGGAAAACGGCTGGTGCT CAAGGTGCCAAGAGGTAAGT 63 671
P2 D CGACTTACCTCTTGGCACCTTG TGAGTTTGCAGCTTGGAATGG 45 417
P2 E versus Exon 2 CGGGGCTGGACTGCTGAACC TTGAAGGCCACGGGCAGGGT 60 817

Transient co-transfection and western blot analysis

To perform the functional analysis corresponding to point mutations of Runx2 found in CCD patients, we used pCMV-Tag4 (BD Clonetech, Palo Alto, CA) expression vector and mouse Runx2-II and Runx2-I full-length cDNAs to generate N-terminal flag-tagged Runx2-II and Runx2-I constructs. We also used a PCR site mutagenesis strategy to create the CCD mutant construct that is able to produce the truncated Runx2 protein. COS-7 cells were cultured in Dulbecco's modified Eagle's minimal essential medium containing 10% foetal bovine serum and 1% penicillin/streptomycin. The full-length Runx2-II and Runx2-I isoforms or mutant constructs along with 1.3-osteocalcin promoter–luciferase reporter construct were transiently co-transfected into COS-7 cells by electroporation using Cell Line Nucleofector Kit R according to the manufacturer's protocol (Amaxa Inc., Gaithersburg, MD). Promoter activity was assessed by measuring luciferase activity 48 h after transfection as previously described (32). The total cell lysates were prepared using a radioimmune precipitation assay buffer (Boston Bioproducts, Ashland, MA) with a cocktail proteinase inhibitor (Roche Applied Science, Indianapolis, IN). Protein concentrations were determined with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA). Equal quantities of protein were subjected to NuPAGE 4–12% Bis-Tris Gel (Invitrogen, Carlsbad, CA) and analysed with a standard western blot protocol (32,33). Primary Anti-M2 (Flag) antibody was purchased from Sigma-Aldrich (St Louis, MO). Signals were detected using a horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA) and an enhanced chemiluminescence detection kit (ECL Plus Western Blotting Detection Reagents; GE Healthcare, Piscataway, NJ).

Results

Mutation detection

Case 1 (34) had three affected members, a father and two daughters, from Mengyin, Shandong. The skull X-ray film of the father showed open fontanelles and multiple wormian bones in lambdoid and sagittal sutures while the X-ray film of his elder daughter demonstrated open fontanelles and multiple wormian bones in lambdoid and sagittal sutures, with one permanent tooth on the upper jaw and three on the lower jaw. Moreover, the affected younger daughter also displayed features of CCD in X-ray, such as open anterior fontanelles and posterior fontanel, wide cranial sutures near the sagittal suture, the abnormally shaped clavicles consisting of three dysplastic parts with lateral gap and hypoplasia of duplex ribs. The radiograph features of Case 1 are shown in Figure 1.

Fig. 1.

Fig. 1

Radiological features of Case 1 from Mengyin, Shandong, China. (a) The father, 32 years old. Frontal (left) and lateral (middle) view of the skull X-ray film shows open fontanelles and multiple wormian bones in lambdoid and sagittal sutures. Chest film (right) demonstrates cone-shaped thorax, left clavicular hypoplasia consisting of two parts and right clavicle absent at the distal one-third part and articulation of humerus forms a false joint. (b) The elder daughter, 8 years old. Frontal (left) and lateral (middle) view of the skull X-ray film shows open fontanelles and multiple wormian bones in lambdoid and sagittal sutures, with one permanent tooth on the upper jaw and three on the lower jaw. Chest film (right) displays cone-shaped thorax, the left clavicle consisting of two dysplastic parts and the right one absent at the distal two-third parts. (c) The younger daughter, 1 year old. The Plain X-ray film (left) of the skull shows open anterior fontanelles and posterior fontanel, wide cranial sutures near the sagittal suture and only four primary teeth. Chest film (right) exhibits cone-shaped thorax, the abnormally shaped clavicles consisting of three dysplastic parts with lateral gap and hypoplasia of duplex ribs.

Two nucleotide substitutions were identified in Case 1, including one reported nonsense mutation (c.577C>T, p.Arg193X) located at the C-terminal end of the Runt domain of RUNX2 and passed to the two daughters from the affected father (Figure 2). The other was a silent substitution (c.240G>A) that was detected in the father and passed to one of his daughters, whereas the other daughter did not carry the silent missense variant (Figure 3).

Fig. 2.

Fig. 2

Sequencing traces showing the nonsense mutation of RUNX2 in Case 1. Panel I shows a trace for the wife with a wild-type allele. Panel II shows a trace for the father with a point mutation (c.577C>T, p.Arg193X), which causes a stop codon in this RUNX2 mutant allele. Panel III shows daughter 1 being heterozygous for the mutation. Panel IV shows daughter 2 carrying the same RUNX2 alleles as daughter 1. The ellipse indicates the site of mutation.

Fig. 3.

Fig. 3

Sequencing traces showing the silent variation of RUNX2 in Case 1. Panel I shows a trace for the wife with a wild type-allele. Panel II shows a trace for the father with a heterozygous silent variation (240 G>A). Panel III shows daughter 1 being wild-type allele for the silent variation. Panel IV shows daughter 2 carrying the same RUNX2 alleles as the father. The ellipse means the silent variation.

Case 2 (35) had three affected members, a mother with a son and daughter, from Laiwu, Shandong. The mother showed large fontanelles, wide cranial sutures, congenital coxa vara, pubis hypoplasia, spinal bifida and bridge of the nose collapse. Moreover, the primary teeth overlapped with the secondary teeth instead of degenerate and the right clavicle was absent at the distal one-third parts and formed sloping shoulders. Her son was found with clavicular pseudarthrosis, sloping shoulders, unclosed anterior fontanel and broad cranial sutures, no secondary teeth, clavicular osseous heteroplasia, cone-shaped thorax and bilateral pubic bone absent. The affected daughter displayed open anterior fontanelles and posterior fontanel, wide cranial sutures, sloping shoulders, right coxa vara abnormity, wide pubic symphysis, cone-shaped thorax and three pieces of hypoplastic carpal bones. Mutational testing was completed and no variations were found.

Case 3 had three affected members, a grandmother with her younger brother and the grandson, from Xuzhou, Jiangsu. The grandmother was noted having a permanent open frontal fontanel since childhood. Her upper dentition was irregular and the secondary teeth did not erupt. She had multiple wormian bones in cranial sutures and showed congenital coxa vara. Her right clavicle was absent at the distal half and forms a pseudoarthrosis with increased mobility. Her younger brother was also found with open fontanelles and multiple wormian bones in lambdoid and showed sagittal sutures, cone-shaped thorax and clavicular hypoplasia leading a hypermobility of the shoulder girdle. The grandson had macrocephaly with open cranial sutures and was found to have irregular primary teeth, no secondary teeth, a cone-shaped thorax and bilateral pubic bone absent. Mutational testing was completed and no variations were found.

All the clinical features of the nine CCD patients were summarized in Table II. The usually reported supernumerary teeth were not found in the present study.

Table II.

Clinical manifestations of patients with CCD

Patient Sex Age Height (cm) Cranial Shoulders Clavicles Other
I 1 M 32 145.0 Large fontanels Sloping, bilateral Absence of lateral 1/3, bilateral Cone-shaped thorax
I 2 F 8 105.0 Severe large fontanels Sloping, bilateral Absence of lateral 2/3, bilateral Cone-shaped thorax
I 3 F 1 60.0 Severe large fontanels Severe sloping, bilateral Absence of lateral 2/3, bilateral Cone-shaped thorax
II 1 F 38 132.0 Large fontanelles Mild sloping, right Absence of lateral 1/3, right Normal
II 2 M 10 107.0 Large fontanelles, anterior Sloping, bilateral Absence of lateral 1/3, right Cone-shaped thorax
II 3 F 4 64.0 Large fontanelles, anterior Sloping, bilateral Absence of lateral 2/3, bilateral Cone-shaped thorax
III 1 F 62 128.0 Large fontanelles Increased mobility, bilateral Absence of lateral 1/2, right Normal
III 2 M 57 131.0 Large fontanelles Increased mobility, bilateral Absence of lateral 1/3, bilateral Cone-shaped thorax
III 3 M 7 102.0 Macrocephaly Increased mobility, bilateral Absence of lateral 1/3, left Cone-shaped thorax

M, male; F, female.

A functional analysis of RUNX2 point mutation in the CCD patients

As shown in Figure 4A, transient co-transfection of full-length Runx2 cDNA along with 1.3-kb osteocalcin promoter–luciferase reporter induced >3-fold stimulation on mouse osteocalcin promoter activity. The full-length Runx2-II and Runx2-I isoforms displayed a similar transactivation. In contrast, transient co-transfection of mutant Runx2 cDNA along with 1.3-kb osteocalcin promoter–luciferase reporter construct had no affect on mouse osteocalcin promoter activity. Western blot analysis revealed that full-length Runx2-II and Runx2-I isoforms generated 64-kDa functional Runx2 proteins, whereas mutant Runx2 isoform constructs produced 30-kDa non-functional truncated proteins due to a mutation at nucleotide c.577C>T (p.Arg193X) converting a coding triplet to a stop codon. The presence of a truncated protein resulting from the nonsense mutation suggests that there is no nonsense-mediated decay (Figure 4B). Taken together, the results confirmed that loss of function RUNX2 mutation in this CCD family is responsible for the CCD phenotype.

Fig. 4.

Fig. 4

Functional analysis of RUNX2 c.577C>T mutation in Case 1. (A) Relative osteocalcin promoter activity. Transient co-transfection N-terminal tagged full-length or mutant Runx2-II and Runx2-I isoform cDNA along with 1.3-osteocalcin promoter–luciferase reporter and Renilla luciferase-null (RL-null) as internal control plasmid into COS-7 cells was performed and relative luciferase activity was measured as described in the Subjects and Methods. (B) Western blot analysis of Runx2 protein expression. The total cell lysates and primary anti-M2 (Flag) antibody were used to perform western blot analysis as described in the Subjects and Methods.

Discussion

RUNX2 is the key transcription factor regulating osteoblast differentiation and bone formation. Heterozygous nonsense mutations or missense mutations have been demonstrated leading to the autosomal dominant skeletal disorder CCD (13). In this report, we have described nine Chinese patients from three different familial cases who were clinically diagnosed with CCD. A sequence analysis of RUNX2-coding domains and promoters was undertaken in these patients to determine whether any new mutations could be found. Our study identified two nucleotide changes of RUNX2 in Chinese CCD patients.

The nonsense mutation identified in Case 1 (c.577C>T, p.Arg193X) resides at the C-terminal of Runt domain of RUNX2 which is highly conserved and has the unique ability of mediating DNA binding and protein heterodimerization with CBF-β (5,17). The mutation resulted in a truncated protein, lacking 314 amino acids from the C-terminus. The in vitro functional study confirmed that R193X mutation completely abolished the transactivation function of both Runx2-I and Runx2-II isoforms as shown by its failure to stimulate the promoter of mouse osteocalcin gene containing two Runx2-binding sites, which could be responsible for this patient's CCD phenotype. However, this mutation results in a no-degraded truncated Runx2 protein as evidenced by the similar band density in western blot, indicating that there is no nonsense-mediated decay (Figure 4). R193X mutation has been found frequently in Caucasian CCD patients (36), whereas the mutations reported recently in Chinese patients were not detected in our cohort (30,37). Moreover, in this study, the patients did not have supernumerary teeth, one of the common clinical traits of CCD, but were featured as having an absence and/or late eruption of teeth, which might be a primary hypodontia from CCD or a secondary hypodontia from other causes (e.g. caries). However, genotype–phenotype correlations have not yet been established for the different RUNX2 mutations found in CCD and some alleles of RUNX2 were only found to be associated with bone mineral density and osteoporosis (38).

Although the CCD phenotype has been shown to have genetic linkage to the RUNX2 locus, no mutations were detected in up to one-third of patients referred for DNA analysis as listed in Table III. Some of these studies, in which genes other than RUNX2 were also sequenced, such as aristaless-like homeobox 4 (ALX4), msh homeobox 2 (MSX2), RUNX2 DNA-binding partner CBF-β failed to provide any molecular mechanism of CCD. We did not find any mutation in Case 2 and 3 patients with typical features of CCD after screening the coding domains and promoters of RUNX2 gene. However, it cannot be ruled out that there may be variations located in the regions that have not been sequenced in this study.

Table III.

Summary of identified RUNX2 mutations in reported CCD cases

Race Subjects no. (total) Subjects no. (no detection) The region sequenced in RUNX2 gene Other genes sequenced Reference
Caucasian 3 0 Coding exons hMSX2, hALX4 exons (no detection) Cunningham et al. (3)
Asian 11 4 Coding exons and promoter (up to 755 bp from ATG) CBF-β exons (no detection) Kim et al. (27)
Caucasian 26 8 Coding exons Baumert (47)
Italian 3 0 Coding exons Puppin (48)
Different ethnic background 38 21 Coding exons and 1.3-kb fragment of the bone-specific promoter Napierala (49)
Italian 14 3 Coding exons Tessa (50)
Japanese 24 7 Coding exons Yoshida et al. (29)
Germany 4 0 Coding exons Bergwitz (51)
Japanese 8 1 Coding exons Zhang et al. (28)
Different ethnic background 42 24 Coding exons Quack et al. (5)
Caucasian 26 9 Coding exons Zhou (52)

Developmental defects in calvaria and clavicles can be exhibited in mouse models in which Runx2 expression was reduced to a threshold extent (39). Furthermore, Cbfb-deficient mice displayed impaired bone development manifest as wide sutures and decreased bone ossification and hypoplastic clavicles similar to the pattern in Runx2-deficient mice (18). These defects were also evident in a patient with interstitial deletion at 16q21q22, where the CBF-β gene is located (40). Taken together, potential reasons why no mutations were found in the coding region of this CCD patient might be a partial or total gene deletion, a deep intronic mutation (resulting in a splicing defect), long-range regulatory rearrangement (e.g. regulatory deletion, point mutation in distant regulatory element) or 3′untranslated region change disrupting an microRNA-binding site, etc., in the RUNX2 locus. Moreover, chromosome or intragenic microdeletion of RUNX2 was demonstrated to be another mechanism for CCD (41,42) which indicates that the methodology is a limitation of this study. Thus, further analysis of negative cases of these RUNX2 mutations might represent an important new phenocopy of CCD that was previously described in the literature (4346).

Conclusions

Our data demonstrate for the first time a nonsense mutation (c.577C>T, p.Arg193X) in Chinese CCD patients and add to the repertoire of RUNX2 mutations in China.

Funding

Teaching and Research Award Program for Out-standing Young Teachers in Higher Education Institutions of Ministry of Education, People's Republic of China (30040002); National Natural Science Foundation of China (30171085 and 30500623); Fudan University of China (CHF301023); National Institutes of Health (RO1-AR049712).

Acknowledgments

Conflict of interest statement: None declared.

References

  • 1.Otto F, Kane1gane H, Mundlos S. Mutations in the RUNX2 gene in patients with cleidocranial dysplasia. Hum. Mutat. 2002;19:209–216. doi: 10.1002/humu.10043. [DOI] [PubMed] [Google Scholar]
  • 2.Fernandez BA, Siegel-Bartelt J, Herbrick JA, Teshima I, Scherer SW. Holoprosencephaly and cleidocranial dysplasia in a patient due to two position-effect mutations: case report and review of the literature. Clin. Genet. 2005;68:349–359. doi: 10.1111/j.1399-0004.2005.00498.x. [DOI] [PubMed] [Google Scholar]
  • 3.Cunningham ML, Seto ML, Hing AV, Bull MJ, Hopkin RJ, Leppig KA. Cleidocranial dysplasia with severe parietal bone dysplasia: C-terminal RUNX2 mutations. Birth Defects Res. A. Clin. Mol. Teratol. 2006;76:78–85. doi: 10.1002/bdra.20231. [DOI] [PubMed] [Google Scholar]
  • 4.Lee B, Thirunavukkarasu K, Zhou L, Pastore L, Baldini A, Hecht J, Geoffroy V, Ducy P, Karsenty G. Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. Nat. Genet. 1997;16:307–310. doi: 10.1038/ng0797-307. [DOI] [PubMed] [Google Scholar]
  • 5.Quack I, Vonderstrass B, Stock M, et al. Mutation analysis of core binding factor A1 in patients with cleidocranial dysplasia. Am. J. Hum. Genet. 1999;65:1268–1278. doi: 10.1086/302622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li YL, Xiao ZS. Advances in Runx2 regulation and its isoforms. Med. Hypotheses. 2007;68:169–175. doi: 10.1016/j.mehy.2006.06.006. [DOI] [PubMed] [Google Scholar]
  • 7.Schroeder TM, Jensen ED, Westendorf JJ. Runx2: a master organizer of gene transcription in developing and maturing osteoblasts. Birth Defects Res. C. Embryo Today. 2005;75:213–225. doi: 10.1002/bdrc.20043. [DOI] [PubMed] [Google Scholar]
  • 8.Franceschi RT, Xiao G, Jiang D, Gopalakrishnan R, Yang S, Reith E. Multiple signaling pathways converge on the Cbfa1/Runx2 transcription factor to regulate osteoblast differentiation. Connect. Tissue Res. 2003;44(Suppl. 1):109–116. [PMC free article] [PubMed] [Google Scholar]
  • 9.Javed A, Barnes GL, Jasanya BO, Stein JL, Gerstenfeld L, Lian JB, Stein GS. Runt homology domain transcription factors (Runx, Cbfa, and AML) mediate repression of the bone sialoprotein promoter: evidence for promoter context-dependent activity of Cbfa proteins. Mol. Cell. Biol. 2001;21:2891–2905. doi: 10.1128/MCB.21.8.2891-2905.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.de Gortazar AR, Alonso V, Alvarez-Arroyo MV, Esbrit P. Transient exposure to PTHrP (107-139) exerts anabolic effects through vascular endothelial growth factor receptor 2 in human osteoblastic cells in vitro. Calcif. Tissue Int. 2006;79:360–369. doi: 10.1007/s00223-006-0099-y. [DOI] [PubMed] [Google Scholar]
  • 11.Xiao ZS, Hjelmeland AB, Quarles LD. Selective deficiency of the “bone-related” Runx2-II unexpectedly preserves osteoblast-mediated skeletogenesis. J. Biol. Chem. 2004;279:20307–20313. doi: 10.1074/jbc.M401109200. [DOI] [PubMed] [Google Scholar]
  • 12.Xiao Z, Awad HA, Liu S, Mahlios J, Zhang S, Guilak F, Mayo MS, Quarles LD. Selective Runx2-II deficiency leads to low-turnover osteopenia in adult mice. Dev. Biol. 2005;283:345–356. doi: 10.1016/j.ydbio.2005.04.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zaidi SK, Javed A, Choi JY, van Wijnen AJ, Stein JL, Lian JB, Stein GS. A specific targeting signal directs Runx2/Cbfa1 to subnuclear domains and contributes to transactivation of the osteocalcin gene. J. Cell. Sci. 2001;114:3093–3102. doi: 10.1242/jcs.114.17.3093. [DOI] [PubMed] [Google Scholar]
  • 14.Wai PY, Mi Z, Gao C, Guo H, Marroquin C, Kuo PC. Ets-1 and runx2 regulate transcription of a metastatic gene, osteopontin, in murine colorectal cancer cells. J. Biol. Chem. 2006;281:18973–18982. doi: 10.1074/jbc.M511962200. [DOI] [PubMed] [Google Scholar]
  • 15.Zheng Q, Zhou G, Morello R, Chen Y, Garcia-Rojas X, Lee B. Type X collagen gene regulation by Runx2 contributes directly to its hypertrophic chondrocyte-specific expression in vivo. J. Cell. Biol. 2003;162:833–842. doi: 10.1083/jcb.200211089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Varghese S, Rydziel S, Canalis E. Bone morphogenetic protein-2 suppresses collagenase-3 promoter activity in osteoblasts through a runt domain factor 2 binding site. J. Cell. Physiol. 2005;202:391–399. doi: 10.1002/jcp.20130. [DOI] [PubMed] [Google Scholar]
  • 17.Thirunavukkarasu K, Mahajan M, McLarren KW, Stifani S, Karsenty G. Two domains unique to osteoblast-specific transcription factor Osf2/Cbfa1 contribute to its transactivation function and its inability to heterodimerize with Cbfbeta. Mol. Cell. Biol. 1998;18:4197–4208. doi: 10.1128/mcb.18.7.4197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kundu M, Javed A, Jeon JP, et al. Cbfbeta interacts with Runx2 and has a critical role in bone development. Nat. Genet. 2002;32:639–644. doi: 10.1038/ng1050. [DOI] [PubMed] [Google Scholar]
  • 19.Tang YY, Shi J, Zhang L, Davis A, Bravo J, Warren AJ, Speck NA, Bushweller JH. Energetic and functional contribution of residues in the core binding factor beta (CBFbeta) subunit to heterodimerization with CBFalpha. J. Biol. Chem. 2000;275:39579–39588. doi: 10.1074/jbc.M007350200. [DOI] [PubMed] [Google Scholar]
  • 20.Xiao ZS, Liu SG, Hinson TK, Quarles LD. Characterization of the upstream mouse Cbfa1/Runx2 promoter. J. Cell. Biochem. 2001;82:647–659. doi: 10.1002/jcb.1192. [DOI] [PubMed] [Google Scholar]
  • 21.Xiao ZS, Thomas R, Hinson TK, Quarles LD. Genomic structure and isoform expression of the mouse, rat and human Cbfa1/Osf2 transcription factor. Gene. 1998;214:187–197. doi: 10.1016/s0378-1119(98)00227-3. [DOI] [PubMed] [Google Scholar]
  • 22.Geoffroy V, Corral DA, Zhou L, Lee B, Karsenty G. Genomic organization, expression of the human CBFA1 gene, and evidence for an alternative splicing event affecting protein function. Mamm. Genome. 1998;9:54–57. doi: 10.1007/s003359900679. [DOI] [PubMed] [Google Scholar]
  • 23.Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 1997;89:755–764. doi: 10.1016/s0092-8674(00)80258-5. [DOI] [PubMed] [Google Scholar]
  • 24.Hecht J, Seitz V, Urban M, et al. Detection of novel skeletogenesis target genes by comprehensive analysis of a Runx2(-/-) mouse model. Gene. Expr. Patterns. 2007;7:102–112. doi: 10.1016/j.modgep.2006.05.014. [DOI] [PubMed] [Google Scholar]
  • 25.Yoda S, Suda N, Kitahara Y, Komori T, Ohyama K. Delayed tooth eruption and suppressed osteoclast number in the eruption pathway of heterozygous Runx2/Cbfa1 knockout mice. Arch. Oral. Biol. 2004;49:435–442. doi: 10.1016/j.archoralbio.2004.01.010. [DOI] [PubMed] [Google Scholar]
  • 26.Selby PB, Selby PR. Gamma-ray-induced dominant mutations that cause skeletal abnormalities in mice. II. Description of proved mutations. Mutat. Res. 1978;51:199–236. doi: 10.1016/s0027-5107(78)80019-0. [DOI] [PubMed] [Google Scholar]
  • 27.Kim HJ, Nam SH, Kim HJ, et al. Four novel RUNX2 mutations including a splice donor site result in the cleidocranial dysplasia phenotype. J. Cell. Physiol. 2006;207:114–122. doi: 10.1002/jcp.20552. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang YW, Yasui N, Ito K, et al. A RUNX2/PEBP2alpha A/CBFA1 mutation displaying impaired transactivation and Smad interaction in cleidocranial dysplasia. Proc. Natl Acad. Sci. USA. 2000;97:10549–10554. doi: 10.1073/pnas.180309597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yoshida T, Kanegane H, Osato M, Yanagida M, Miyawaki T, Ito Y, Shigesada K. Functional analysis of RUNX2 mutations in cleidocranial dysplasia: novel insights into genotype-phenotype correlations. Blood Cells Mol. Dis. 2003;30:184–193. doi: 10.1016/s1079-9796(03)00020-2. [DOI] [PubMed] [Google Scholar]
  • 30.Xuan D, Li S, Zhang X, Hu F, Lin L, Wang C, Zhang J. Mutations in the RUNX2 gene in Chinese patients with cleidocranial dysplasia. Ann. Clin. Lab. Sci. 2008;38:15–24. [PubMed] [Google Scholar]
  • 31.Mundlos S. Cleidocranial dysplasia: clinical and molecular genetics. J. Med. Genet. 1999;36:177–182. [PMC free article] [PubMed] [Google Scholar]
  • 32.Xiao Z, Zhang S, Mahlios J, et al. Cilia-like structures and polycystin-1 in osteoblasts/osteocytes and associated abnormalities in skeletogenesis and Runx2 expression. J. Biol. Chem. 2006;281:30884–30895. doi: 10.1074/jbc.M604772200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xiao ZS, Simpson LG, Quarles LD. IRES-dependent translational control of Cbfa1/Runx2 expression. J. Cell. Biochem. 2003;88:493–505. doi: 10.1002/jcb.10375. [DOI] [PubMed] [Google Scholar]
  • 34.Xu W, Qin F, Dong H. Craniocleidol dysplasia of 2 cases in a family. J. Med. Imaging. 1998;8:253–254. [Google Scholar]
  • 35.Chen X, Hua B, Li L, Liu J, Tao Z. Craniocleidol dysplasia: a report of 8 cases in a family. J Taishan Med. Coll. 2002;23:254–256. [Google Scholar]
  • 36.Kisiel BM, Kostrzewa G, Wlasienko P, Kruczek A, Gajdulewicz M, Maciejak D, Wisniewska M, Ploski R, Korniszewski L. Cleidocranial dysplasia in a Polish population: high frequency of the R193X mutation. Clin. Genet. 2006;70:167–169. doi: 10.1111/j.1399-0004.2006.00648.x. [DOI] [PubMed] [Google Scholar]
  • 37.Tang S, Xu Q, Xu X, Du J, Yang X, Jiang Y, Wang X, Speck N, Huang T. A novel RUNX2 missense mutation predicted to disrupt DNA binding causes cleidocranial dysplasia in a large Chinese family with hyperplastic nails. BMC Med. Genet. 2007;8:82. doi: 10.1186/1471-2350-8-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Vaughan T, Pasco JA, Kotowicz MA, Nicholson GC, Morrison NA. Alleles of RUNX2/CBFA1 gene are associated with differences in bone mineral density and risk of fracture. J. Bone. Miner. Res. 2002;17:1527–1534. doi: 10.1359/jbmr.2002.17.8.1527. [DOI] [PubMed] [Google Scholar]
  • 39.Lou Y, Javed A, Hussain S, et al. A Runx2 threshold for the cleidocranial dysplasia phenotype. Hum. Mol. Genet. 2009;18:556–568. doi: 10.1093/hmg/ddn383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Otto F, Lubbert M, Stock M. Upstream and downstream targets of RUNX proteins. J. Cell. Biochem. 2003;89:9–18. doi: 10.1002/jcb.10491. [DOI] [PubMed] [Google Scholar]
  • 41.Izumi K, Yahagi N, Fujii Y, et al. Cleidocranial dysplasia plus vascular anomalies with 6p21.2 microdeletion spanning RUNX2 and VEGF. Am. J. Med. Genet. A. 2006;140:398–401. doi: 10.1002/ajmg.a.31061. [DOI] [PubMed] [Google Scholar]
  • 42.Lee MT, Tsai AC, Chou CH, et al. Intragenic microdeletion of RUNX2 is a novel mechanism for cleidocranial dysplasia. Genomic Med. 2008;2:45–49. doi: 10.1007/s11568-008-9024-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wilkie AO, Tang Z, Elanko N, et al. Functional haploinsufficiency of the human homeobox gene MSX2 causes defects in skull ossification. Nat. Genet. 2000;24:387–390. doi: 10.1038/74224. [DOI] [PubMed] [Google Scholar]
  • 44.Mavrogiannis LA, Antonopoulou I, Baxova A, et al. Haploinsufficiency of the human homeobox gene ALX4 causes skull ossification defects. Nat. Genet. 2001;27:17–18. doi: 10.1038/83703. [DOI] [PubMed] [Google Scholar]
  • 45.Antonopoulou I, Mavrogiannis LA, Wilkie AO, Morriss-Kay GM. Alx4 and Msx2 play phenotypically similar and additive roles in skull vault differentiation. J. Anat. 2004;204:487–499. doi: 10.1111/j.0021-8782.2004.00304.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Rice R, Rice DP, Olsen BR, Thesleff I. Progression of calvarial bone development requires Foxc1 regulation of Msx2 and Alx4. Dev. Biol. 2003;262:75–87. doi: 10.1016/s0012-1606(03)00355-5. [DOI] [PubMed] [Google Scholar]
  • 47.Baumert U, Golan I, Redlich M, Aknin JJ, Muessig D. Cleidocranial dysplasia: molecular genetic analysis and phenotypic-based description of a Middle European patient group. Am. J. Med. Genet. A. 2005;139:78–85. doi: 10.1002/ajmg.a.30927. [DOI] [PubMed] [Google Scholar]
  • 48.Puppin C, Pellizzari L, Fabbro D, et al. Functional analysis of a novel RUNX2 missense mutation found in a family with cleidocranial dysplasia. J. Hum. Genet. 2005;50:679–683. doi: 10.1007/s10038-005-0311-3. [DOI] [PubMed] [Google Scholar]
  • 49.Napierala D, Garcia-Rojas X, Sam K, et al. Mutations and promoter SNPs in RUNX2, a transcriptional regulator of bone formation. Mol. Genet. Metab. 2005;86:257–268. doi: 10.1016/j.ymgme.2005.07.012. [DOI] [PubMed] [Google Scholar]
  • 50.Tessa A, Salvi S, Casali C, et al. Six novel mutations of the RUNX2 gene in Italian patients with cleidocranial dysplasia. Hum. Mutat. 2003;22:104. doi: 10.1002/humu.9155. [DOI] [PubMed] [Google Scholar]
  • 51.Bergwitz C, Prochnau A, Mayr B, et al. Identification of novel CBFA1/RUNX2 mutations causing cleidocranial dysplasia. J. Inherit. Metab. Dis. 2001;24:648–656. doi: 10.1023/a:1012758925617. [DOI] [PubMed] [Google Scholar]
  • 52.Zhou G, Chen Y, Zhou L, et al. CBFA1 mutation analysis and functional correlation with phenotypic variability in cleidocranial dysplasia. Hum. Mol. Genet. 1999;8:2311–2316. doi: 10.1093/hmg/8.12.2311. [DOI] [PubMed] [Google Scholar]

Articles from Mutagenesis are provided here courtesy of Oxford University Press

RESOURCES