Abstract
Protective immunity against avian influenza virus was elicited in chickens by single-dose in ovo vaccination with a non-replicating human adenovirus vector encoding an H5N9 avian influenza virus hemagglutinin. Vaccinated chickens were protected against both H5N1 (89% hemagglutinin homology; 68% protection) and H5N2 (94% hemagglutinin homology; 100% protection) highly pathogenic avian influenza virus challenges. Mass-administration of this bird flu vaccine can be streamlined with available robotic in ovo injectors. In addition, adenovirus-vectored vaccines can be produced rapidly and the safety margin of a non-replicating vector is superior to that of a replicating counterpart. Furthermore, this mode of vaccination is compatible with epidemiological surveys of natural avian influenza virus infections.
Keywords: Avian influenza, In ovo vaccination, Adenovirus vector, Replication-competent adenovirus
1. Introduction
As the H5N1 highly pathogenic avian influenza (HPAI) virus has devastated the poultry industry in multiple countries during recent years with the capacity of inducing high lethality rate after transmission to humans [1], a pandemic of the same severity as that of the 1918, 1957, or 1968 [2] is conceivable. Strategies to control avian influenza (AI) vary from co-existing with low pathogenic AI virus strains to the other extreme of implementing a slaughter approach in the case of HPAI strains. The radical slaughter approach is feasible when outbreaks of disease occur in restricted areas with adequate veterinary infrastructure, but the costs can be insurmountable if outbreaks are widespread. A more cost-effective approach is mass vaccination to both increase resistance of the chicken population and reduce AI virus shedding. To vaccinate birds in great numbers within a short timeframe in response to an outbreak of AI, vaccines have to be produced rapidly and inexpensively, and elicit protective immunity in a single-dose regimen without involving labor-intensive procedures. Immune responses induced by vaccination should allow easy differentiation between infected and vaccinated animals (DIVA).
Poultry have been vaccinated against AI with two types of commercially available vaccines including inactivated whole AI virus [3,4] and fowlpox-vectored vaccines [5]. Whole AI virus vaccines have disadvantages including the requirement of live virus replication in embryonated eggs, incompatibility with DIVA when the vaccine strain is identical to the circulating virus, and withdrawal time of as long as 42 days. The distinct advantage of vectored vaccines is the ability to introduce highly specific immune interventions based on well-defined antigens that can be the focus of specific immune reactivity, without the risk of generating virulent revertants. Evidence shows that vaccination of chickens by delivery of a fowlpox vector encoding an avian hemagglutinin (HA) of a specific AI virus is sufficient to protect immunized birds against lethal AI virus challenges. The homology between the HA of the vaccine and that of the challenge virus is inversely correlated with virus shedding in poultry [5]; however, a broad cross-protection within a subtype between even antigenically diverse AI viruses can be achieved among chickens [6]. Although multiple vectors are available as vaccine carriers, bioengineered avian virus-derived vectors (e.g., fowlpox virus) have shown reduced protection associated with pre-existing immunity to the vector due to pre-exposure of birds to the avian virus [7].
Humans have been safely and effectively immunized by administration of human adenovirus serotype 5 (Ad5)-vectored influenza vaccines [8]. It was recently reported that mice [9,10] and chickens [9] could be protected against H5N1 virus challenges following inoculation of this human Ad5 vector encoding an avian H5 HA. All of the aforementioned Ad5 vectors were produced in human 293-derived cells that intrinsically contaminate Ad5 stocks by generating replication-competent adenovirus (RCA) through homologous recombination between the Ad5 vector and the E1 region in the 293 genome [11]. RCA may induce disease in infected humans, and/or out-replicate the recombinant vectors during large-scale production. In the present studies, we demonstrate that chickens can be protected against HPAI by in ovo administration of an RCA-free human Ad5 vector encoding avian H5 HA. This vectored AI vaccine possesses no safety risk due to its replication incompetence, and the in ovo mode allows automated mass delivery.
2. Materials and methods
2.1. Construction of the AdTW68.H5 vector
The A/turkey/Wisconsin/68 HA gene was amplified by polymerase chain reaction (PCR) from a plasmid template [12] using the primer pair 5′CACACAAAGCTTGCCGCCATGGAAAGAATAGTGATTGC3′ and 5′CACACAGGATCCATCTGAACTCACAATCCTAGATGC3′. These primers contain sequences that anneal to the 5′ and 3′ ends of the HA gene, a eukaryotic ribosomal binding site immediately upstream from the initiation ATG codon, and unique restriction sites for subsequent cloning. The fragment containing the full-length HA gene was inserted into the HindIII-BamHI site of the shuttle plasmid pAdApt (provided by Crucell Holland BV; Leiden, The Netherlands) to generate the plasmid pAdApt-TW68.H5 with the HA gene under transcriptional control of the human cytomegalovirus (CMV) early promoter. An RCA-free, E1/E3-defective Ad5 vector encoding this H5 HA gene (AdTW68.H5) was subsequently constructed in human PER.C6 cells (provided by Crucell) by co-transfection of pAdApt-TW68.H5 with the Ad5 backbone plasmid pAdEasy1 [13] as described [14]. The AdTW68.H5 vector was validated by DNA sequencing. Titer (infectious units [ifu] per ml]) was determined by the Adeno-X rapid titer kit (BD Clontech; Mountain View, CA).
2.2. Experimental design
AdTW68.H5-vectored AI vaccine was administered to specific-pathogen-free (SPF) white leghorn chicken embryonated eggs to evaluate antibody responses and protection against challenge as described in the following trials. In ovo inoculation was performed as described [15]. Briefly, embryonated eggs were candled for viability followed by disinfection of the egg shell. A small hole was made through the large end (air cell end) with a drill. Vaccines were injected approximately 1 inch deep into the amnion-allantoic cavity with a 21-gauge needle, followed by sealing the hole and continued incubation of the eggs. Machines widely used for in ovo immunization deliver vaccines into the same cavity on day 18 of embryonation (E18) [16]. Post-hatch vaccination was performed intranasally. Hemagglutination-inhibition (HI) antibody titers in serum samples were determined as described [17] against 4 hemagglutinating units of the low pathogenic A/turkey/Wisconsin/68 (H5N9) strain. Titers of <1.0 log2 were arbitrarily assigned a titer of 1.0 log2. Birds were reared and handled according to Institutional Animal Care and Use Committee’s guidelines at Auburn University as well as USDA Southeast Poultry Research Laboratory.
2.3. Trial 1
AdTW68.H5-vectored AI vaccine was delivered in ovo to chicken embryos at a dose of 1.5×108 ifu in a volume of 0.3 ml on E10 or E18. The Ad5 vector was purified by ultracentrifugation over cesium chloride gradient and resuspended in Ad buffer as described [14]. Approximately 50% of the hatched chickens were boosted by intranasal instillation with the same dose of AdTW68.H5 on day 15 post-hatch (D15); the remaining chickens did not receive a booster application. Serum samples were obtained on D28 for determination of individual HI antibody titers against the A/turkey/Wisconsin/68 virus from all chicken groups.
2.4. Trial 2
We subsequently expanded the experiment to demonstrate reproducibility as well as to evaluate protection against lethal challenge with HPAI virus strains. Nineteen chickens were immunized in ovo on E18 as described in Trial 1. Twelve of 19 chickens were intranasally boosted on D15 and the remaining 7 were not revaccinated. Serum samples from each bird on D23 and D29 were tested for HI antibody titers against the A/turkey/Wisconsin/68 virus. Challenge was performed in a biosafety level 3+ facility by oropharyngeal instillation of 1×105 embryo infectivity doses (EID50) of the HPAI virus A/chicken/Queretaro/14588-19/95 (H5N2) [18]. The HA (GenBank accession U79448) of this challenge strain has 94% deduced amino acid sequence similarity with the HA (GenBank accession U79456) of the A/turkey/Wisconsin/68 strain (vaccine strain) expressed from the Ad5 vector. A total of 30 chickens, including 7 birds vaccinated in ovo and 12 vaccinated in ovo in conjunction with nasal boost, as well as 11 unvaccinated controls, were challenged on D34. Challenged birds were observed daily for morbidity and mortality throughout an experimental period of 14 days. Oropharyngeal swabs from individual birds were obtained for quantitation of AI genomes by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) on days 2, 4, and 7 after challenge. Samples were suspended in 1 ml of brain heart infusion medium (Becton Dickinson and Company; Sparks, MD), and stored at −70°C. RNA was extracted by using the RNeasy mini kit (Qiagen Inc.; Valencia, CA). Real-time RT-PCR was performed with primers specific for type A influenza virus matrix RNA as described [19]. Copy number of viral RNA was interpolated from the cycle thresholds by using standard curves generated from known amounts of control A/chicken/Queretaro/14588-19/95 RNA (101.0 to 106.0 EID50/ml).
2.5. Trial 3
To determine whether the AdTW68.H5-vectored AI vaccine can confer protection against a recent H5N1 HPAI virus strain, 31 chickens were vaccinated in ovo with the AdTW68.H5 vector at a dose of 3×108 ifu on E18. Unlike the vectors produced in Trials 1 and 2, the AdTW68.H5 vector used in Trial 3 was purified by Vivapure AdenoPACK ion-exchange membranes (Sartorius Corp., Edgewood, NY) and subsequently resuspended in A195 buffer [20].
Control groups included 10 chickens vaccinated with an Ad5 vector (AdCMV-tetC) encoding an irrelevant antigen (tetanus toxin C-fragment) [14] and 10 chickens which were not exposed to Ad5 vectors. HI antibody titers were analyzed on D25. Control and immunized birds were challenged through the choanal slit with 105 EID50 of the HPAI virus A/swan/Mongolia/244L/2005 (H5N1) on D31 (the HA of this challenge strain has 89% deduced HA amino acid sequence similarity with the HA of the A/turkey/Wisconsin/68 strain).
3. Results
3.1. Trial 1
As shown in Fig. 1, chickens vaccinated in ovo on E10 showed HI antibody titers of 2.7 log2 (geometric mean titer [GMT]) against the A/turkey/Wisconsin/68 virus on D28; those vaccinated on E10 with nasal boost showed HI titers of 5.2 log2 [GMT]; those vaccinated on E18 showed HI titers of 5.0 log2 [GMT]; and those vaccinated on E18 with nasal boost had HI titers of 5.2 log2 [GMT]. Overall, in ovo administration of this human Ad5-vectored AI vaccine induced a robust antibody response against the H5 HA of AI virus in chickens, whereas intranasal instillation of Ad5-vectored vaccines, as recently reported [21], seemed to be ineffective in chickens.
Fig. 1.
Serum HI antibodies induced by in ovo immunization with the RCA-free AdTW68.H5 vector encoding the A/turkey/Wisconsin/68 (H5N9) HA. In ovo vaccination was performed on E10 and E18, respectively. Approximately 50% of the in ovo vaccinated birds were intranasally boosted on D15 whereas the remaining chickens were not revaccinated. E10, chickens immunized on day 10 of embryonation; E10+, chickens immunized on E10 with nasal boost on D15; E18, chickens immunized on day 18 of embryonation; E18+, chickens immunized on E18 with nasal boost on D15. HI titers against the A/turkey/Wisconsin/68 virus were determined on D28 and are expressed as log2 [HI titer] in individual birds (circles and triangles); bars represent the log2 [GMT] for each group. No HI titers (≤1 log2) were detected in 32 naïve control chickens.
3.2. Trial 2
Overall, the HI antibody titers against the A/turkey/Wisconsin/68 virus in immunized chickens (Fig. 2A) were similar to the values obtained in trial 1 (Fig. 1). Titers in chickens immunized in ovo on E18 increased from 6.0 log2 [GMT] on D23 to 7.0 log2 [GMT] on D29. In ovo vaccination in conjunction with nasal boost induced HI antibody titers at the level of 5.3 log2 [GMT] on D23, with subsequent increase to 6.1 log2 [GMT] on D29.
Fig. 2.
Protection of chickens by in ovo immunization with the AdTW68.H5-vectored AI vaccine against A/chicken/Queretaro/14588-19/95 (H5N2) HPAI virus challenge. In ovo vaccination was performed on E18. (A) Twelve of 19 of the in ovo vaccinated birds were intranasally boosted on D15 whereas the other 7 were not revaccinated. D23 and D29 refer to days of serum collection from in ovo immunized chickens; +D23 and +D29 refer to days of serum collection from in ovo immunized chickens that were revaccinated intranasally on D15. HI titers against the A/turkey/Wisconsin/68 virus are expressed as log2 [HI titer] in individual birds (triangles and circles); bars represent the log2 [GMT] for each group. No HI titers (≤1 log2) were detected in 11 naïve control chickens. (B) On D34, chickens were challenged through the choanal slit with 105 EID50 of the HPAI virus A/chicken/Queretaro/14588-19/95. Survival rates were statistically analyzed using the Logrank test (Prism 4.03, GraphPad Software). In ovo vaccination with AdTW68.H5 with or without nasal boost significantly protected chickens (100%) against lethal challenge when compared to unvaccinated controls (P<0.001). All data are plotted as percent survival versus number of days after challenge. Numbers in parentheses represent the number of birds in each group. (C) A/chicken/Queretaro/14588-19/95 viral genomes in individual chickens expressed as log10 copies per ml (triangles and circles) determined by real-time RT-PCR in oropharyngeal samples collected 2, 4, and 7 days post-challenge. Control, chickens without immunization; in-ovo, chickens immunized in ovo; in-ovo+, chickens immunized in ovo followed by a nasal booster. A significant reduction in viral load was observed in immunized birds 7 days post-challenge.
Clinical signs of AI, including swelling of comb and wattles, conjunctivitis, anorexia and hypothermia, were observed two days after challenge with A/chicken/Queretaro/14588-19/95 virus in 10 of 11 control birds. After two more days, most survivors in the control group exhibited comb necrosis, swelling of wattles, diarrhea, dehydration, lethargy, and subcutaneous hemorrhages of the leg shank. No signs of AI were observed in any of the vaccinated chickens. All chickens (19/19) vaccinated in ovo with or without booster application survived the challenge with the HPAI virus A/chicken/Queretaro/14588-19/95 strain (Fig. 2B).
Copy number of the A/chicken/Queretaro/14588-19/95 matrix RNA in challenged birds was quantitatively determined by real-time RT-PCR in oropharyngeal swabs collected 2, 4, and 7 days post-challenge. There was a significant reduction of viral RNA in all immunized birds 7 days after challenge (Fig. 2C). Absence of detectable viral RNA in vaccinated chickens provides evidence that in ovo vaccination elicited an immune response capable of controlling AI virus shedding within a week, and probably sooner since some of the signals may have been amplified from viral remanence by RT-PCR.
3.3. Trial 3
All of the unvaccinated (10/10) and AdCMV-tetC-immunized (10/10) birds died from AI within 9 days after challenge with A/swan/Mongolia/244L/2005 virus and none of them produced measurable HI antibodies, whereas 68% (21/31) of the AdTW68.H5-vaccinated birds survived without clinical signs 10 days post-challenge (Fig. 3A). In ovo immunization induced antibodies within a range of 1 and 6 log2 on D25 (Fig. 3B). Notably, 7 birds in the immunized group with HI titers of ≥3 log2 were still killed by this highly lethal H5N1 AI virus. It is conceivable that the survival rate against bird flu may be improved by in ovo vaccination with an Ad5 vector encoding an HA with antigenicity more matched to that of the challenge virus.
Fig. 3.
Protection of chickens by in ovo immunization with the AdTW68.H5-vectored AI vaccine against A/swan/Mongolia/244L/2005 (H5N1) HPAI virus challenge. In ovo vaccination was performed on E18. (A) Control and immunized birds were challenged through the choanal slit with 105 EID50 of the HPAI virus A/swan/Mongolia/244L/2005 (H5N1) on D31. The data are plotted as described in the Fig. 2 legend. (B) Pre-challenge serum HI antibodies on D25 were analyzed. Minus sign (−) indicates birds that succumbed to challenge; plus sign (+) indicates birds that survived challenge. Other symbols and abbreviations are described in the Fig. 1 legend. Survivors had significantly elevated pre-challenge serum HI activity (P<0.001) as compared to those that died (unpaired t-test; Prism 4.03), although a small number of birds with HI titers of 3–5 log2 were still killed by the H5N1 virus. All naïve control birds (n=10) and birds immunized by the control vector AdCMV-tetC (n=10) produced no measurable HI antibody titers (≤1 log2).
4. Discussion
In ovo vaccination in chickens on E18 has been routinely practiced for many years in the poultry industry. Currently over 80% of U.S. commercial broilers are vaccinated in ovo with a mechanized injector against Marek’s disease [15,16]. This automated vaccination method minimizes labor, time, and costs by allowing administration of a uniform vaccine dose into hundreds of eggs per minute.
The results presented herein demonstrated that in ovo immunization with an RCA-free human Ad5 vector encoding avian H5 HA elicits protective immunity against HPAI viruses in chickens. Ad-vectored in ovo AI vaccines can be produced rapidly and mass-administered into chicken populations within the context of a high-standard safety profile in response to an emerging AI pandemic. Large-scale production of RCA-free Ad5 vectors in the well-characterized PER.C6 cell line in serum-free suspension bioreactors [22] in conjunction with chromatography-mediated purification [23], and buffers that do not require freezers for long-term storage [20], should greatly reduce the production costs of Ad5 vectors. Potency of this novel in ovo vaccine conceivably may be further enhanced by codon optimization of the HA gene and/or development of in ovo adjuvants. The use of cultured cells instead of embryonated eggs as a substrate for AI vaccine production is significant, particularly during an AI outbreak when embryonated eggs may be in short supply. This Ad5-vectored AI vaccine is in compliance with a DIVA strategy because the vector only encodes the viral HA. Thus, analysis of serum samples both by HI assay and another serologic test detecting a conserved viral protein (e.g., nuclear protein of an AI virus [24]) would allow easy discrimination between chickens infected by field AI viruses and those subjected to vaccination.
Although an aerosol AI vaccine may be developed by expressing HA from a Newcastle disease virus vector [25] or a reassortant influenza virus containing a non-pathogenic influenza virus backbone [26], the RCA-free Ad5-vectored in ovo AI vaccine provides a unique platform capable of arresting HPAI virus infections in immunized birds through automated delivery of a uniform dose of non-replicating AI vaccine that is compatible with a DIVA strategy. Unlike replicating recombinant vectors that are associated with the risk of generating revertants and allow spread of genetically modified organisms in both target and non-target species in the environment, the RCA-free Ad5 vectors will not propagate in the field. In contrast to the reassortant AI virus vaccine that may generate undesirable further reassortments with a concurrently circulating wild influenza virus [27], it is not possible for the DNA genome of Ad5 to undergo reassortment with the segmented RNA genome of an influenza virus.
Since most domestic chickens are reared for human consumption (broilers) with a short life span (≤2 months in many countries including the U.S.), in ovo administration of the RCA-free Ad5-vectored AI vaccine, at minimum, should be able to protect the great majority of chickens against AI and significantly reduce human exposure to AI viruses. In addition to chickens and AI, other domestic birds can also be effectively immunized in ovo against other pathogens [28]. Introduction of this new class of in ovo vaccine may thus provide a simple and safe solution for mass immunization of poultry in a wide variety of disease settings.
Acknowledgments
We thank P. Gao for generation of the AdTW68.H5 vector; C. Breedlove and D. Grove for technical assistance; Z. Huang for mass production of the vector; S. Ewald, F. J. Hoerr, and V. van Santen for helpful discussions; Crucell Holland BV for providing pAdApt DNA and PER.C6 cells. This work was supported by USDA grant 2005-35605-15388 and NIH grant 1-R43-AI-068285-01.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Fauci AS. Emerging and re-emerging infectious diseases: influenza as a prototype of the host-pathogen balancing act. Cell. 2006;124:665–670. doi: 10.1016/j.cell.2006.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ghedin E, Sengamalay NA, Shumway M, et al. Large-scale sequencing of human influenza reveals the dynamic nature of viral genome evolution. Nature. 2005;437:1162–1166. doi: 10.1038/nature04239. [DOI] [PubMed] [Google Scholar]
- 3.Tollis M, Di Trani L. Recent developments in avian influenza research: epidemiology and immunoprophylaxis. Vet J. 2002;164:202–215. doi: 10.1053/tvjl.2002.0716. [DOI] [PubMed] [Google Scholar]
- 4.Stone H, Mitchell B, Brugh M. In ovo vaccination of chicken embryos with experimental Newcastle disease and avian influenza oil-emulsion vaccines. Avian Dis. 1997;41:856–863. [PubMed] [Google Scholar]
- 5.Swayne DE, Garcia M, Beck JR, Kinney N, Suarez DL. Protection against diverse highly pathogenic H5 avian influenza viruses in chickens immunized with a recombinant fowlpox vaccine containing an H5 avian influenza hemagglutinin gene insert. Vaccine. 2000;18:1088–1095. doi: 10.1016/s0264-410x(99)00369-2. [DOI] [PubMed] [Google Scholar]
- 6.Swayne DE, Perdue ML, Beck JR, Garcia M, Suarez DL. Vaccines protect chickens against H5 highly pathogenic avian influenza in the face of genetic changes in field viruses over multiple years. Vet Microbiol. 2000;74:165–172. doi: 10.1016/s0378-1135(00)00176-0. [DOI] [PubMed] [Google Scholar]
- 7.Swayne DE, Beck NK., JR Failure of a recombinant fowl poxvirus vaccine containing an avian influenza hemagglutinin gene to provide consistent protection against influenza in chickens preimmunized with a fowl pox vaccine. Avian Dis. 2000;44:132–137. [PubMed] [Google Scholar]
- 8.Van Kampen KR, Shi Z, Gao P, et al. Safety and immunogenicity of adenovirus-vectored nasal and epicutaneous influenza vaccines in humans. Vaccine. 2005;23:1029–1036. doi: 10.1016/j.vaccine.2004.07.043. [DOI] [PubMed] [Google Scholar]
- 9.Gao W, Soloff AC, Lu X, et al. Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J Virol. 2006;80:1959–1964. doi: 10.1128/JVI.80.4.1959-1964.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hoelscher MA, Garg S, Bangari DS, et al. Development of adenoviral-vector-based pandemic influenza vaccine against antigenically distinct human H5N1 strains in mice. Lancet. 2006;367:475–481. doi: 10.1016/S0140-6736(06)68076-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhu J, Grace M, Casale J, et al. Characterization of replication-competent adenovirus isolates from large-scale production of a recombinant adenoviral vector. Hum Gene Ther. 1999;10:113–121. doi: 10.1089/10430349950019246. [DOI] [PubMed] [Google Scholar]
- 12.Suarez DL, Schultz-Cherry S. The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model. Avian Dis. 2000;44:861–868. [PubMed] [Google Scholar]
- 13.He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA. 1998;95:2509–2514. doi: 10.1073/pnas.95.5.2509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Shi Z, Zeng M, Yang G, et al. Protection against tetanus by needle-free inoculation of adenovirus-vectored nasal and epicutaneous vaccines. J Virol. 2001;75:11474–11482. doi: 10.1128/JVI.75.23.11474-11482.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Sharma JM, Burmester BR. Resistance to Marek’s disease at hatching in chickens vaccinated as embryos with the turkey herpesvirus. Avian Dis. 1982;26:134–149. [PubMed] [Google Scholar]
- 16.Wakenell PS, Bryan T, Schaeffer J, Avakian A, Williams C, Whitfill C. Effect of in ovo vaccine delivery route on herpesvirus of turkeys/SB-1 efficacy and viremia. Avian Dis. 2002;46:274–280. doi: 10.1637/0005-2086(2002)046[0274:EOIOVD]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
- 17.Swayne DE, Senne DA, Beard CW. Influenza. In: Swayne DE, Glisson JR, Jackwood MW, Pearson JE, Reed WM, editors. Isolation and Identification of Avian Pathogens. American Association of Avian Pathologists; Kennett Square: 1998. pp. 150–155. [Google Scholar]
- 18.Garcia A, Johnson H, Srivastava DK, Jayawardene DA, Wehr DR, Webster RG. Efficacy of inactivated H5N2 influenza vaccines against lethal A/Chicken/Queretaro/19/95 infection. Avian Dis. 1998;42:248–256. [PubMed] [Google Scholar]
- 19.Spackman EDA, Senne TJ, Myers LL, Bulaga LP, Garber ML, Perdue K, Lohman L, Daum T, Suarez DL. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol. 2002;40:3256–3260. doi: 10.1128/JCM.40.9.3256-3260.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Evans RK, Nawrocki DK, Isopi LA, et al. Development of stable liquid formulations for adenovirus-based vaccines. J Pharm Sci. 2004;93:2458–2475. doi: 10.1002/jps.20157. [DOI] [PubMed] [Google Scholar]
- 21.Gao WAC, Soloff X, Lu A, Montecalvo DC, Nguyen Y, Matsuoka PD, Robbins DE, Swayne RO, Donis JM, Katz SM, Barratt-Boyes A, Gambotto Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J Virol. 2006;80:1959–1964. doi: 10.1128/JVI.80.4.1959-1964.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lewis JA, Brown EL, Duncan PA. Approaches to the release of a master cell bank of PER.C6 cells; a novel cell substrate for the manufacture of human vaccines. Dev Biol (Basel) 2006;123:165–176. [PubMed] [Google Scholar]
- 23.Konz JO, Livingood RC, Bett AJ, Goerke AR, Laska ME, Sagar SL. Serotype specificity of adenovirus purification using anion-exchange chromatography. Hum Gene Ther. 2005;16:1346–1353. doi: 10.1089/hum.2005.16.1346. [DOI] [PubMed] [Google Scholar]
- 24.Veits J, Wiesner D, Fuchs W, et al. Newcastle disease virus expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian influenza. Proc Natl Acad Sci USA. 2006;103:8197–8202. doi: 10.1073/pnas.0602461103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Swayne DE. Vaccines for List A poultry diseases: emphasis on avian influenza. Dev Biol (Basel) 2003;114:201–212. [PubMed] [Google Scholar]
- 26.Lee CW, Senne DA, Suarez DL. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine. 2004;22:3175–3181. doi: 10.1016/j.vaccine.2004.01.055. [DOI] [PubMed] [Google Scholar]
- 27.Hilleman MR. Realities and enigmas of human viral influenza: pathogenesis, epidemiology and control. Vaccine. 2002;20:3068–3087. doi: 10.1016/s0264-410x(02)00254-2. [DOI] [PubMed] [Google Scholar]
- 28.Worthington KJ, Sargent BA, Davelaar FG, Jones RC. Immunity to avian pneumovirus infection in turkeys following in ovo vaccination with an attenuated vaccine. Vaccine. 2003;21:1355–1362. doi: 10.1016/s0264-410x(02)00689-8. [DOI] [PubMed] [Google Scholar]






