Skip to main content
The Journal of Experimental Medicine logoLink to The Journal of Experimental Medicine
. 2009 Aug 31;206(9):1863–1871. doi: 10.1084/jem.20091059

TPL-2 negatively regulates interferon-β production in macrophages and myeloid dendritic cells

Frank Kaiser 1, Dorthe Cook 1,2, Stamatia Papoutsopoulou 2, Ricardo Rajsbaum 1, Xuemei Wu 1, Huei-Ting Yang 2, Susan Grant 2, Paola Ricciardi-Castagnoli 3, Philip N Tsichlis 4, Steven C Ley 2,✉, Anne O'Garra 1
PMCID: PMC2737152  PMID: 19667062

Abstract

Stimulation of Toll-like receptors (TLRs) on macrophages and dendritic cells (DCs) by pathogen-derived products induces the production of cytokines, which play an important role in immune responses. Here, we investigated the role of the TPL-2 signaling pathway in TLR induction of interferon-β (IFN-β) and interleukin-10 (IL-10) in these cell types. It has previously been suggested that IFN-β and IL-10 are coordinately regulated after TLR stimulation. However, in the absence of TPL-2 signaling, lipopolysaccharide (TLR4) and CpG (TLR9) stimulation resulted in increased production of IFN-β while decreasing IL-10 production by both macrophages and myeloid DCs. In contrast, CpG induction of both IFN-α and IFN-β by plasmacytoid DCs was decreased in the absence of TPL-2, although extracellular signal-regulated kinase (ERK) activation was blocked. Extracellular signal-related kinase–dependent negative regulation of IFN-β in macrophages was IL-10–independent, required protein synthesis, and was recapitulated in TPL-2–deficient myeloid DCs by retroviral transduction of the ERK-dependent transcription factor c-fos.


Toll-like receptors (TLRs) on macrophages and DCs respond to pathogen-derived products to induce the production of effector molecules that regulate innate and adaptive immune responses (Medzhitov, 2001; Akira and Takeda, 2004; Beutler et al., 2004). These include the type I IFNs, IFN-α and IFN-β, and the proinflammatory cytokine IL-12, which are important for protective responses to infection (O'Garra and Robinson, 2004; Stetson and Medzhitov, 2006), and IL-10, which suppresses cytokine production by macrophages and DCs, thereby limiting the immune response to infectious agents (Moore et al., 2001).

The cytoplasmic regions of TLRs share the Toll/IL-1R (TIR) domain, leading to associations between TLRs and the TIR-containing adaptors, MyD88, TIRAP (MAL), TIR domain–containing adaptor inducing IFN-β (TRIF; TICAM-1), and TRIF-related adaptor molecule (Akira and Takeda, 2004), upon ligand binding. TLR4, the receptor for LPS, utilizes all four adaptors, whereas TLR9, the receptor for CpG-DNA motifs, uses only MyD88. Differential responses mediated by distinct TLR ligands may be explained in part by selective usage of TIR adaptor molecules (Boonstra et al., 2006; Stetson and Medzhitov, 2006; Colonna, 2007; Schmitz et al., 2007; Rajsbaum et al., 2008).

TLR stimulation induces activation of the major mitogen-activated protein kinase (MAPK) subtypes (extracellular signal-related kinases [ERK]-1/2, Jun N-terminal kinases [JNK], and p38) and the IκB kinase (IKK) complex for activation of NF-κB transcription factors (Akira and Takeda, 2004). TNF receptor-associated factor (TRAF) 6 is required for MyD88-dependent activation of MAPKs and NF-κB (Gohda et al., 2004). TRIF-dependent signaling utilizes TRAF3 (Häcker et al., 2006), which couples TRIF and MyD88, to activate TBK1 (Häcker et al., 2006; Oganesyan et al., 2006), a kinase that regulates the activation of IFN regulatory factor (IRF) 3 and IRF7 (Honda et al., 2006). It has been proposed that the TRAF6-dependent pathway, via its activation of MAPKs and IKK, participates in the induction of proinflammatory cytokines, whereas the TRAF3-dependent pathway coordinately regulates the production of type I IFNs and IL-10 (Häcker et al., 2006). Thus, the ratio of TRAF6 versus TRAF3 recruitment to TLRs may dictate the relative production of proinflammatory cytokines, such as IL-12, versus type I IFNs and IL-10. However, the observation that LPS induction of IFN-β in macrophages and DCs is dependent on TRIF, but not MyD88 (Akira and Takeda, 2004; Boonstra et al., 2006), whereas induction of IL-10 requires both adaptors (Boonstra et al., 2006), indicates that IFN-β and IL-10 may not always be coordinately regulated. Furthermore, the signals regulating the induction of type I IFN differ according to the activating TLR and the cell type being stimulated (Colonna, 2007; Schmitz et al., 2007). Thus, TLR4-mediated induction of IFN-β in macrophages and myeloid DCs involves activation of IRF3 (for review see Akira and Takeda, 2004; Stetson and Medzhitov, 2006; Colonna, 2007), whereas TLR9 stimulation of IFN-β in these cells is mediated via IRF1 (Schmitz et al., 2007). However, TLR9 induction of type I IFN in plasmacytoid DCs (pDCs) involves activation of IRF7 (for review see Akira and Takeda, 2004; Stetson and Medzhitov, 2006; Colonna, 2007).

The signaling pathways coupling TLRs to the activation of MAPKs diverge downstream of TRAF6 and involve distinct MAPKKKs (MAP 3-kinases; Symons et al., 2006). In macrophages, LPS activation of ERK, but not JNK or p38 MAPK, is mediated by the MAP 3-kinase TPL-2 (Dumitru et al., 2000), which phosphorylates and activates the ERK-specific MAPKKs MEK-1/2 (Salmeron et al., 1996). A role for ERK activation in the induction of IL-10 and down-regulation of IL-12 production has previously been reported (Yi et al., 2002; Agrawal et al., 2003; Dillon et al., 2004; Banerjee et al., 2006). However, it is still unclear whether the inhibition of IL-12 is a direct effect of TLR ligand-induced ERK activation or results as a consequence of IL-10 induction by this signaling pathway (Yi et al., 2002; Agrawal et al., 2003; Dillon et al., 2004).

In this study, we investigated the role of the TPL-2 signaling pathway in the induction of IFN-β and IL-10 in macrophages, myeloid DCs, and pDCs. We demonstrate that TLR4 and TLR9 activation of ERK was dependent on TPL-2 in each of these cell types. Furthermore, we show that TLR induction of IL-10 was decreased in Tpl-2−/− macrophages and myeloid DCs compared with WT control cells; pDCs do not produce this cytokine upon TLR stimulation. Levels of IFN-β and IL-12 were substantially increased in Tpl-2−/− macrophages and myeloid DCs stimulated with LPS or CpG, as compared with controls. In contrast, production of IFN-α and IFN-β was significantly reduced in Tpl-2−/− pDCs stimulated with CpG, as compared with controls, demonstrating that TPL-2 signaling has different consequences depending on the cell type activated. Negative regulation of IFN-β in macrophages and myeloid DCs required protein synthesis and could be restored in Tpl-2−/− or IL-10−/− myeloid DCs by retroviral expression of the ERK-dependent transcription factor c-fos.

RESULTS AND DISCUSSION

IFN-β is up-regulated and IL-10 is down-regulated in Tpl-2−/− macrophages and myeloid DCs stimulated with LPS

To determine the role of the TPL-2 signaling pathway in TLR regulation of IL-10 and IFN-β production, BM-derived macrophages (BMDMs) and BM-derived DCs (BMDCs/myeloid DCs) were generated from Tpl-2−/− or control WT mice. Induction of IFN-β mRNA and IFN-β protein in response to LPS stimulation were significantly increased in Tpl-2−/− BMDMs compared with control cells (Fig. 1 a). In contrast, IL-10 mRNA and IL-10 protein were significantly decreased in the absence of TPL-2. Increased production of IL-12p40 and p35 mRNA, and in IL-12p70 and p40 protein, was also observed in Tpl-2−/− BMDMs (Fig. 1 a).

Figure 1.

Figure 1.

TPL-2 activation in BMDMs and BMDCs after LPS stimulation negatively regulates IFN-β and IL-12, but is required for optimal IL-10 production. BMDMs (a) and BMDCs (b) generated from wild-type (+/+) and Tpl-2−/− (−/−) mice were stimulated with 100 ng/ml LPS. Cytokine levels in culture supernatants were determined by ELISA after 24 h stimulation. Total RNA was extracted from cells stimulated for 3 h, and cytokine mRNA expression was measured by quantitative PCR (normalized to ubiquitin mRNA). Graphs show mean of individual cell cultures ± SD (protein, n = 4; mRNA, n = 3). *, P < 0.05; **, P < 0.01; ***, P < 0.001; Student's t test. Data are representative of at least three independent experiments with similar results. Whole-cell extracts of BMDMs (a, right) and BMDCs (b, right) were generated after indicated stimulation times and analyzed by immunoblotting with the antibodies shown. Results are representative of at least four independent experiments.

Similarly, BMDCs from Tpl-2−/− mice produced elevated levels (mRNA and protein) of IFN-β, but reduced amounts of IL-10 (Fig. 1 b). However, the increase in IFN-β production in Tpl-2−/− relative to WT cells was less in BMDCs than in BMDMs. The elevated amounts of IFN-β produced by Tpl-2−/− BMDMs and BMDCs may result in part from decreased production of IL-10 because IL-10 inhibits IFN-β production (Moore et al., 2001). This may explain why IFN-β production is less affected by TPL-2 deficiency in BMDCs compared with BMDMs because the BMDCs produce lower concentrations of IL-10. Consistent with the results using Tpl-2−/− BMDMs, Tpl-2−/− BMDCs produced elevated levels of IL-12 p40 and p70 protein and IL-12 p35 and p40 mRNA (Fig. 1 b) compared with control BMDCs.

LPS induction of ERK phosphorylation in macrophages and myeloid DCs is TPL-2 dependent

To determine whether impaired LPS-induced ERK activation accounted for the altered cytokine production by Tpl-2−/− BMDMs, activation of ERK was monitored by specific immunoblotting. In WT cells, LPS-stimulated rapid ERK phosphorylation, which peaked at 15 min (Fig. 1 a). In contrast, LPS-induced ERK phosphorylation was not detected in Tpl-2−/− BMDMs (Fig. 1 a), whereas JNK and p38 phosphorylation were unaffected (Fig. 1 a), as reported previously (Dumitru et al., 2000). To confirm that the effects of TPL-2 deficiency on TLR-induced cytokine production resulted from abrogation of ERK activation, WT cells were treated with the MEK inhibitor U0126 to block ERK activation while leaving p38 or JNK activation unaffected (Favata et al., 1998; Davies et al., 2000). U0126 increased IFN-β and IL-12 production and reduced production of IL-10 by LPS-stimulated BMDMs (Fig. S1), similar to the effects of TPL-2 deficiency in this cell type (Fig. 1 a). Comparable results were obtained with a structurally distinct inhibitor of MEK-1/2, PD184352 (a gift from P. Cohen, University of Dundee, Scotland, UK; unpublished data). These data support the hypothesis that TPL-2 promotes IL-10 production while decreasing IL-12 and IFN-β production via its activation of the ERK MAPK pathway.

We show that activation of ERK by TLR4 in macrophages required TPL-2, in agreement with previous findings (Dumitru et al., 2000; Banerjee et al., 2006; Papoutsopoulou et al., 2006). Our data also suggest that activation of the TPL-2 signaling pathway was required for optimal IL-10 production, but negatively regulated IL-12 production. These findings are in accordance with published data using pharmacological inhibitors to block ERK activation in macrophages (Feng et al., 1999; Häcker et al., 1999; Yi et al., 2002; Banerjee et al., 2006). Moreover, our data suggest that TLR4 activation of the TPL-2 pathway negatively regulates the production of IFN-β, in contrast to its positive effects on IL-10 production.

Although the consequences of TPL-2 deficiency on cytokine production after TLR stimulation were very similar in BMDMs and BMDCs (Fig. 1), it has been suggested previously that LPS does not stimulate ERK activation in BMDCs (Häcker et al., 1999). Hence, we reinvestigated whether TLR4 was actually able to induce ERK phosphorylation in BMDCs. In our hands, LPS clearly stimulated ERK phosphorylation in WT BMDCs (Fig. 1 b), although at a reduced intensity compared with WT BMDMs (Fig.1 a). This may explain the previous failure to detect ERK phosphorylation in BMDCs after LPS stimulation (Häcker et al., 1999). We show that LPS-induction of ERK phosphorylation was blocked in BMDCs from Tpl-2−/− mice (Fig. 1 b), similarly to BMDMs. p38 MAPK phosphorylation was marginally reduced in Tpl-2−/− BMDCs compared with WT cells after LPS stimulation, but JNK phosphorylation was unaffected. Thus, altered cytokine production in Tpl-2−/− BMDCs after TLR stimulation was associated predominantly with a block in ERK activation.

Our data that TPL-2 negatively regulates IL-12 in BMDCs are consistent with reports from the Pulendran group that pharmacological inhibition of ERK activation increases IL-12 production by human and mouse DCs (Agrawal et al., 2003; Dillon et al., 2004). The negative regulatory effect of TPL-2 on IFN-β production that we observe in BMDCs stimulated with LPS contrasts to the requirement of TPL-2 for optimal IL-10 induction (Fig. 1 b). Thus, TLR-induction of IL-10 and IFN-β is oppositely regulated by TPL-2 in both macrophages and myeloid DCs.

CpG stimulation results in increased IFN-β production in Tpl-2−/− macrophages and myeloid DCs, but decreased IFN-α and IFN-β in Tpl-2−/− pDCs

Because pDCs are a major source of type I IFNs during immune responses (Stetson and Medzhitov, 2006), we determined the role of the TPL-2 signaling pathway in TLR-induction of IFN-α and IFN-β in this cell type. As pDCs express TLR9, but not TLR4 (Boonstra et al., 2003), we stimulated pDCs with CpG rather than LPS in comparison to macrophages and myeloid DCs. BMDMs and BMDCs obtained from Tpl-2−/− mice produced elevated levels of IFN-β protein, IL-12p40 and IL-12p70 upon CpG stimulation, as compared with the same cell types from WT mice (Fig. 2, a and b). Ex vivo Tpl-2−/− splenic CD11b+ macrophages purified directly from Tpl-2−/− mice also showed highly elevated levels of IFN-β and IL-12p40 and p70 as compared with equivalent cells from control mice after CpG stimulation (Fig. S2). Furthermore, CpG-induced IL-10 production was significantly reduced in Tpl-2−/− BMDMs (Fig. 2 a) and BMDCs (Fig. 2 b), similar to results observed after LPS stimulation. IL-10 production by purified splenic macrophages was also reduced compared with control WT cells after CpG stimulation (Fig. S2).

Figure 2.

Figure 2.

Upon stimulation with CpG, TPL-2 negatively regulates IFN-β and IL-12 in macrophages and conventional DCs, but not in pDCs. BMDMs, BMDCs, and pDCs generated from WT and Tpl-2−/− mice were stimulated with CpG (500 nM) for 24 h. Cytokine production in culture supernatants was determined by ELISA (mean ± SD; n = 3). *, P < 0.05; **, P < 0.01; ***, P < 0.001; Student's t test. Results are representative of at least three independent experiments.

Opposite effects of TPL-2 deficiency were observed after stimulation of pDCs with CpG. Production of both IFN-α and IFN-β in Tpl-2−/− BM-pDCs were significantly reduced, as compared with pDCs from WT mice (Fig. 2 c). Furthermore, again in contrast to Tpl-2−/− BMDMs and BMDCs, a small but significant decrease in IL-12p40 and IL-12p70 was observed in Tpl-2−/− pDCs stimulated with CpG, as compared with controls (Fig. 2 c). Similar effects were obtained with directly purified ex vivo splenic pDCs (unpublished data). Consistent with the hypothesis that pDCs are wired differently to macrophages and myeloid DCs, pDCs did not produce IL-10 in response to CpG stimulation (unpublished data). Conversely, whereas pDCs produced high levels of IFN-α after stimulation with CpG, IFN-α was not detectable in supernatants of BMDMs and BMDCs stimulated similarly, even in the absence of TPL-2 (unpublished data).

Our findings reveal cell-intrinsic differences in the requirements for TPL-2 in TLR-induced signaling in pDCs versus macrophages and myeloid DCs. Whereas TPL-2 negatively regulated the induction of optimal IFN-β and IL-12 in macrophages and myeloid DCs after TLR-9 stimulation, TPL-2 was required for TLR9 induction of both IFN-α and IFN-β by pDCs. Furthermore, these data extend previous studies showing that the signaling requirements for induction of type I IFNs in pDCs are distinct to macrophages and myeloid DCs (Colonna, 2007; Schmitz et al., 2007).

TPL-2 is required for CpG-induced ERK phosphorylation in macrophages, myeloid DCs, and pDCs

Because CpG stimulation of Tpl-2−/− pDCs resulted in an opposite effect on type I IFN induction than that observed in macrophages and myeloid DCs, it was important to determine whether ERK was phosphorylated in pDCs in response to CpG in a TPL-2–dependent fashion. It was also important to determine whether TLR9 induction of ERK phosphorylation in BMDMs and BMDCs required TPL-2, as it has been recently proposed that TLR9 stimulation does not induce ERK phosphorylation in this cell type (Häcker et al., 1999) and that CpG activation of ERK is not affected by TPL-2 deficiency in macrophages (Sugimoto et al., 2004).

We show here that CpG induced a more gradual increase in ERK phosphorylation in WT BMDMs (Fig. 3 a) than LPS did (Fig. 1 a), and that this was abrogated in BMDMs from Tpl-2−/− mice (Fig. 3 a). CpG clearly stimulated ERK phosphorylation in WT BMDCs (Fig. 3 b), although at a reduced intensity compared with WT BMDMs, possibly explaining data from Sugimoto et al. (2004), who failed to detect any reduction in ERK phosphorylation after CpG stimulation of Tpl-2−/− macrophages. The reduced signal may also explain the previous failure to detect CpG stimulation of ERK phosphorylation in BMDCs (Häcker et al., 1999). CpG-induced ERK phosphorylation in BMDCs was blocked in the absence of TPL-2 (Fig. 3 b). Using a high sensitivity substrate for chemiluminescent detection of phospho-ERK antibody, CpG was also found to induce phosphorylation of ERK in pDCs, which was dependent on TPL-2. CpG-induced p38 and JNK phosphorylation in pDCs were minimally affected by the absence of TPL-2 (Fig. 3 c).

Figure 3.

Figure 3.

TPL-2 is essential for TLR-induced ERK signaling in pDCs. Macrophages (a), myeloid DCs (b), and pDCs (c) were generated from WT and Tpl-2−/− mice and stimulated with 500 nM CpG for times indicated. Whole-cell extracts were analyzed by immunoblotting with the indicated antibodies. Luminescence signals in pDCs blots were visualized using a high sensitivity substrate. Results are representative of three independent experiments with similar results.

Our data show that ERK activation after TLR9 ligation required TPL-2 in macrophages, myeloid DCs, and pDCs, although the effects of TPL-2 deficiency on cytokine induction were distinct in pDCs compared with the other two cell types. The very low levels of ERK phosphorylation induced by CpG stimulation of pDCs compared with BMDMs and BMDCs may explain this differential requirement for TPL-2 in cytokine induction in these different cell types; it has been established in PC12 cells and fibroblasts that the amplitude and duration of ERK signaling can dictate the biological effect of this signaling pathway (Marshall, 1995; Murphy et al., 2002). Alternatively, it is possible that ERK signaling is interpreted differently in pDCs compared with macrophages and myeloid DCs as a consequence of integration of ERK activation with other signaling pathways triggered by TLR9. In accordance with the latter possibility, pDCs have been shown to use unique signaling pathways for the induction of type I IFNs (Honda et al., 2006; Stetson and Medzhitov, 2006; Colonna, 2007; Schmitz et al., 2007; Cao et al., 2008; Guiducci et al., 2008). Consistent with cell type–specific differences for ERK in regulating IFN-β production, a previous study has shown that ERK positively regulates IFN-β production by mouse embryonic fibroblasts in response to myxoma virus infection (Wang et al., 2004), similar to CpG induction of IFN-α and IFN-β in pDCs, but opposite to its negative effects on IFN-β production in macrophages and myeloid DCs (Fig. 2).

Negative regulation of IFN-β by TPL-2 in macrophages requires protein synthesis

To determine the requirement for protein synthesis in the negative regulation of IFN-β mRNA induction by TPL-2, Tpl-2−/− and WT control BMDMs were stimulated with CpG in the presence or absence of cycloheximide (CHX). Induction of IFN-β mRNA was increased when WT BMDMs were stimulated in the presence of CHX compared with untreated control, indicating that IFN-β expression was negatively regulated by a protein synthesis–dependent mechanism (Fig. 4 a). The elevated expression of IFN-β mRNA observed in the Tpl-2−/− BMDMs, however, was not affected by CHX, demonstrating that the negative regulation of IFN-β production by protein synthesis is TPL-2 dependent. Similar results were obtained for IL-12p40 expression (Fig. 4 a); however, CHX increased IL-12p40 mRNA not only in WT BMDMs but also, to a lesser extent, in Tpl-2−/− BMDMs, suggesting TPL-2–dependent and –independent mechanisms for IL-12p40 mRNA regulation. Similar data were obtained with BMDMs stimulated with LPS (unpublished data). This protein synthesis requirement for negative regulation of IFN-β mRNA expression could indicate the action of a TPL-2–dependent cytokine or transcription factor that negatively regulates IFN-β transcription.

Figure 4.

Figure 4.

TPL-2 negatively regulates TLR-induced IFN-β mRNA expression via a de novo protein synthesis–dependent mechanism and independent of IL-10. (a) Before stimulation with 500 nM CpG for 3 h, BMDMs generated from WT and Tpl-2−/− mice were incubated with cycloheximide or left untreated. Total RNA was extracted and the indicated cytokine mRNA expression was measured by quantitative PCR (normalized to HPRT mRNA). The graph shows mean ± SD from two individual mice assayed in triplicate cell cultures. Results are representative of two independent experiments. (b) Before stimulation with 500 nM CpG, BMDMs derived from IL10−/− mice were incubated for 30 min with 2.5 µM U0126 or vehicle control (DMSO). After 24 h stimulation, cytokine production in culture supernatants was assayed by ELISA (mean ± SD; n = 3). *, P < 0.05; **, P < 0.01; ***, P < 0.001; Student's t test. (c) BMDMs generated from WT and Tpl-2−/− mice were stimulated with 500 nM CpG for the times indicated and total RNA was extracted. c-fos mRNA expression was measured by quantitative PCR (normalized to HPRT mRNA). *, P < 0.05; **, P < 0.01; and ***, P < 0.001; two-way analysis of variance (ANOVA) with Bonferroni correction. (d) BMDMs generated from WT and Tpl-2−/− mice were stimulated with 500 nM CpG for the times indicated, and nuclear extracts were prepared. c-fos binding activity was measured by ELISA. Graph shows mean ± SD; n = 3. *, P < 0.05; **, P < 0.01; ***, P < 0.001; two-way ANOVA with Bonferroni correction. Data in b–d are representative of at least three independent experiments.

ERK signaling negatively regulates IFN-β and IL-12 production independent of IL-10

Because IL-10 has profound inhibitory effects on cytokine production by TLR-stimulated macrophages (Moore et al., 2001), it was possible that the increased levels of IFN-β and IL-12 in Tpl-2−/− BMDMs resulted from diminished IL-10 production. However, we show that stimulation of IL-10−/− BMDMs with LPS (not depicted) or CpG (Fig. 4 b) in the presence of U0126 inhibitor resulted in elevated levels of IFN-β and IL-12, as compared with controls. In addition, in the absence of U0126, the production of IFN-β and IL-12 was increased in IL-10−/− BMDMs compared with WT cells. Thus, ERK negatively regulates the production of IFN-β and IL-12 independent of IL-10, but TLR-induced production of these cytokines is additionally regulated by the autocrine effects of IL-10, which is itself positively regulated by ERK.

It has been suggested that TLR stimulation coordinately induces the TRAF3-dependent production of IFN-β and IL-10 (Häcker et al., 2006). However, we have shown previously that IFN-β and IL-10 are not always co-regulated and that LPS activates signaling pathways that have different effects on the expression of these two cytokine genes (Boonstra et al., 2006). In keeping with this, we show that TPL-2 activation of ERK is required for TLR4 and TLR9 induction of IL-10, but negatively regulates IFN-β production via both IL-10–dependent and –independent mechanisms.

Abrogation of ERK signaling in Tpl-2−/− macrophages significantly reduces both c-fos expression and c-Fos DNA binding activity

Our results indicate that negative regulation of IFN-β expression by TPL-2–mediated activation of ERK was dependent on protein synthesis. To identify which transcription factors might regulate IFN-β transcription in an ERK-dependent fashion, LPS and CpG-induced gene expression in BMDMs stimulated in the presence or absence of the MEK inhibitor UO126 was analyzed by Affymetrix gene array. Transcription of the IFN-β gene is known to be regulated by NF-κB, AP-1, and IRFs (for review see Colonna, 2007). Analysis of the gene array data revealed that expression of mRNAs encoding NF-κB and IRF family members was not affected by U0126 (unpublished data). However, U0126 substantially reduced LPS and CpG induction of mRNA encoding the AP-1 transcription factor c-fos (unpublished data), which was shown to regulate IL-10 and IL-12 expression (Dillon et al., 2004). Previous studies with MEK inhibitors have shown that ERK signaling is required for IL-10 production by myeloid cells triggered via TLR (Yi et al., 2002; Dillon et al., 2004). This was suggested to be mediated by transcriptional induction of IL-10 by c-Fos, whose expression is positively regulated by ERK signaling. It has also been suggested that negative regulation of IL-12p40 by ERK was mediated indirectly as a consequence of reduced IL-10 production (Yi et al., 2002). Although ERK down-regulation of IL-12p40 production has also been proposed to be mediated via c-Fos (Dillon et al., 2004), the regulation of IFN-β production was not addressed. Our data obtained with IL-10−/− macrophages demonstrate that ERK negatively regulates IL-12 and IFN-β production independent of IL-10 (Fig. 4 b).

We show that c-fos mRNA expression in macrophages is positively regulated by TPL-2 because CpG induced reduced levels of c-fos mRNA in Tpl-2−/− compared with WT control BMDMs (Fig. 4 c). Similar results were obtained with LPS (unpublished data). At the peak time of c-fos mRNA induction, however, no differences in mRNA expression of AP-1 transcription factors, Jund1 or ets-1, were observed between WT and Tpl-2−/− BMDMs (Fig. S3). Reduced c-fos mRNA in Tpl-2−/− BMDMs stimulated with CpG translated into reduced c-Fos binding activity, since c-Fos binding to a specific AP-1 DNA oligonucleotide was found to be significantly reduced in the absence of TPL-2 (Fig. 4 d).

Retroviral transduction of c-fos into Tpl-2−/− and IL-10−/− myeloid DCs reduces CpG-induced IFN-β and IL-12 expression

To investigate the potential role of c-Fos in negative regulation of IFN-β and IL-12, BMDCs from Tpl-2−/−, IL-10−/−, and WT mice were transduced with a retroviral construct containing c-fos-IRES-GFP or Mock-IRES-GFP and flow cytometry purified on the basis of GFP expression. Expression of c-fos decreased the levels of IFN-β and IL-12 in Tpl-2−/−, IL-10−/−, and WT cells (Fig. 5) induced after CpG stimulation. Whereas negative regulation of IL-12 by c-Fos had been proposed previously, it remained unclear whether this was independent of effects on IL-10 expression (Agrawal et al., 2003; Dillon et al., 2004). We show that c-Fos regulates IL-12 production in the presence and absence of IL-10. Furthermore, the negative regulation of IFN-β by c-Fos suggests a potential mechanism by which the TPL-2 signaling pathway negatively regulates IFN-β production.

Figure 5.

Figure 5.

c-fos reduces TLR up-regulation of IFN-β and IL-12 in Tpl-2−/−, Il-10−/−, and WT BMDCs, independent of IL-10. BMDCs were generated from Tpl-2−/− (a), IL-10−/− (b), and WT (c) mice and transfected with control GFP or c-fos-IRES-GFP encoding vectors. GFP+ BMDCs were sorted by MoFlo and stimulated with 500 nM CpG for 24 h. Cytokine production in culture supernatants was assayed by ELISA (mean ± SD; n = 3). *, P < 0.05; **, P < 0.01; and ***, P < 0.001; Student's t test. Results are representative of five (a and b) or two (c) independent experiments with similar results.

The TPL-2 MAPK signaling pathway has attracted considerable interest as a possible target for antiinflammatory drugs (Hall et al., 2007). Because of its critical role in the induction of TNF (Dumitru et al., 2000; Rousseau et al., 2008), several large pharmaceutical companies are developing small molecule inhibitors of TPL-2 as potential drugs to treat inflammatory diseases (Hall et al., 2007). However, our work suggests that TPL-2 inhibition may have undesirable proinflammatory effects caused by its complex regulation of cytokine production. Thus, although TPL-2 inhibition might decrease TNF production, our data suggest that the production of the proinflammatory cytokines IL-12 and IFN-β would be increased in macrophages and myeloid DCs, whereas production of the antiinflammatory cytokine IL-10 would be decreased. We also show that TPL-2 regulates cytokine production in a cell-specific fashion, positively regulating TLR-induced IL-12 and IFN-β production in pDCs. Our data, therefore, raise questions about the validity of TPL-2 as an antiinflammatory drug target.

MATERIALS AND METHODS

Mice and primary cells.

C57BL/6, Tpl-2−/− (Dumitru et al., 2000), and IL-10−/− (Kühn et al., 1993) mice were bred at the National Institute for Medical Research under specific pathogen–free conditions. All protocols for breeding and experiments with animals were performed and approved by the Home Office, UK, Animals (Scientific Procedures) Act 1986 (Project License Number: PPL 80/2236). Macrophages, myeloid DCs, and pDCs were generated from BM as previously described (Boonstra et al., 2006). BMDM (F4/80+) and BMDC (CD11c+) purities were ≥95%, and pDC (CD11b− CD11c+ B220+ or 120G8+) purities were ≥98% (MoFlo cytometer; Cytomation). Similarly, spleen cell suspensions were depleted of T cells, and DCs and macrophages were purified as CD11b+ (≥95%; Fiorentino et al., 1991).

Antibodies, cDNA, plasmids, and reagents.

The antibodies used for immunoblotting have been previously described (Papoutsopoulou et al., 2006). mAbs used for cell purification were as follows: anti-F4/80-PE (Invitrogen), anti-CD11c-PE (BD), anti-CD11b-APC (eBioscience), and 120G8-Alexa Fluor 488 (Boonstra et al., 2006). Cells were stimulated with Salmonella Minnesota LPS (Enzo Biochem, Inc.) or phosphorothioate CpG DNA (CpG1668: TCCATGACGTTCCTGATGCT; TriLink Biotech). GM-CSF was obtained from Schering-Plough, and Flt3 ligand was purchased from Shanghai Genomics. The MEK-1 inhibitor U0126 (Favata et al., 1998) was obtained from BIOMOL International; DMSO, cycloheximide, and polybrene were purchased from Sigma-Aldrich; Liberase Cl and FuGENE-6 were obtained from Roche. The cDNA encoding c-fos was donated by A. Behrens (Cancer Research Institute, London, UK).

In vitro stimulation of macrophages and DCs, and quantitation of cytokine production.

Supernatants from BMDMs and BMDCs (2 × 105/200 µl) stimulated with LPS (100 ng/ml) or CpG1668 (500 nM) for 24 h were analyzed by commercial ELISA kits for IFN-β (PBL), IL-12p70, and IL-10 (eBioscience). IL-12p40 was detected as previously described (Boonstra et al., 2006).

Protein analyses.

BMDMs and BMDCs were cultured in medium containing 1% FCS for 5 h before stimulation with LPS or CpG and washed in PBS before lysis (1% NP-40, 0.1% SDS, 0.5% deoxycholate acid, 50 mM Tris HCl, pH 8.0, 50 mM NaCl, 2 mM EDTA, 2 mM sodium-pyrophosphate, 50 mM sodium fluoride, 100 mM vanadate [all from Sigma-Aldrich], and complete EDTA-free protease inhibitor cocktail [Roche]). Immunoblotting of proteins was performed as previously described (Saraiva et al., 2005; Papoutsopoulou et al., 2006) and visualized with ECL (GE Healthcare) or SuperSignal West Femto Substrate (Thermo Fisher Scientific). pDCs showed low background levels of MAPK phosphorylation without resting and were used directly, but stimulated in 1% FCS.

RT-PCR.

Total RNA was isolated from BMDMs, BMDCs, and pDCs, using the RNeasy kit (QIAGEN) and reverse transcribed with the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The expression of IFN-β, IL-12p35, IL-12p40, IL-10, c-fos, JunD1, and ets-1 was quantified by Real-Time PCR (7900HT; Applied Biosystems) and normalized against ubiquitin or HPRT mRNA levels, as previously described (Rajsbaum et al., 2008). The following primers and probes were obtained from Applied Biosystems: c-fos (Mm00487425); Jund1 (Mm00495088); ets-1 (Mm00468970).

Measurement of transcription factor DNA-binding activity.

Nuclear extracts of BMDMs stimulated with CpG (500 nM) were prepared with the Nuclear Extract kit and assayed with the TransAM ELISA kit (both from Active Motif).

Retroviral infection of DCs.

Amphoteric c-fos recombinant retrovirus was produced by transfection of c-fos cDNA (subcloned into pMXI-IRES-eGFP vector and sequenced to verify correct insertion; Shoemaker et al., 2006) into the Plat-E packaging cell line (Morita et al., 2000) using FuGene-6 transfection reagent (Roche). Transfected cells were cultured at 37°C for 48 h (DMEM plus 10% FCS and antibiotics). Culture supernatants were centrifuged at 48,000 g for 4 h at 4°C, sediments resuspended and filtered (0.4 µm) as concentrated virus. BMDCs from WT, Tpl-2−/−, or IL-10−/− mice were prepared as previously described (Boonstra et al., 2006), with minor modifications. BM cells were cultured in 6-well plates (Corning) in complete RPMI containing GM-CSF as previously described (Boonstra et al., 2006) at 2 ml/well. After 48 h of incubation, 0.5 µg/ml polybrene and 200 µl of concentrated virus was added per well and plates were centrifuged at 2,000 g for 1 h at 25°C. On days 3, 4, and 5, each well was further supplemented with 1 ml complete BMDCs medium containing 100 µl of virus. On day 7, nonadherent cells were harvested and sorted for GFP+ (MoFlo; Cytomation) and 96% of cells were CD11c+, and 99% GFP+.

Statistical analyses.

Analyses were performed using Prism software (GraphPad).

Online supplemental material.

Fig. S1 shows the contribution of ERK activation to LPS-mediated cytokine production. Fig. S2 shows that TPL-2 negatively regulates TLR-induced IFN-β and IL-12 production, but is required for optimal IL-10 production in splenic macrophages stimulated with CpG. Fig. S3 shows that transcription of Jund1 and Ets1 is not regulated by TPL-2. Online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20091059/DC1.

Acknowledgments

We would like to thank Aaron Rae, Graham Preece, and Nadine Biboum for help with flow cytometric cell sorting.

A. O'Garra, D. Cook, S. Papoutsopulou, H-T. Yang, and S. Ley are supported by the Medical Research Council (MRC) UK. A. O'Garra has additional funding from the sixth Framework EU Program, DC-VACC, and DC-THERA. P. Ricciardi-Castagnoli had funding from DC-VACC and DC-THERA for this project. R. Rajsbaum was supported by DC-THERA. F. Kaiser was supported by the Arthritis Research Campaign UK (ARC 16053), and S. Grant (AICR 03-297) by the Association for International Cancer Research. F. Kaiser was also subsequently by MRC. P.N. Tsichlis is supported by the National Institutes of Health grant R01CA095431.

The authors have no conflicting financial interests.

Footnotes

Abbreviations used: BMDC, BM-derived DC; BMDM, BM-derived macrophage; CHX, cycloheximide; ERK, extracellular signal-regulated kinase; IKK, IκB kinase; IRF, IFN regulatory factor; JNK, Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; MAPKKK, MAP-3 kinase; pDC, plasmacytoid DC; TIR, Toll/IL-1R; TLR, Toll-like receptor; TRAF, TNF receptor-associated factor; TRIF, TIR domain–containing adaptor inducing IFN-β.

References

  1. Agrawal S., Agrawal A., Doughty B., Gerwitz A., Blenis J., Van Dyke T., Pulendran B. 2003. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos.J. Immunol. 171:4984–4989 [DOI] [PubMed] [Google Scholar]
  2. Akira S., Takeda K. 2004. Toll-like receptor signalling.Nat. Rev. Immunol. 4:499–511 [DOI] [PubMed] [Google Scholar]
  3. Banerjee A., Gugasyan R., McMahon M., Gerondakis S. 2006. Diverse Toll-like receptors utilize Tpl2 to activate extracellular signal-regulated kinase (ERK) in hemopoietic cells.Proc. Natl. Acad. Sci. USA. 103:3274–3279 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Beutler B., Hoebe K., Georgel P., Tabeta K., Du X. 2004. Genetic analysis of innate immunity: TIR adapter proteins in innate and adaptive immune responses.Microbes Infect. 6:1374–1381 [DOI] [PubMed] [Google Scholar]
  5. Boonstra A., Asselin-Paturel C., Gilliet M., Crain C., Trinchieri G., Liu Y.J., O'Garra A. 2003. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation.J. Exp. Med. 197:101–109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boonstra A., Rajsbaum R., Holman M., Marques R., Asselin-Paturel C., Pereira J.P., Bates E.E., Akira S., Vieira P., Liu Y.J., et al. 2006. Macrophages and myeloid dendritic cells, but not plasmacytoid dendritic cells, produce IL-10 in response to MyD88- and TRIF-dependent TLR signals, and TLR-independent signals.J. Immunol. 177:7551–7558 [DOI] [PubMed] [Google Scholar]
  7. Cao W., Manicassamy S., Tang H., Kasturi S.P., Pirani A., Murthy N., Pulendran B. 2008. Toll-like receptor-mediated induction of type I interferon in plasmacytoid dendritic cells requires the rapamycin-sensitive PI(3)K-mTOR-p70S6K pathway.Nat. Immunol. 9:1157–1164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Colonna M. 2007. TLR pathways and IFN-regulatory factors: to each its own.Eur. J. Immunol. 37:306–309 [DOI] [PubMed] [Google Scholar]
  9. Davies S.P., Reddy H., Caivano M., Cohen P. 2000. Specificity and mechanism of action of some commonly used protein kinase inhibitors.Biochem. J. 351:95–105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dillon S., Agrawal A., Van Dyke T., Landreth G., McCauley L., Koh A., Maliszewski C., Akira S., Pulendran B. 2004. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells.J. Immunol. 172:4733–4743 [DOI] [PubMed] [Google Scholar]
  11. Dumitru C.D., Ceci J.D., Tsatsanis C., Kontoyiannis D., Stamatakis K., Lin J.H., Patriotis C., Jenkins N.A., Copeland N.G., Kollias G., Tsichlis P.N. 2000. TNF-alpha induction by LPS is regulated posttranscriptionally via a Tpl2/ERK-dependent pathway.Cell. 103:1071–1083 [DOI] [PubMed] [Google Scholar]
  12. Favata M.F., Horiuchi K.Y., Manos E.J., Daulerio A.J., Stradley D.A., Feeser W.S., Van Dyk D.E., Pitts W.J., Earl R.A., Hobbs F., et al. 1998. Identification of a novel inhibitor of mitogen-activated protein kinase kinase.J. Biol. Chem. 273:18623–18632 [DOI] [PubMed] [Google Scholar]
  13. Feng G.J., Goodridge H.S., Harnett M.M., Wei X.Q., Nikolaev A.V., Higson A.P., Liew F.Y. 1999. Extracellular signal-related kinase (ERK) and p38 mitogen-activated protein (MAP) kinases differentially regulate the lipopolysaccharide-mediated induction of inducible nitric oxide synthase and IL-12 in macrophages: Leishmania phosphoglycans subvert macrophage IL-12 production by targeting ERK MAP kinase.J. Immunol. 163:6403–6412 [PubMed] [Google Scholar]
  14. Fiorentino D.F., Zlotnik A., Mosmann T.R., Howard M., O'Garra A. 1991. IL-10 inhibits cytokine production by activated macrophages.J. Immunol. 147:3815–3822 [PubMed] [Google Scholar]
  15. Gohda J., Matsumura T., Inoue J. 2004. Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling.J. Immunol. 173:2913–2917 [DOI] [PubMed] [Google Scholar]
  16. Guiducci C., Ghirelli C., Marloie-Provost M.A., Matray T., Coffman R.L., Liu Y.J., Barrat F.J., Soumelis V. 2008. PI3K is critical for the nuclear translocation of IRF-7 and type I IFN production by human plasmacytoid predendritic cells in response to TLR activation.J. Exp. Med. 205:315–322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Häcker H., Mischak H., Häcker G., Eser S., Prenzel N., Ullrich A., Wagner H. 1999. Cell type-specific activation of mitogen-activated protein kinases by CpG-DNA controls interleukin-12 release from antigen-presenting cells.EMBO J. 18:6973–6982 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Häcker H., Redecke V., Blagoev B., Kratchmarova I., Hsu L.C., Wang G.G., Kamps M.P., Raz E., Wagner H., Häcker G., et al. 2006. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6.Nature. 439:204–207 [DOI] [PubMed] [Google Scholar]
  19. Hall J.P., Kurdi Y., Hsu S., Cuozzo J., Liu J., Telliez J.-B., Seidl K.J., Winkler A., Hu Y., Green N., et al. 2007. Pharmacologic inhibition of tpl2 blocks inflammatory responses in primary human monocytes, synoviocytes, and blood.J. Biol. Chem. 282:33295–33304 [DOI] [PubMed] [Google Scholar]
  20. Honda K., Takaoka A., Taniguchi T. 2006. Type I interferon [corrected] gene induction by the interferon regulatory factor family of transcription factors.Immunity. 25:349–360 [DOI] [PubMed] [Google Scholar]
  21. Kühn R., Löhler J., Rennick D., Rajewsky K., Müller W. 1993. Interleukin-10-deficient mice develop chronic enterocolitis.Cell. 75:263–274 [DOI] [PubMed] [Google Scholar]
  22. Marshall C.J. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation.Cell. 80:179–185 [DOI] [PubMed] [Google Scholar]
  23. Medzhitov R. 2001. Toll-like receptors and innate immunity.Nat. Rev. Immunol. 1:135–145 [DOI] [PubMed] [Google Scholar]
  24. Moore K.W., de Waal Malefyt R., Coffman R.L., O'Garra A. 2001. Interleukin-10 and the interleukin-10 receptor.Annu. Rev. Immunol. 19:683–765 [DOI] [PubMed] [Google Scholar]
  25. Morita S., Kojima T., Kitamura T. 2000. Plat-E: an efficient and stable system for transient packaging of retroviruses.Gene Ther. 7:1063–1066 [DOI] [PubMed] [Google Scholar]
  26. Murphy L.O., Smith S., Chen R.H., Fingar D.C., Blenis J. 2002. Molecular interpretation of ERK signal duration by immediate early gene products.Nat. Cell Biol. 4:556–564 [DOI] [PubMed] [Google Scholar]
  27. O'Garra A., Robinson D. 2004. Development and function of T helper 1 cells.Adv. Immunol. 83:133–162 [DOI] [PubMed] [Google Scholar]
  28. Oganesyan G., Saha S.K., Guo B., He J.Q., Shahangian A., Zarnegar B., Perry A., Cheng G. 2006. Critical role of TRAF3 in the Toll-like receptor-dependent and -independent antiviral response.Nature. 439:208–211 [DOI] [PubMed] [Google Scholar]
  29. Papoutsopoulou S., Symons A., Tharmalingham T., Belich M.P., Kaiser F., Kioussis D., O'Garra A., Tybulewicz V., Ley S.C. 2006. ABIN-2 is required for optimal activation of Erk MAP kinase in innate immune responses.Nat. Immunol. 7:606–615 [DOI] [PubMed] [Google Scholar]
  30. Rajsbaum R., Stoye J.P., O'Garra A. 2008. Type I interferon-dependent and -independent expression of tripartite motif proteins in immune cells.Eur. J. Immunol. 38:619–630 [DOI] [PubMed] [Google Scholar]
  31. Rousseau S., Papoutsopoulou M., Symons A., Cook D., Lucocq J.M., Prescott A.R., O'Garra A., Ley S.C., Cohen P. 2008. TPL2-mediated activation of ERK1 and ERK2 regulates the processing of pre-TNF alpha in LPS-stimulated macrophages.J. Cell Sci. 121:149–154 [DOI] [PubMed] [Google Scholar]
  32. Salmeron A., Ahmad T.B., Carlile G.W., Pappin D., Narsimhan R.P., Ley S.C. 1996. Activation of MEK-1 and SEK-1 by Tpl-2 proto-oncoprotein, a novel MAP kinase kinase kinase.EMBO J. 15:817–826 [PMC free article] [PubMed] [Google Scholar]
  33. Saraiva M., Christensen J.R., Tsytsykova A.V., Goldfeld A.E., Ley S.C., Kioussis D., O'Garra A. 2005. Identification of a macrophage-specific chromatin signature in the IL-10 locus.J. Immunol. 175:1041–1046 [DOI] [PubMed] [Google Scholar]
  34. Schmitz F., Heit A., Guggemoos S., Krug A., Mages J., Schiemann M., Adler H., Drexler I., Haas T., Lang R., Wagner H. 2007. Interferon-regulatory-factor 1 controls Toll-like receptor 9-mediated IFN-beta production in myeloid dendritic cells.Eur. J. Immunol. 37:315–327 [DOI] [PubMed] [Google Scholar]
  35. Shoemaker J., Saraiva M., O'Garra A. 2006. GATA-3 directly remodels the IL-10 locus independently of IL-4 in CD4+ T cells.J. Immunol. 176:3470–3479 [DOI] [PubMed] [Google Scholar]
  36. Stetson D.B., Medzhitov R. 2006. Type I interferons in host defense.Immunity. 25:373–381 [DOI] [PubMed] [Google Scholar]
  37. Sugimoto K., Ohata M., Miyoshi J., Ishizaki H., Tsuboi N., Masuda A., Yoshikai Y., Takamoto M., Sugane K., Matsuo S., et al. 2004. A serine/threonine kinase, Cot/Tpl2, modulates bacterial DNA-induced IL-12 production and Th cell differentiation.J. Clin. Invest. 114:857–866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Symons A., Beinke S., Ley S.C. 2006. MAP kinase kinase kinases and innate immunity.Trends Immunol. 27:40–48 [DOI] [PubMed] [Google Scholar]
  39. Wang F., Ma Y., Barrett J.W., Gao X., Loh J., Barton E., Virgin H.W., McFadden G. 2004. Disruption of Erk-dependent type I interferon induction breaks the myxoma virus species barrier.Nat. Immunol. 5:1266–1274 [DOI] [PubMed] [Google Scholar]
  40. Yi A.K., Yoon J.G., Yeo S.J., Hong S.C., English B.K., Krieg A.M. 2002. Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response.J. Immunol. 168:4711–4720 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Experimental Medicine are provided here courtesy of The Rockefeller University Press

RESOURCES