Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Sep 3.
Published in final edited form as: J Urol. 2008 May 21;180(1):373–378. doi: 10.1016/j.juro.2008.02.040

Neural control of Substance P-induced upregulation and release of macrophage migration inhibitory factor in the rat bladder

Pedro L Vera 1,2, Xihai Wang 1,2, Katherine L Meyer-Siegler 1,2
PMCID: PMC2737321  NIHMSID: NIHMS113559  PMID: 18499160

Abstract

OBJECTIVE

Macrophage migration inhibitory factor (MIF) is increased in the intraluminal fluid after experimental inflammation and mediates pro-inflammatory effects on the bladder. We examined the contribution of nerve activity and of specific neurotransmitter systems on the mechanism of MIF release from the bladder during inflammation.

MATERIALS & METHODS

Male Sprague-Dawley rats were anesthetized, bladders were emptied and filled with saline. Rats received saline (s.c.; control; 0.1 ml/100 g bodyweight) or substance P (40 μg/kg in saline; s.c.; 0.1 ml/100 g bodyweight) and also received hexamethonium (50 mg/kg;i.p.; in saline; 0.1 ml/100 g body weight); intravesical lidocaine (2%; 0.3 ml), atropine (3 mg/kg in saline; i.v.; 0.1 ml/100 g body weight), propranolol (3 mg/kg in saline; i.v.; 0.1 ml/100 g body weight) or phentolamine (10 mg/kg in saline; i.v.; 0.1 ml/100 g body weight). After of 1 hour, the intravesical fluid was removed and the bladder was excised. MIF levels in the intraluminal fluid were measured by ELISA and Western-blotting. MIF expression in bladder homogenates was examined using RT-PCR.

RESULTS

Either intravesical lidocaine or ganglionic blockage with hexamethonium prevented Substance P-induced MIF release. In addition, pretreatment with atropine and phentolamine, but not propranolol, also prevented MIF release. MIF upregulation in the bladder, while increased with Substance P treatment, was only prevented by intravesical lidocaine.

CONCLUSION

Substance P-induced MIF release in the bladder is mediated through nerve activation. Post-ganglionic parasympathetic (via muscarinic receptors) and sympathetic (via alpha-adrenergic receptors) fibers mediate MIF release while activation of bladder afferent nerve terminals upregulate MIF.

Keywords: cytokine, cystitis, muscarinic, alpha-adrenergic, beta-adrenergic

INTRODUCTION

Macrophage migration inhibitory factor (MIF) is a pluripotent cytokine considered to be an upstream regulator of other inflammatory cytokines1. Our recent findings are consistent with an inflammatory role for MIF during bladder inflammation. MIF is constitutively expressed by urothelial cells which contain high concentrations of this cytokine. Under normal conditions urothelial cells exhibit basal release of MIF into the intraluminal space, a process that is increased by experimental bladder inflammation although the mechanism controlling MIF release in the bladder is not well-understood2, 3. Similarly, we observed increased levels of MIF in the urine of patients with urinary tract infections compared to controls4. Our findings also showed MIF upregulation during bladder inflammation2, 3, 5, upregulation of CD74 (binding protein for MIF) and CD44 (signaling component for MIF-CD74 complex)6 thus documenting that all the elements involved in signaling for MIF-mediated pro-inflammatory actions are present in the bladder during inflammation. In support of a pro-inflammatory role for intraluminal MIF, we reported that intravesical antibodies to MIF (to sequester released MIF) decreased experimental bladder inflammation5.

In the present study we examine further the mechanism of MIF release from the bladder during inflammation. We proposed earlier that noxious stimuli in the bladder lead to activation of C-fiber afferents that result in release of tachykinins and set up local and central (i.e. involving the spinal cord) reflexes to produce MIF release and induction of MIF-mediated pro-inflammatory effects in the bladder to maintain and/or augment bladder inflammation (see Fig 45). In support of this hypothesis, we recently showed that intravesical capsaicin also elicited MIF release7 suggesting that activation of bladder sensory fibers are involved in this process.

Figure 4.

Figure 4

Open in a new tab

Effect of different treatments on MIF expression in the bladder. The overall ANOVA showed a significant different across treatment groups (F=12.29, p=0.00002). When compared to saline treated rats (n=3), Substance P treatment (n=3) significantly increased MIF expression in the bladder (Dunnett’s test, p=0.039) and only intravesical lidocaine was able to prevent this effect (Dunnett’s test, p=0.999; compared to saline). The remaining treatments still showed significantly increased MIF upregulation as a result of Substance P treatment. (Dunnett’s test, atropine, p=0.001; propanolol, p=0.001; phentolamine, p=0.033). *=p<0.05; **=p<0.01; ***=p<0.001.

Continuing our investigation of MIF-mediated pro-inflammatory changes in the bladder and to test our hypothesis of reflex-mediated MIF release after noxious bladder stimuli, the aim of the present study was to investigate further the mechanism of Substance P(SP)-induced MIF release by first examining the contribution of nerve activity and more specifically, efferent nerves in the bladder. Thus, we compared the effects of intravesical lidocaine (to block bladder nerve activity) with the effects of ganglionic blockage (to stop efferent pathways to the bladder). Moreover, we also examined the specific contribution of parasympathetic pathways (by blocking muscarinic receptors) and/or sympathetic pathways (by blocking alpha and beta adrenergic receptors) to SP-induced MIF release. In this study we show that MIF release is mediated by activation of post-ganglionic fibers involving muscarinic and alpha-adrenergic receptors while MIF upregulation during bladder inflammation may only involve afferent stimulation.

METHODS

All experiments were approved by the local IACUC committee and conformed to National Institutes of Health guidelines. Male Sprague-Dawley rats (N=45; 300-350 gm; Harlan, IN) were anesthetized with sodium pentobarbital (60 mg/kg; i.p.) and placed on a heating pad. The bladders were exposed and ureters cut and allowed to drain. The bladder was emptied of urine (using a syringe and a 30 ga hypodermic needle) and 0.3 ml saline (or 2% lidocaine; see below) was placed in the bladder.

In experiment 1, we determined the contribution of nerve-activity vs. efferent nerves in Substance P-induced MIF release. The following groups (n= 5 rats/group) were examined: Control: Saline (s.c.); Substance P: Substance P (SP; 40 μg/kg; sc; Sigma, St. Louis, MO); Lidocaine: Lidocaine (2%; intravesically; 0.3 ml; Abbott, Chicago) + SP (s.c.); Hexamethonium: Hexamethonium (50 mg/kg; i.p.; Sigma) + SP (s.c.).

In experiment 2, we determined the contribution of parasympathetic or sympathetic pathways in Substance P-induced MIF release. The following groups (n= 5 rats/group) were examined: Control: Saline (s.c.); Substance P: Substance P (40 μg/kg; s.c.); Atropine: Atropine (3 mg/kg; i.v.; Sigma) + SP (s.c.); Propanolol: Propanolol (3 mg/kg; i.v.; Sigma) + SP (s.c.); Phentolamine: Phentolamine (10 mg/kg; i.v.; Sigma) + SP (s.c.).

All drugs were dissolved in saline, and systemic administration (s.c.,i.p. or i.v.) of the agent was given in a volume of 0.1 ml of solution/100 g of body weight 5-10 minutes prior to SP (s.c.).

One hour after treatment, the intraluminal fluid was collected (using a syringe and a 30 Ga needle), the bladders excised and placed in Trizol (Invitrogen, Carlsbad, California) and the animals euthanized. MIF levels in the intraluminal fluid were determined by ELISA (Experiment 1) or Western-blotting (Experiment 2).

Rat MIF ELISA development and validation

We developed and validated an ELISA to detect rat MIF using commercially available antibodies. Briefly, white high binding ELISA plates (Microlite 2, ThermoScientific, Waltham, MA) were coated with 100 μl goat anti-MIF antibody (sc-16965, 2 μg/ml in phosphate-buffered saline; PBS, pH 7.4; Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature overnight. Plates were blocked with 200 μl reagent diluent (1% BSA in PBS pH 7.4) for 1 h at room temperature. Recombinant rat MIF (Torrey Pines Biolabs, Houston, TX) was used to generate a standard curve from 2000 to 31.25 pg/ml in reagent diluent. Intraluminal fluid was diluted to the appropriate concentration in reagent diluent and applied in duplicate wells. Plates were covered with adhesive tape and incubated 2 h at room temperature. Individual wells were then washed three times with wash buffer (PBS containing 0.05% Tween-20, pH 7.4) using an automated plate washer (ThermoScientific). Detection antibody (biotinylated-goat anti-MIF, BAF289, R&D Systems, Minneapolis, MN) was added at a final concentration of 200 ng/ml, the plates recovered with adhesive and incubated 2 h at room temperature. The wells were washed as described above, 100 μl strepavidin-horseradish peroxidase (1:200 dilution in reagent diluent, DY998, R&D Systems) added to each well and the covered plate was incubated for 20 minutes at room temperature. The wells were washed as described above, 100 μl substrate (SuperSignal ELISA Pico Chemiluminescent Substrate, Pierce, Rockford, IL) was added and each well immediately read using a chemiluminescent microplate reader (GloRunner, Turner BioSystems, Sunnyvale, CA). A standard curve was created using linear regression and sample concentrations calculated by interpolation (PRISM v 4.02, GraphPad Software). This ELISA showed a linear relationship between chemiluminescence (arbitrary units) and MIF concentrations in the range of 31.25-2000 pg/ml (Figure 1). Repeated determinations using the recombinant MIF as standards showed an intraplate (n=10) and interplate (n=10) coefficient of variation of 7.3 and 12% respectively.

Figure 1.

Figure 1

Open in a new tab

Validation of rat MIF ELISA. Representative regression showing high correlation (adjusted r2=0.9979) between MIF concentration (pg/ml) and chemiluminescence (arbitary units). Repeated determinations using recombinant MIF as standards were carried out to determine intraplate (n=10) and interplate (n=10) variability. Results showed coefficient of variation of 7.3 and 12% respectively.

MIF Western-blotting

Western-blotting of intraluminal fluid was performed under non-reducing conditions following the manufacturer’s protocols (NuPAGE Bis-Tris gels, Invitrogen) as described previously7, 8. Briefly, 10 μl of intraluminal fluid were loaded onto NuPAGE Bis-Tris gels (4-12%; Invitrogen). After electrophoresis, separated proteins were transferred to a polyvinylidene fluoride membrane. MIF protein bands were detected using a polyclonal antibody to MIF (R&D Systems; biotinylated; BAF289) and chemiluminescent substrate (Pierce). MIF Western-blotting under denaturing (non-reducing) conditions results in multiple bands reflected MIF association with α1-inhibitor 37. Band intensities were quantified using Kodak Image Station (Kodak, Rochester, NY), added and expressed as a ratio of the saline group.

MIF RT-PCR

The bladders were processed for MIF RT-PCR as previously described8. Briefly, Bladder total RNA was isolated using TriZol reagent (Invitrogen). 1 μg total RNA was reverse transcribed using random hexamers (Promega, Madison, WI) and amplified for MIF by endpoint PCR (ReadyTaq, Sigma). Rat specific MIF PCR primers used were sense: 5’ CTCTCCGAGCTCACCCAGCAG 3’ and antisense: 5’ CGCGTTCATGTCGTAATAGTT 3’. Relative gene expression was determined by measuring net intensity of ethidium bromide staining DNA bands using Kodak Image Station (Kodak). Gene specific PCR product intensities were normalized to an 18S rRNA internal standard (Classic, Ambion, Austin, TX) by determining a ratio (net-intensity of gene-specific band divided by net-intensity of 18S rRNA band).

Statistical Analyses

Data are reported as mean+S.E.M. Data were analyzed using ANOVA followed by Dunnett’s test (using Saline group as control) if the overall ANOVA was significant (p<0.05). Statistical analyses were carried out using R9, and using the multicomp package for post-hoc comparisons10.

RESULTS

We first examined whether blocking nerve activity using intravesical lidocaine or selectively blocking only post-ganglionic (efferent) activity using hexamethonium would be effective in reducing SP-induced MIF release, measured by ELISA. An analysis of variance showed that the effect of treatment was significant (F(3,16) = 4.02, p = 0.026). Subsequent post-hoc analyses using Dunnett’s post-hoc t-test (using saline group as control) indicated that SP treatment significantly increased intraluminal fluid MIF (79.55+ 28.91 μg MIF/ml) compared to saline treatment (10.89+ 1.04 μg MIF/ml; Dunnett’s test, p=0.016; Figure 2) similar to our previous findings 3, 7. Pretreatment with either hexamethonium (50 mg/kg; i.p.) or intravesical lidocaine prevented MIF release and in these groups, intraluminal MIF amounts were not significantly different from saline treated animals (18.32+ 6.07 μg MIF/ml, Dunnett’s test, p=0.62; 33.05 + 8.38 μg MIF/ml, p=0.97, respectively).

Figure 2.

Figure 2

Open in a new tab

Changes in MIF levels in the intraluminal fluid increased after different treatments. The overall ANOVA showed a significant difference (p=0.026) across treatment groups. Substance P (n=5) increased the intraluminal levels of MIF (as measured by ELISA) compared to saline treatment (n=5) and this difference was statistically significant (Dunnett’s test, p=0.0162). Pretreatment with hexamethonium (Hex; 50 mg/kg; i.p; n=5) or intravesical lidocaine (Lid; 0.3 ml; 2%; n=5) prevented Substance P-induced increase in intraluminal MIF so that the level of MIF in those groups were not significantly different from saline (Dunnett’s test, p=0.621; p=0.973, respectively). Sal= Saline; SP=Substance P (s.c.); Hex+SP: Pretreatment with hexamethonium followed by Substance P; Lid = Intravesical Lidocaine followed by Substance P; *=p<0.05.

Next we examined whether blocking parasympathetic pathways (through blockade of muscarinic receptors) or sympathetic pathways (through blockade of alpha or beta adrenergic receptors) was able to prevent SP-induced MIF release. Using Western-blot analysis we examined the effects of SP and pre-treatment with atropine, propanolol and phentolamine on the levels of MIF in the intraluminal fluid (Figure 3). Figure 3A shows MIF Western blotting of intraluminal fluid for 3 different animals in each of the treatment groups, and high molecular weight bands (approximate molecular weights 170 and 130 kDa) as well as a 12 kDa band were detected. High-molecular weight bands are MIF-alpha1-inhibitor 3 complexes as recently shown by us7, while monomeric MIF is 12 kDa. As can be seen in Figure 3A, SP increased the intensity of the high molecular weight bands compared to saline treated rats. Atropine and phentolamine prevented the increase in intensity while propanolol had no effect. Figure 3B shows the densitometric analysis of the Western-blotting MIF bands (170, 130 and 12 kDa) normalized to the saline group. ANOVA showed the effect of treatment was significant (F(4,10)= 8.41, p=0.003), while post-hoc tests indicated that SP produced a greater than four-fold increase (compared to saline) in the amounts of MIF detected by Western blotting (Dunnett’s test, p=.0029), particularly the 170 and 130 kDa bands that are associated with alpha1-inhibitor 37 (Fig 3A). Pretreatment with atropine (3 mg/kg; i.v.) prevented the increase in SP-mediated MIF release and this group was not significant different from saline (Dunnett’s test, p=0.979). Similarly, pretreatment with phentolamine prevented SP-induced MIF release and this group was not significantly different from saline (Dunnett’s test, p=0.848), However, pretreatment with propranolol did not prevent SP-induced effects and intraluminal MIF levels increased four-fold when compared to saline (Figure 3A,3B; Dunnett’s test, p=0.024).

Figure 3.

Figure 3

Open in a new tab

Effect of different receptor blockade on Substance P-induced MIF release. A) Western-blotting under denaturing (non-reducing) conditions showed multiple MIF bands. High molecular weight bands (170,130 kDa, indicated on the right side of the figure) correspond to MIF-alpha-1 inhibitor 3 complexes as reported earlier7, whereas a band at 12 kDa corresponds to monomeric MIF. Each lane represents intraluminal fluid from one animal. Substance P (SP) increased the intensity of the MIF Western-blotting bands at 170 and 130 kDa (previously shown to be associated with alpha1-inhibitor 37. MIF bands at 170, 130 and 12 kda (monomeric MIF) are indicated by markers on the left hand side of the figure. Atropine (3 mg/kg; i.v.) or phentolamine (10 mg/kg; i.v.) pretreatment blocked the effect of Substance P. Propanolol (3 mg/kg; i.v.) had no effect. Although 5 animals were used in each group, we randomly selected 3 to allow side-by-side comparisons during Western-blotting. This procedure was repeated twice include all animals and to insure reproducibility of results. B) Densitometric analysis of the MIF Western-blot bands (170,130, 12) in panel A. The overall ANOVA showed a significant difference across treatment groups (F=8,41, p=0.0036). A significant increase in levels of intraluminal MIF was observed after Substance P when compared to saline treatment (Dunnett’s test, p<0.003). This increase was prevented by pre-treatment with atropine and phentolamine, and in these groups the intraluminal MIF levels were not significantly different from saline treated animals (Dunnett’s test, p=0.980; p=0.848, respectively). The group treated with propanolol still showed increased levels of MIF in the intraluminal fluid when compared to saline (Dunett’s test, p=0.024). Abbreviations: Sal=Saline; SP=Substance P; ATR+SP: Atropine pretreatment followed by Substance P; PRO+SP: Propanolol pretreatment followed by Substance P; PHE+SP: Phentolamine pretreatment followed by Substance P. *=p<0.05; **=p<0.01.

We also examined the effect of the different treatments on upregulation of bladder MIF using RT-PCR. Figure 4 shows that SP treatment alone upregulated MIF mRNA in the bladder as shown by us earlier 3, 5. Similar findings were observed for all the other treatments, except for intravesical lidocaine pre-treatment which abolished MIF upregulation after SP treatment (Figure 4).

DISCUSSION

SP elicits MIF release into the intraluminal fluid of the rat as we have shown in this and previous studies3, 5, 7. In this study we show that blocking nerve activity in the bladder with intravesical lidocaine or blocking ganglionic transmission (with hexamethonium) prevents SP-induced MIF release indicating that nerve activity is necessary for SP-induced MIF release and that such release is mediated via activation of post-ganglionic pathways to the bladder.

Intravesical lidocaine likely blocked both afferent and efferent nerve activity at the bladder since intravesical lidocaine has also been reported to abolish micturition contractions and produce overflow incontinence during cystometry in rats11. In the clinical literature, on the other hand, poor penetration by lidocaine (and other local anesthetics) has been reported, necessitating increasing the pH of the lidocaine solution to maximize absorbance12.

SP-induced MIF release was prevented by either blocking nerve fibers (intravesical lidocaine) or a ganglionic blocker (hexamethonium), suggesting that SP activated bladder afferent fibers (probably C-fibers, since capsaicin also elicited MIF release7) to activate reflex pathways in the spinal cord leading to activation of post-ganglionic nerves to the bladder and MIF release into the intraluminal fluid.

Then, we selectively blocked the contribution of the transmitters (cholinergic or adrenergic) in efferent post-ganglionic pathways to the bladder13, 14. Administration of atropine to block muscarinic receptors or phentolamine to block alpha-adrenergic receptors at the bladder, both prevented SP-induced MIF release. Administration of propanolol to block beta-adrenergic receptors, on the other hand, was not effective. Therefore, our data suggest that SP-induced MIF release may be due to afferent activation of reflex post-ganglionic pathways to the bladder, involving both parasympathetic (acting via muscarinic) and sympathetic (acting via alpha-adrenergic) innervation. As a first step, we used broad receptor blockers at concentrations reported effective for blocking transmission in the rat bladder13, 14, the receptor subtypes involved remain to be elucidated and future experiments will investigate this question. It should be noted, that cytokine release modulated by the parasympathetic and/or sympathetic nervous systems has been reported in other organs15-17 and suggests that neural modulation of the immune system is likely to play a pivotal role in health and disease.

Although either ganglionic blockade or selective blockade (of either muscarinic or alpha-adrenergic receptors) prevented SP-induced MIF release, these treatments had no effect on MIF upregulation in the bladder produced by SP. Thus, activation of efferent pathways to the bladder does not appear to be involved in MIF upregulation in the bladder after SP treatment. It is possible that SP is acting directly on bladder epithelia or muscle to upregulate MIF. However, intravesical lidocaine prevented MIF upregulation after SP. Thus, it appears that nerve activity is necessary for MIF upregulation after SP and since blockade of post-ganglionic efferent pathways to the bladder had no effect, it suggests that afferent nerve activity alone is sufficient to elicit MIF upregulation. Consistent with this possibility, intravesical capsaicin alone was observed to upregulate MIF in the bladder (unpublished observations), indicating that activation of capsaicin-sensitive afferent fibers mediate MIF upregulation.

Our observations suggests that neurogenic inflammation produced by the release of neuropeptides at the bladder and proposed as one of several factors involved in chronic pelvic pain conditions (including interstitial cystitis)18, may be capable of upregulating bladder MIF production and result in MIF release into the intraluminal fluid which, in turn, can augment or maintain inflammatory processes in the bladder (Figure 5). Increased MIF release alone, however, is not likely to be sufficient to produce pro-inflammatory effects without the presence of CD74 (recognized MIF-binding protein) and CD44 (MIF-CD74 signaling component), which are both upregulated during experimental bladder inflammation6. We also recently presented preliminary evidence of upregulation of MIF and CD74 in the urothelium of IC patients19. Since IC patients have increased levels of urinary SP20, it is possible that neurogenic inflammation in these patients may be eliciting similar results (in terms of MIF/CD74 upregulation) as we have observed in an animal model of experimental cystitis.

Figure 5.

Figure 5

Open in a new tab

Proposed mechanism by which MIF maintains and/or enhances bladder inflammation (modified from Siegler & Vera5 to incorporate new evidence). Noxious stimulation activate C-fiber afferents in the bladder to produce local release of tachykinins (e.g. neurogenic inflammation) and also set up reflexes involving the central nervous system (CNS). C-fiber activation (as shown with intravesical capsaicin7) of CNS reflexes results in release of MIF mediated via activation of muscarinic and alpha-adrenergic receptors (presumably through activation of efferent activity to the major pelvic ganglia (MPG) and sympathetic ganglia (SG) innervating the bladder) and upregulation of MIF production in the bladder. Released MIF can then bind to the CD74/CD44 receptor-signaling complex that is also upregulated in the urothelium during inflammation6 and induce production of pro-inflammatory mediators5. These factors can then further activate local afferent fibers thus setting up a positive feedback loop that maintains inflammation. Continued release of MIF and other pro-inflammatory mediators, if left unchecked, can then set up conditions of chronic inflammation and further activation of central nervous system reflexes including viscero-visceral interactions.

CONCLUSIONS

SP-induced MIF release in the bladder is nerve-mediated and involves activation of post-ganglionic fibers (via muscarinic and alpha-adrenergic receptors) indicating that activation of both parasympathetic and sympathetic pathways to the bladder elicit MIF release. Activation of bladder afferent fibers mediates MIF upregulation in the bladder. These results show that neurogenic inflammation modulates MIF production and release in the bladder through activation of different nerve terminals.

Acknowledgments

We thank Hugo L. Fernandez, Ph.D. for helpful comments during the preparation of this manuscript.

This work was supported by the Department of Veterans Affairs Merit Award program (PLV; KLMS), NIDDK (DK075059; XW, PLV, KLMS) and by the Bay Pines Foundation.

Gary A. Smith Jr. and Mircea Cristescu provided excellent technical assistance.

ABBREVIATIONS

SP

Substance P

MIF

Macrophage migration inhibitory factor

RT-PCR

reverse transcriptase polymerase chain reaction

ANOVA

analysis of variance

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Morand EF. New therapeutic target in inflammatory disease: macrophage migration inhibitory factor. Intern Med J. 2005;35:419. doi: 10.1111/j.1445-5994.2005.00853.x. [DOI] [PubMed] [Google Scholar]
  • 2.Meyer-Siegler KL, Ordorica RC, Vera PL. Macrophage migration inhibitory factor is upregulated in an endotoxin-induced model of bladder inflammation in rats. J Interferon Cytokine Res. 2004;24:55. doi: 10.1089/107999004772719918. [DOI] [PubMed] [Google Scholar]
  • 3.Meyer-Siegler KL, Vera PL. Substance P induced release of macrophage migration inhibitory factor from rat bladder epithelium. J Urol. 2004;171:1698. doi: 10.1097/01.ju.0000115883.49365.1a. [DOI] [PubMed] [Google Scholar]
  • 4.Meyer-Siegler KL, Iczkowski KA, Vera PL. Macrophage migration inhibitory factor is increased in the urine of patients with urinary tract infection: macrophage migration inhibitory factor-protein complexes in human urine. J Urol. 2006;175:1523. doi: 10.1016/S0022-5347(05)00650-6. [DOI] [PubMed] [Google Scholar]
  • 5.Meyer-Siegler KL, Vera PL. Intraluminal antibodies to macrophage migration inhibitory factor decrease substance P induced inflammatory changes in the rat bladder and prostate. J Urol. 2004;172:1504. doi: 10.1097/01.ju.0000140213.54457.97. [DOI] [PubMed] [Google Scholar]
  • 6.Meyer-Siegler KL, Vera PL. Substance P induced changes in CD74 and CD44 in the rat bladder. J Urol. 2005;173:615. doi: 10.1097/01.ju.0000143188.02802.f3. [DOI] [PubMed] [Google Scholar]
  • 7.Vera PL, Iczkowski KA, Leng L, Bucala R, Meyer-Siegler KL. Macrophage migration inhibitory factor is released as a complex with alpha1-inhibitor-3 in the intraluminal fluid during bladder inflammation in the rat. J Urol. 2005;174:338. doi: 10.1097/01.ju.0000161606.15696.79. [DOI] [PubMed] [Google Scholar]
  • 8.Vera PL, Meyer-Siegler KL. Substance P induces localization of MIF/alpha1-inhibitor-3 complexes to umbrella cells via paracellular transit through the urothelium in the rat bladder. BMC Urol. 2006;6:24. doi: 10.1186/1471-2490-6-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.R Development Core Team. R Foundation for Statistical Computing. Vienna, Austria: 2007. R: A language and environment for statistical computing. http://www.R-project.org. [Google Scholar]
  • 10.Hothorn T, Bretz F, Westfall P. multcomp: Simultaneous Inference for General Linear Hypotheses. R package version 0.992-1. 2007 http://www.R-project.org.
  • 11.Lecci A, Giuliani S, Lazzeri M, Benaim G, Turini D, Maggi CA. The behavioral response induced by intravesical instillation of capsaicin rats is mediated by pudendal urethral sensory fibers. Life Sci. 1994;55:429. doi: 10.1016/0024-3205(94)90054-x. [DOI] [PubMed] [Google Scholar]
  • 12.Henry R, Patterson L, Avery N, Tanzola R, Tod D, Hunter D, et al. Absorption of alkalized intravesical lidocaine in normal and inflamed bladders: a simple method for improving bladder anesthesia. J Urol. 2001;165:1900. doi: 10.1097/00005392-200106000-00014. [DOI] [PubMed] [Google Scholar]
  • 13.Hegde SS, Mandel DA, Wilford MR, Briaud S, Ford AP, Eglen RM. Evidence for purinergic neurotransmission in the urinary bladder of pithed rats. Eur J Pharmacol. 1998;349:75. doi: 10.1016/s0014-2999(98)00173-3. [DOI] [PubMed] [Google Scholar]
  • 14.Jeong MS, Lee JG. The role of spinal and peripheral alpha1-and alpha2-adrenoceptors on bladder activity induced by bladder distension in anaesthetized rat. BJU Int. 2000;85:925. doi: 10.1046/j.1464-410x.2000.00572.x. [DOI] [PubMed] [Google Scholar]
  • 15.Castrillon PO, Cardinali DP, Arce A, Cutrera RA, Esquifino AI. Interferon-gamma release in sympathetically denervated rat submaxillary lymph nodes. Neuroimmunomodulation. 2000;8:197. doi: 10.1159/000054280. [DOI] [PubMed] [Google Scholar]
  • 16.Esquifino AI, Castrillon PO, Arce A, Cutrera RA, Cardinali DP. Effect of parasympathetic decentralization on interferon-gamma release from rat submandibular lymph nodes in vitro. Auton Neurosci. 2001;91:10. doi: 10.1016/s1566-0702(01)00291-0. [DOI] [PubMed] [Google Scholar]
  • 17.Pongratz G, Harle P, Schnellinger G, Janele D, Scholmerich J, Straub RH. Norepinephrine in mice inhibits secretion of splenic IL-6 during the dark period but stimulates its secretion in the light period--possible role of the corticosterone tone. J Neuroimmunol. 2005;158:120. doi: 10.1016/j.jneuroim.2004.08.017. [DOI] [PubMed] [Google Scholar]
  • 18.Wesselmann U. Neurogenic inflammation and chronic pelvic pain. World J Urol. 2001;19:180. doi: 10.1007/s003450100201. [DOI] [PubMed] [Google Scholar]
  • 19.Vera PL, Iczkowski KA, Moldwin RM, Kushner LM-S, K L. Macrophage migration inhibitory factor and its receptor (CD74) are upregulated in the urothelium of Interstitial Cystitis patients. Journal of Urology. 2006;175(Supplement):95. [Google Scholar]
  • 20.Kushner L, Chiu PY, Brettschneider N, Lipstein A, Eisenberg E, Rofeim O, et al. Urinary substance P concentration correlates with urinary frequency and urgency in interstitial cystitis patients treated with intravesical dimethyl sulfoxide and not intravesical anesthetic cocktail. Urology. 2001;57:129. doi: 10.1016/s0090-4295(01)01100-1. [DOI] [PubMed] [Google Scholar]

RESOURCES