Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2009 Jun 29;77(9):4111–4120. doi: 10.1128/IAI.00409-09

Bicarbonate Induces Vibrio cholerae Virulence Gene Expression by Enhancing ToxT Activity▿ †

Basel H Abuaita 1, Jeffrey H Withey 1,*
PMCID: PMC2738005  PMID: 19564378

Abstract

Vibrio cholerae is a gram-negative bacterium that is the causative agent of cholera, a severe diarrheal illness. The two biotypes of V. cholerae O1 capable of causing cholera, classical and El Tor, require different in vitro growth conditions for induction of virulence gene expression. Growth under the inducing conditions or infection of a host initiates a complex regulatory cascade that results in production of ToxT, a regulatory protein that directly activates transcription of the genes encoding cholera toxin (CT), toxin-coregulated pilus (TCP), and other virulence genes. Previous studies have shown that sodium bicarbonate induces CT expression in the V. cholerae El Tor biotype. However, the mechanism for bicarbonate-mediated CT induction has not been defined. In this study, we demonstrate that bicarbonate stimulates virulence gene expression by enhancing ToxT activity. Both the classical and El Tor biotypes produce inactive ToxT protein when they are cultured statically in the absence of bicarbonate. Addition of bicarbonate to the culture medium does not affect ToxT production but causes a significant increase in CT and TCP expression in both biotypes. Ethoxyzolamide, a potent carbonic anhydrase inhibitor, inhibits bicarbonate-mediated virulence induction, suggesting that conversion of CO2 into bicarbonate by carbonic anhydrase plays a role in virulence induction. Thus, bicarbonate is the first positive effector for ToxT activity to be identified. Given that bicarbonate is present at high concentration in the upper small intestine where V. cholerae colonizes, bicarbonate is likely an important chemical stimulus that V. cholerae senses and that induces virulence during the natural course of infection.


Cholera is a human disease that is characterized by massive loss of water and electrolytes, which leads to severe dehydration and hypovolemic shock if the condition is not treated. The causative agent of cholera is Vibrio cholerae, a highly motile, gram-negative, curved rod having a single polar flagellum. V. cholerae strains are classified into serogroups based on the lipopolysaccharide O antigen, and more than 200 serogroups have been identified to date. Only serogroups O1 and O139 are responsible for epidemic and pandemic cholera (46, 47). Serogroup O1 can be further divided into two biotypes, classical and El Tor, based on biochemical properties and susceptibility to bacteriophages (11, 47). Classical biotype V. cholerae strains are thought to have caused the first six cholera pandemics, beginning in 1817, whereas the El Tor biotype has been responsible for the seventh pandemic, which has been ongoing since 1961 (11, 47).

A major difference between the classical and El Tor biotypes is that they require different in vitro growth conditions for virulence gene induction. The classical biotype is cultured in LB medium at 30°C and pH 6.5 for maximal virulence gene expression and is cultured in LB medium at 37°C and pH 8.5 for minimal virulence gene expression (41). The El Tor biotype is cultured under biphasic conditions termed AKI conditions for maximal virulence gene expression (26-28). During the first phase, the bacteria are cultured for several hours statically in a stationary tube in AKI medium, which contains 1.5% peptone, 0.3% yeast extract, and 0.5% NaCl (26). During the second phase, an aliquot is vigorously aerated and cultured for another several hours. Cholera toxin (CT) expression in the El Tor biotype was also observed when bacteria were grown in AKI media supplemented with 0.3% sodium bicarbonate under strictly static conditions (27). The mechanisms that induce virulence gene expression under either of these conditions are unknown.

Growth under virulence-inducing conditions results in production of the two major virulence factors, CT and toxin-coregulated pilus (TCP) (41, 56, 57), as well as an assortment of other gene products having functions that are poorly understood (10, 16, 17, 22, 23, 43). CT and TCP are absolutely required for V. cholerae to cause cholera. CT, a classical AB toxin composed of pentameric B subunits and one enzymatic A subunit (13, 34), is encoded by the ctxAB genes in the genome of a filamentous bacteriophage (CTXφ) (59). The CT A subunit ADP ribosylates a regulatory G protein in the intestinal epithelium, leading to constitutive adenylate cyclase activity and subsequent hypersecretion of water and electrolytes (47). This results in the voluminous watery diarrhea that is the hallmark of cholera. TCP is a type IV pilus that is encoded in the tcpA operon on the Vibrio pathogenicity island and aids in the formation of microcolonies during colonization of the intestinal epithelial lining (29, 57, 58). TCP also acts as the receptor for CTXφ, which allows nontoxigenic V. cholerae carrying the Vibrio pathogenicity island to acquire the CT genes (59).

The regulation of V. cholerae virulence gene expression is complex (38). The V. cholerae virulence genes have collectively been known as the ToxR regulon due to the central role that the ToxR protein plays in activating virulence gene expression. However, the major direct transcription activator of the virulence genes is the ToxT protein. ToxT is produced by the action of the transcription activators ToxR and TcpP (9, 18, 19, 31). Once produced, ToxT activates transcription of many virulence genes, including tcpA and ctxAB, leading to pathogenesis (24, 61-63, 65, 66). ToxR has also been shown to play a role in virulence gene expression independent of ToxT. Studies of classical biotype V. cholerae have shown that ToxR alone can induce CT production in the presence of bile (25). However, the amount of secreted toxin is very small compared to the amount of secreted toxin produced in a ToxT-dependent manner, and this ToxR-dependent expression has not been observed in El Tor strains or in vivo (32).

ToxT belongs to the large AraC/XylS family of transcription regulators (20). The carboxyl terminus of ToxT, corresponding to the conserved AraC family domain, contains two helix-turn-helix motifs that are utilized for DNA binding (37). The amino terminus does not share similarity with any protein in the databases and is hypothesized to be involved in dimerization and/or interaction with an effector(s) that modulates ToxT activity (44). Bile and bile components have been shown to decrease ToxT activity, perhaps through direct binding by ToxT (7, 14, 49). However, no positive effector for ToxT activity has been identified.

While the in vivo signals that induce V. cholerae virulence gene expression have not been determined, V. cholerae has been shown to modulate the expression of its virulence genes in vitro in response to environmental factors and conditions, such as temperature, pH, osmolarity, chemotaxis toward certain amino acids, and bile salts (7, 14, 41, 49). Another potential inducer of virulence gene expression is sodium bicarbonate, which is included in some El Tor AKI media (27) and is present at a high concentration in the upper small intestine, which V. cholerae colonizes. Sodium bicarbonate protects the small intestine from the acidity of fluid arriving from the stomach and is secreted by the pancreatic duct epithelium at concentrations ranging from 70 to 140 mM (21). Data from human volunteers indicated that the infectious dose of V. cholerae decreased from 108 to 104 cells when volunteers were fed 2 g of sodium bicarbonate along with the inoculum (4). Although the interpretation of these data was that administration of bicarbonate enhanced survival of the bacteria in the acidic environment of the stomach, an alternative explanation is that bicarbonate could induce virulence gene expression, signaling to the bacteria that they are entering a human host. The bicarbonate ion has been shown to promote virulence gene expression in other bacteria, such as Bacillus anthracis (60), Streptococcus pyogenes (3), enterohemorrhagic Escherichia coli (1), and the murine pathogen Citrobacter rodentium (64).

To determine whether bicarbonate alone could induce expression of the V. cholerae virulence genes, we monitored the effects of bicarbonate on expression of TCP and CT in both classical and El Tor biotype V. cholerae. The data strongly suggest that bicarbonate enhances virulence gene expression in both biotypes in a ToxT-dependent manner. ToxT protein was observed in bacteria grown with and without sodium bicarbonate in the growth medium, but virulence gene expression was observed only if bicarbonate was present. Addition of a carbonic anhydrase (CA) inhibitor caused a significant reduction in virulence gene expression. Thus, we propose that bicarbonate induces V. cholerae virulence gene expression by enhancing ToxT activity and that this may be the primary mechanism for virulence gene induction in vivo.

MATERIALS AND METHODS

Strains and growth conditions.

V. cholerae classical biotype strain O395 and El Tor biotype strain E7946 and isogenic ΔtoxT (5) and ΔtoxR (31) mutants of these strains were maintained at −70°C in LB medium containing 20% glycerol. All strains were grown overnight in LB medium at 37°C and then subcultured in AKI medium (27) in the presence or absence of 0.3% bicarbonate. Sodium bicarbonate was freshly prepared and used on the day of the experiment. The classical strains were subcultured in the AKI medium from an overnight culture using a 1:100 dilution, while the El Tor strains were diluted 1:1,000.

Plasmid and strain construction.

A chromosomal tcpA-lacZ fusion was constructed as follows. The V. cholerae O395 tcpA promoter region was amplified by PCR with 500-bp segments on either side corresponding to the DNA sequence surrounding the V. cholerae lac promoter. The product was cloned into suicide vector pKAS32, transformed into E. coli SM10(λpir), and moved into V. cholerae strain O395 by conjugation as previously described (50). Thus, PtcpA replaced Plac as the promoter driving lacZ expression from the normal chromosomal locus. A toxT::lacZ fusion plasmid was constructed by PCR amplifying the toxT promoter from V. cholerae O395 genomic DNA and cloning it into pTL61T (33) using XbaI and HindIII restriction sites. The tcpA::lacZ fusion plasmid was constructed previously (62). An arabinose-inducible toxT plasmid (pBAD-toxT) was constructed by amplifying the toxT gene from V. cholerae O395 genomic DNA and cloning it into pBAD33 (15) using XbaI and PstI restriction sites.

RNA isolation and reverse transcription (RT)-PCR.

Cell pellets harvested at different time points during static growth or AKI growth were collected by centrifugation. RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer's protocol. Total RNA was subjected to DNase I digestion for 1 h at 37°C to eliminate any DNA contamination. RNA was recovered by ethanol precipitation and resuspended in RNase-free water. The RNA concentration was adjusted to 5 μg/μl based on A260 measurement. To monitor the presence of toxT mRNA, an aliquot of each RNA sample was reverse transcribed using SuperScript III reverse transcriptase (Invitrogen). This was followed by PCR using Taq DNA polymerase (Denville Scientific) and an Eppendorf Mastercycler gradient thermal cycler. The PCR conditions were as follows: 60 s at 94°C, followed by 30 cycles of 30 s at 94°C for denaturation, 30 s at 55°C for annealing, and 60 s at 72°C for extension and then 5 min at 72°C. The upstream forward primer ATGATTGGGAAAAAATCTTTTC was used (the underlined sequence is the start codon). The reverse primer sequence was TCAAGATCATCAGTAATAAATATAG (the underlined codon is complementary to the leucine codon at position 168 of ToxT relative to the start codon).

β-Galactosidase and CT assays.

β-Galactosidase activity was measured using the basic procedure of Miller (40). CT was detected in the culture supernatant by a GM1 enzyme-linked immunosorbent assay (ELISA) (55), using polyclonal anti-CT antibody (Sigma). A positive control assay for quantification of the level of CT in the samples was performed using purified CT (List Biological Laboratories).

Immunodetection of ToxT.

Aliquots of cells harvested at different time points during growth were normalized based on the optical density at 600 nm and resuspended in 10 μl water and 10 μl of 2× protein buffer (123 mM Tris-HCl, 4% sodium dodecyl sulfate, 1.4 M 2-mercaptoethanol, 20% glycerol, 0.2% bromophenol blue). The samples were boiled for 5 min and subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The gel was blotted on nitrocellulose paper for 2 h using a semidry electroblotter apparatus (Fisher Scientific). Blots were incubated for 2 h in TBS buffer (20 mM Tris-HCl, 0.5 M NaCl, 0.025% Tween 20; pH 7.5) containing 5% milk to reduce nonspecific binding. After the blots were washed with TBS buffer, they were incubated overnight in TBS buffer containing 5% milk and a 1:3,000 dilution of rabbit polyclonal anti-ToxT serum. After three washes for a total of 15 min with TBS buffer, each blot was incubated for 2 h in TBS buffer containing 5% milk and a 1:5,000 dilution of goat anti-rabbit immunoglobulin G conjugated to alkaline phosphatase (Southern Biotech). After the blots were washed with TBS buffer, they were developed using 5 ml of immuno-BCIP (5-bromo-4-chloro-3-indolylphosphate)—nitroblue tetrazolium liquid substrate (Invitrogen).

RESULTS

Sodium bicarbonate stimulates CT and TCP production.

To begin our investigation into the effects of bicarbonate on V. cholerae virulence gene expression, we assessed expression of the tcpA and ctxAB operons. Previous work indicated that CT was produced by El Tor V. cholerae cells when the bacteria were grown in a stationary tube (static conditions) in the presence of bicarbonate (27). CT was not detected when the cells were cultured under the same conditions in the absence of bicarbonate. However, adding a shaking phase after the static growth phase resulted in production of high levels of CT regardless of the presence of bicarbonate in the medium (26). We repeated these experiments using a CT ELISA to measure CT production and β-galactosidase assays to measure tcpA::lacZ expression. CT and β-galactosidase levels were measured at 3, 4, 5, and 6 h after subculturing and again after 4 h of shaking for AKI conditions.

Our results indicate that bicarbonate does indeed induce expression of both CT and TCP under static growth conditions. As shown in Fig. 1A, CT was expressed at very low or undetectable levels when V. cholerae El Tor strain E7946 was grown statically in the absence of bicarbonate. High levels of CT were expressed when the E7946 strain was grown statically in the presence of 0.3% sodium bicarbonate. CT expression peaked at 4 h after subculturing and remained stable during the rest of the experiment (Fig. 1A). An isogenic V. cholerae strain in which toxT, which encodes the major activator of ctxAB and tcpA transcription, was deleted did not produce detectable levels of CT at any time point under any growth conditions, indicating that the observed CT production required ToxT protein activity.

FIG. 1.

FIG. 1.

Effect of bicarbonate on CT and tcpA::lacZ expression. Open bars, wild-type V. cholerae grown without bicarbonate; dark gray bars, wild-type V. cholerae grown with 0.3% bicarbonate; light gray bars, V. cholerae ΔtoxT mutant grown with 0.3% bicarbonate. (A) CT production by El Tor strain E7946. (B) β-Galactosidase produced from plasmid-borne tcpA::lacZ in El Tor strain E7946. (C) CT production by classical strain O395. (D) β-Galactosidase produced from chromosomal tcpA-lacZ in classical strain O395. Statistical significance was determined by Student's t test (*, P < 0.025; **, P < 0.005; ***, P < 0.0005). OD600, optical density at 600 nm; WT, wild type.

Induction of tcpA transcription was also observed to be dependent on both bicarbonate and ToxT. β-Galactosidase production from a plasmid-borne tcpA::lacZ fusion in E7946 was measured at 3, 4, 5, and 6 h after subculturing in medium either containing or lacking 0.3% sodium bicarbonate (Fig. 1B). In contrast to the very low CT production that we observed when bacteria were grown under static conditions in media lacking bicarbonate, some tcpA::lacZ expression was observed over the time course in the absence of bicarbonate, starting at 4 h after subculturing. However, the β-galactosidase levels were much higher when the bacteria were grown in the presence of 0.3% sodium bicarbonate. Once again, an otherwise isogenic ΔtoxT strain did not produce significant β-galactosidase activity at any time point or under any growth conditions. These results demonstrate that bicarbonate stimulates the expression of tcpA and ctxAB and that this stimulation is toxT dependent.

Under AKI growth conditions, which include an additional shaking phase after the static growth phase, CT production was observed to be much higher if bicarbonate was present in the growth medium, but tcpA::lacZ expression was similar in the presence and in the absence of bicarbonate (Fig. 1A and B). Similar results were obtained using El Tor strains C6706 and N16961 (data not shown). An otherwise isogenic ΔtoxT strain did not produce significant CT or β-galactosidase activity under AKI conditions, confirming that the induction of virulence gene expression under AKI conditions is ToxT mediated.

To determine whether bicarbonate also induces virulence gene expression in classical biotype V. cholerae, CT production and tcpA-lacZ expression in classical strain O395 were measured. Previously, it was found that some classical strains produced CT under AKI conditions, whereas other did not (26). Our results indicate that bicarbonate induces virulence gene expression in classical V. cholerae strain O395. Both CT levels (Fig. 1C) and β-galactosidase production from a chromosomal tcpA-lacZ fusion (Fig. 1D) were greatly increased by addition of 0.3% bicarbonate to the growth medium. AKI growth conditions with medium lacking bicarbonate resulted in some induction of CT and tcpA-lacZ expression, but addition of bicarbonate under AKI conditions still caused a significant increase in CT and tcpA-lacZ expression. No significant CT or tcpA-lacZ expression was observed in an isogenic O395 ΔtoxT strain under any conditions (data not shown).

The pH of AKI medium increased from 7.00 to 7.20 when 0.3% bicarbonate was added. To rule out the possibility that the induction of virulence was due to the pH difference, we measured the expression of tcpA::lacZ after the starting pH of AKI medium was increased to 7.2 with sodium hydroxide. No significant induction was observed for either El Tor strain E7946 or classical strain O395 (see Fig. S1 in the supplemental material). The pH of the culture with added bicarbonate remained 7.2 during 4 h of static growth, whereas the pH of the culture whose pH was raised to 7.2 with NaOH dropped to 6.8 during 4 h of static growth, indicating that bicarbonate buffers the medium. Addition of morpholinepropanesulfonic acid (MOPS) buffer to AKI medium with a starting pH of 7.2 kept the pH at 7.2 during 4 h of static growth but had no effect on virulence gene expression unless bicarbonate was also added (data not shown). Overall, these results demonstrate that bicarbonate induces tcpA and ctxAB expression in El Tor and classical V. cholerae strains and that this induction is ToxT dependent.

toxT mRNA production is independent of bicarbonate.

toxT transcription is initially activated by the inner membrane protein pairs ToxR-ToxS and TcpP-TcpH (9, 18, 19, 31). Once ToxT protein is expressed, it can produce more of itself by activating transcription of the tcpA operon, in which the toxT gene is located (65). One possible explanation for the minimal virulence gene expression observed when V. cholerae was cultured under static conditions in the absence of bicarbonate is that the initial activation of toxT did not occur. To examine this possibility, we analyzed the effects of bicarbonate on β-galactosidase production from a toxT::lacZ reporter plasmid. Because the reporter is plasmid based and not located downstream of tcpA, ToxT should have no effect on its expression. When V. cholerae was grown in the absence of bicarbonate, the amount of β-galactosidase activity per cell was larger than the amount when V. cholerae was grown in the presence of bicarbonate (Fig. 2A), strongly suggesting that bicarbonate is not required for and does not positively affect toxT transcription. Addition of bicarbonate to the growth medium caused a ∼50% reduction in toxT::lacZ expression at every time point. Regardless of the presence of bicarbonate, toxT::lacZ expression peaked at 4 h after subculturing, consistent with the ToxT-dependent CT and tcpA::lacZ expression peaks shown in Fig. 1. As a control, β-galactosidase production by a ΔtoxR strain that harbors the same toxT::lacZ fusion plasmid was also measured. The toxT::lacZ expression in the ΔtoxR strain was low at all time points, and no effect of bicarbonate was observed, confirming that toxT transcription is ToxR dependent and bicarbonate independent.

FIG. 2.

FIG. 2.

Bicarbonate does not increase toxT transcription. (A) β-Galactosidase produced from plasmid-borne toxT::lacZ in El Tor strain E7946. Light gray bars, V. cholerae ΔtoxR mutant grown without bicarbonate; black bars, V. cholerae ΔtoxR mutant grown with 0.3% bicarbonate; open bars, wild-type V. cholerae grown without bicarbonate; dark gray bars, wild-type V. cholerae grown with 0.3% bicarbonate. Statistical significance was determined by Student's t test (*, P < 0.02). WT, wild type. (B) RT-PCR to detect toxT mRNA in whole-cell RNA preparations. − RT, no RT was performed before PCR; + RT, RT was performed before PCR. Lane M contained molecular weight standards, and 4 hr and 6 hr indicate the time of growth in a stationary tube. AKI indicates addition of a shaking phase of growth. The presence or absence of bicarbonate in the growth medium is indicated below the gels.

To directly assess whether the toxT mRNA level or stability was affected by bicarbonate, RT-PCR experiments using primers specific for the toxT gene were performed (Fig. 2B). toxT transcripts were present under both static and AKI growth conditions regardless of the presence of bicarbonate. These results indicate that the effect of bicarbonate on virulence gene expression is mediated downstream from toxT transcription.

ToxT protein is produced but inactive in the absence of bicarbonate.

Because toxT mRNA production was not dependent on bicarbonate, we next investigated whether ToxT protein production was dependent on bicarbonate. Bicarbonate could possibly act at the translational level, affecting ToxT protein synthesis, or at the protein level, affecting ToxT activity. Using polyclonal antibodies specific for ToxT, we assessed by Western blotting whether ToxT protein was produced in V. cholerae grown in the presence or absence of bicarbonate. Our results paralleled the results that we obtained for toxT mRNA expression. ToxT protein was stably produced regardless of the presence of bicarbonate in the growth medium (Fig. 3). Using cell extracts harvested from El Tor strain E7946 after 4 h of static growth in medium either containing or lacking bicarbonate, a ToxT-specific band was visible in Western blots under both growth conditions (Fig. 3A, lanes 3 and 4). An isogenic ΔtoxT strain did not produce this band (Fig. 3A, lane 2).

FIG. 3.

FIG. 3.

Detection of ToxT protein in V. cholerae grown in the presence or absence of bicarbonate. ToxT protein was detected by Western blotting using polyclonal anti-ToxT antibodies. 6His-ToxT, purified His-tagged ToxT protein loaded as a control. (A) El Tor strain E7946. The presence or absence of bicarbonate in the growth medium is indicated above the lanes. E7946 ΔtoxT + pBAD-toxT indicates that the ΔtoxT strain was complemented in trans with pBAD-toxT and arabinose was included in the growth medium. (B) Classical strain O395. 4 hr and 6 hr indicate the time of growth in a stationary tube, and AKI indicates that a shaking phase of growth was added. Lane M contained protein molecular weight markers.

Similar results were obtained using cell extracts from classical strain O395. At the 4- and 6-h time points, a ToxT-specific band that corresponded to purified ToxT protein was observed (Fig. 3B, lanes 1, 3, 4, 6, and 7). An isogenic ΔtoxT strain did not produce this band (Fig. 3B, lane 2). The ToxT-specific band was also observed for extracts of O395 grown under AKI conditions (Fig. 3B, lanes 5 and 8). However, the ToxT levels in bacteria grown under AKI conditions with bicarbonate were significantly lower; the reasons for this are unclear. Paralleling the toxT::lacZ expression results indicating that toxT transcription was lower in the presence of bicarbonate, lower ToxT protein levels were observed in cells grown in the presence of bicarbonate in general, strongly suggesting that bicarbonate does not increase ToxT protein expression or stability.

Overexpression of ToxT can compensate for the absence of bicarbonate.

The experimental results described above are consistent with a model in which bicarbonate positively affects ToxT activity rather than ToxT expression levels. Previous work indicated that ToxT expression from a plasmid in V. cholerae or E. coli resulted in activation of virulence factor transcription, even under virulence-repressing growth conditions (66; M. Bellair and J. H. Withey, unpublished results). To investigate whether this overexpression of ToxT could compensate for the absence of bicarbonate as the inducing agent, we constructed a plasmid carrying toxT fused to ParaBAD (pBAD-toxT). ToxT expression can be induced from pBAD-toxT by addition of 0.2% arabinose to the growth medium. This plasmid was transformed into our E7946 ΔtoxT derivative, and CT production and ToxT protein levels in the new strain were then measured.

Our results indicate that ToxT was indeed overproduced from the pBAD-toxT plasmid and that this resulted in increased CT production. In Western blot experiments (Fig. 3A, lanes 5 and 6) much higher levels of ToxT were present in extracts of the E7946 ΔtoxT strain carrying pBAD-toxT than in extracts of wild-type strain E7946 carrying the pBAD33 vector. CT production was approximately sixfold greater in the E7946 ΔtoxT strain carrying pBAD-toxT than in wild-type strain E7946 carrying the pBAD33 vector when both strains were grown in the absence of bicarbonate (Fig. 4). The CT production by the E7946 ΔtoxT strain carrying pBAD-toxT grown without bicarbonate was remarkably similar to the CT production by wild-type strain E7946 carrying the pBAD33 vector grown with bicarbonate. However, bicarbonate still increased CT expression in the E7946 ΔtoxT strain carrying pBAD-toxT more than twofold, suggesting that ToxT activity could be enhanced by bicarbonate even when ToxT levels are far higher than normal.

FIG. 4.

FIG. 4.

Effect of ToxT overproduction from pBAD-toxT on CT production in V. cholerae El Tor strain E7946. Open bars, bacteria grown without bicarbonate; gray bars, bacteria grown with 0.3% bicarbonate. Both strains were grown statically for 6 h in the presence of arabinose before a CT ELISA was performed. E7946 ΔtoxT + pBAD-toxT indicates that the ΔtoxT E7946 strain was complemented in trans with pBAD-toxT, and E7946 + pBAD33 indicates wild-type V. cholerae carrying the empty pBAD33 vector. Statistical significance was determined by Student's t test (*, P < 0.005). OD600, optical density at 600 nm.

A CA inhibitor, ethoxyzolamide (EZA), inhibits the effect of bicarbonate on virulence induction.

The results described above strongly suggest that bicarbonate induces ToxT-dependent V. cholerae virulence gene expression. In mammals, bicarbonate is secreted by the pancreas into the upper small intestine at a concentration of ∼140 mM (21). V. cholerae colonizes the upper small intestine and therefore encounters high levels of bicarbonate during the course of infection. Bicarbonate could enter bacterial cells by at least two routes. First, bicarbonate and CO2 are interconvertible in aqueous solution. CO2 can enter the bacterial cell by passive diffusion and then be converted into bicarbonate by CA. Second, bicarbonate transporters can directly bind to bicarbonate and import it into the cell. Recent studies of other pathogens that utilize bicarbonate/CO2 to induce virulence have produced different results regarding the effects of CA inhibition. Inhibition of CA reduces virulence activation in C. rodentium (64) but has no effect on B. anthracis (60). These results suggest that C. rodentium utilizes CA to accumulate bicarbonate in the cell, while B. anthracis mainly utilizes direct bicarbonate transport.

To determine whether CA inhibition affects bicarbonate-mediated virulence induction in V. cholerae, we measured β-galactosidase production from tcpA::lacZ in the presence of EZA in both classical (O395) and El Tor (E7946) V. cholerae strains. Addition of 400 μM EZA resulted in a >50% reduction in tcpA::lacZ expression in both E7946 and O395 grown with bicarbonate in the medium (Fig. 5). The effect of EZA was observed in bacteria grown under both static and AKI conditions. In the absence of bicarbonate, EZA had no effect when V. cholerae was cultured under static conditions but caused 50% inhibition of tcpA::lacZ expression when V. cholerae was cultured under AKI conditions, suggesting that the shaking phase of AKI conditions mimics the presence of bicarbonate in static culture. EZA had no detectable effect on V. cholerae growth rates. These data suggest that CA plays an important role in V. cholerae virulence induction by modulating intracellular bicarbonate levels.

FIG. 5.

FIG. 5.

Effects of the CA inhibitor EZA on tcpA::lacZ expression. Gray bars, dimethyl sulfoxide (DMSO) alone added to the growth medium; open bars, EZA dissolved in dimethyl sulfoxide added to the growth medium. (A) β-Galactosidase produced from plasmid-borne tcpA::lacZ in El Tor strain E7946. (B) β-Galactosidase produced from chromosomal tcpA-lacZ in classical strain O395. Statistical significance was determined by Student's t test (*, P < 0.015; **, P < 0.005).

DISCUSSION

Sodium bicarbonate has previously been found to induce CT production in the El Tor biotype of V. cholerae (26, 27), but the mechanism for this induction was unknown. Medrano et al. (39) found that ToxR-dependent toxT transcripts were produced when El Tor biotype V. cholerae was cultured under static conditions in the absence of bicarbonate. However, ToxT activity in terms of increased ctxAB transcription was not detected. These results suggested that the ToxT protein was either present but inactive or not present when the cells were cultured statically in the absence of bicarbonate. Here we have shown that the initial activation of the toxT promoter by ToxR-ToxS and TcpP-TcpH occurs when the bacteria are cultured statically in the presence or absence of bicarbonate. These results are in agreement with previous data showing that transient expression of toxT occurs during the static phase under AKI conditions (39). Moreover, our data indicate that the ToxT protein was present but had minimal activity in both the classical and El Tor biotypes when bacteria were grown in the absence of bicarbonate. Growing the bacteria with bicarbonate in the medium enhances the activity of ToxT, and both CT production and tcpA promoter activation are maximally induced. This bicarbonate-mediated virulence induction is ToxT dependent, as the isogenic toxT deletion strains did not express virulence genes in the presence of bicarbonate.

The V. cholerae in vitro virulence-inducing conditions do not resemble the conditions that V. cholerae encounters in the small intestine. The classical biotype is cultured in LB medium at pH 6.5 and 30°C for maximum virulence gene induction (41). Neither low temperature nor low pH occurs in the upper small intestine that V. cholerae colonizes. The El Tor biotype is cultured in rich medium statically for several hours, followed by shaking for several more hours, for maximal virulence gene induction (26). Again, these conditions are not found in the upper small intestine. The presence of bicarbonate is not required for CT production and tcpA::lacZ expression under AKI conditions, although bicarbonate does increase the amount of CT produced. However, static growth conditions with bicarbonate in the medium might more closely mimic what happens during the course of infection, as V. cholerae is grown at 37°C, with exposure to very low levels of oxygen, and in the presence of bicarbonate, all of which are similar to conditions in the small intestine. Based on the evidence that we obtained regarding the requirement of bicarbonate for maximal ToxT activity and knowing that bicarbonate is present at high concentrations in the small intestine, we propose that V. cholerae utilizes bicarbonate during infection as an effector molecule to induce virulence.

Bicarbonate could also be responsible for the temporal regulation of virulence that has been observed in vivo. Bicarbonate is produced by pancreatic cells and secreted into the lumen of the small intestine to neutralize the acid that comes from the stomach. Lee et al. (32) have observed that during infection tcpA expression is induced in two stages, while ctxAB expression is induced subsequent to the second stage of tcpA induction. On the basis of these results, these authors proposed a model for temporal regulation in which the primary pulse of tcpA expression allows the bacteria to colonize the epithelial lining and in response to a second signal ctxAB expression is induced. Studies have shown that there is a pH gradient in the mucus gel in the human duodenum (45), suggesting that the concentration of bicarbonate is higher close to the epithelial surface, so bicarbonate could be the second signal that stimulates maximum virulence induction.

The following model describes a mechanism for bicarbonate-mediated virulence gene induction and its involvement in temporal regulation patterns (Fig. 6). As the bacteria enter the lumen of the small intestine, they encounter the primary signal, which remains unclear and which induces transcription of toxT. In the lumen, lower levels of pancreatic bicarbonate are present due to diffusion throughout the intestine. The low concentration of bicarbonate produces low levels of ToxT activity, resulting in a low level of tcpA expression. At later stages of infection, the bacteria enter the mucus layer, where they encounter a higher concentration of bicarbonate that is secreted by the epithelial cells. This leads to enhanced ToxT activity and maximal tcpA and CT expression.

FIG. 6.

FIG. 6.

Model for induction of virulence gene expression by bicarbonate in vivo. On the left, motile V. cholerae containing inactive ToxT protein enters the upper small intestine. In the center, V. cholerae in the intestinal lumen encounters bicarbonate, ToxT becomes active, and TCP production begins. On the right, bacteria entering the mucus layer encounter higher levels of bicarbonate, virulence genes are fully induced, and CT production begins. The gradient of increasing bicarbonate levels from the lumen to the mucosal surface is indicated by the triangle on the right.

Bicarbonate has the same effects on ToxT protein activity and virulence gene expression in both the classical and El Tor V. cholerae biotypes. This suggests that the mechanism of bicarbonate-mediated enhancement of ToxT activity is conserved. Bicarbonate could act as a positive effector molecule and directly modulate ToxT protein activity, or it could act indirectly to enhance ToxT function. Recent work on RegA of C. rodentium, which like ToxT shares sequence homology with the AraC/XylS protein family, has shown that bicarbonate stabilizes RegA binding to promoter regions. Addition of bicarbonate in vitro resulted in different migration patterns of RegA-DNA complexes in electrophoretic mobility shift assay (EMSA) experiments (64). ToxT binds to promoter DNA sequences in vitro without bicarbonate (61-63, 66). We tested for a similar direct effect of bicarbonate on ToxT-DNA complexes using EMSA. However, no differences in the binding profiles were observed after addition of bicarbonate to the binding reaction mixtures (data not shown). Although we did not observe direct effects of bicarbonate on ToxT using the EMSA technique, the possibility that bicarbonate directly binds to the ToxT protein and modulates its activity cannot be ruled out. The possible mechanisms for modulation of ToxT activity by bicarbonate include enhancing the binding affinity of ToxT for toxboxes, enhancing the interaction between DNA-bound ToxT monomers, enhancing the interactions between ToxT and RNA polymerase, and some other direct mechanisms. Our data indicating that overexpression of ToxT can compensate for the absence of bicarbonate in the growth medium suggest that bicarbonate may enhance the binding affinity of ToxT for its DNA or protein partners. Thus, an increased ToxT concentration compensates for reduced ToxT binding affinity.

Indirect effects of bicarbonate on ToxT are also possible. Bicarbonate could induce or modulate gene products to enhance the activity of ToxT. Sträter et al. have found that bicarbonate ion activates E. coli aminopeptidase A (PepA) (54). The pepA gene product is a multifunctional protein. It has peptide proteolysis activity (6), acts as a repressor involved in regulation of the carboamoylphosphate synthetase operon (8), and plays a role in site-specific recombination at the ColE1 site, a mechanism that is involved in resolving multimers of multicopy plasmids into monomers to allow stable heredity of the plasmids (52). The X-ray crystallographic structure of PepA indicated that a bicarbonate anion is bound to an arginine side chain (53). Interestingly, deletion of the V. cholerae pepA gene has also been shown to increase the levels of CT, tcpA, toxT, and tcpP when the cells are cultured under ToxR-repressing conditions (LB medium at pH 8.5 and 37°C) (2). One possible indirect effect of bicarbonate is that pepA or other gene products negatively regulate the activity of ToxT and addition of bicarbonate could modify such gene products to relieve this inhibition.

Bacteria can increase cytosolic bicarbonate levels through at least two routes. First, transporters can directly bind to and import bicarbonate. The cmpABCD gene cluster encodes the bicarbonate transport system of Synechococcus elongatus PCC 6301 (35). Proteins with sequence homology to proteins in this system have been shown to play a role in B. anthracis pathogenesis (60). However, BLAST searches of the V. cholerae genome have yielded no sequences having homology to this system. This suggests either that V. cholerae does not utilize transporters to accumulate cellular bicarbonate or that V. cholerae utilizes a different system of transporters to import bicarbonate. Second, both metabolic CO2 and atmospheric CO2 that enter the cell by simple diffusion are converted into bicarbonate by the action of CA. CAs are zinc metalloenzymes that catalyze the hydration of CO2 into bicarbonate. CAs have been shown to be involved in many cellular processes, such as photosynthesis, respiration, CO2 transport, and cyanate metabolism in E. coli (51). CAs are classified into three classes, α, β, and γ, and they share little sequence homology with each other but catalyze the same reaction. V. cholerae encodes one putative CA homolog belonging to each class; the cah gene (VC0395_0957) product belongs to the α class; the putative gene VC0395_A 0118 product belongs to the β class; and the putative VC0395_A2463 product belongs to the γ class. Our data indicate that addition of the CA inhibitor EZA resulted in a >50% reduction in tcpA promoter activity. This suggests that one or more of the putative CAs and/or other CA-like molecules play a role in virulence induction in V. cholerae. Notably, EZA also caused a decrease in virulence gene expression under AKI conditions in the absence of bicarbonate. This finding suggests that the shaking phase of AKI conditions has an effect that is similar to addition of bicarbonate to a static culture and that the induction of virulence gene expression induced by both bicarbonate and AKI conditions is due to increased cytosolic bicarbonate levels mediated by one or more of the V. cholerae CAs.

Culturing V. cholerae under AKI conditions likely mimics the presence of bicarbonate in the medium by increasing the CO2 concentration in the medium. CO2 and HCO3− freely interconvert in solution, so an increase in the CO2 concentration would result in an increase in the bicarbonate concentration. Production of CT has been observed when the El Tor biotype was cultured in the absence of bicarbonate. However, either a shaking period or culturing the bacteria with a low ratio of volume to surface area was required (26, 48). Under these conditions, V. cholerae could produce enough CO2 so that there was an increase in cellular bicarbonate levels. The increase in bicarbonate levels could occur through direct transport of bicarbonate by the bacteria and/or through CO2 uptake and conversion into bicarbonate by CAs. Increasing the cellular bicarbonate level would enhance ToxT activity so that CT was maximally expressed. In the absence of bicarbonate, V. cholerae produces mainly CO2 as a product of metabolism. When the bacteria are grown under static conditions with a small exposed surface area, the amount of CO2 produced by the cells is relatively small as the growth rate is low. CO2 diffuses out of the cells at a rate greater than the rate of conversion into cellular bicarbonate by CA. The low level of bicarbonate produced by CA under these conditions is not sufficient to induce virulence. In contrast, addition of a shaking period or culturing using a large exposed surface area increases the growth rate due to aerobic metabolism, and thus the cells produce more CO2. The higher level of CO2 could increase the cytoplasmic level of bicarbonate, and virulence gene expression would be induced. It has been reported that under anaerobic growth conditions in either classical virulence-inducing medium (classical biotype) (30) or syncase medium (El Tor biotype) (36) TCP expression is observed but CT production is low or nonexistent. This is somewhat similar to the expression patterns that we observed under AKI conditions in the absence of bicarbonate, in which a high level of tcpA expression but a low level of CT production was observed (Fig. 1). Both of these growth conditions may mimic the early stages of infection shown in Fig. 6, in which the bicarbonate concentration is relatively low. A possible mechanism for the observed differential expression of CT and TCP under low-bicarbonate conditions arises from the observation that H-NS is a major negative regulator of ctx transcription (12, 42), whereas H-NS has little or no effect on tcpA transcription (66). When bicarbonate levels are low, a small pool of “activated” ToxT may be blocked from binding to the ctx promoter by H-NS but may bind to the tcpA promoter unhindered and activate its transcription.

In summary, we have found that bicarbonate induces expression of the V. cholerae major virulence factors by enhancing the activity of the ToxT protein that is already present in the bacteria. This is the first example of a positive effector for ToxT activity, and bicarbonate is likely to be an important in vivo signal that induces V. cholerae virulence gene expression during infection.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank members of the Withey and Neely labs for helpful discussions.

This work was supported by Public Health Service grant K22 AI071011 from the National Institutes of Health (to J.H.W.).

Editor: A. Camilli

Footnotes

▿

Published ahead of print on 29 June 2009.

†

Supplemental material for this article may be found at http://iai.asm.org/.

REFERENCES

  • 1.Abe, H., I. Tatsuno, T. Tobe, A. Okutani, and C. Sasakawa. 2002. Bicarbonate ion stimulates the expression of locus of enterocyte effacement-encoded genes in enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 703500-3509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Behari, J., L. Stagon, and S. B. Calderwood. 2001. pepA, a gene mediating pH regulation of virulence genes in Vibrio cholerae. J. Bacteriol. 183178-188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Caparon, M. G., R. T. Geist, J. Perez-Casal, and J. R. Scott. 1992. Environmental regulation of virulence in group A streptococci: transcription of the gene encoding M protein is stimulated by carbon dioxide. J. Bacteriol. 1745693-5701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cash, R. A., S. I. Music, J. P. Libonati, M. J. Snyder, R. P. Wenzel, and R. B. Hornick. 1974. Response of man to infection with Vibrio cholerae. I. Clinical, serologic, and bacteriologic responses to a known inoculum. J. Infect. Dis. 12945-52. [DOI] [PubMed] [Google Scholar]
  • 5.Champion, G. A., M. N. Neely, M. A. Brennan, and V. J. DiRita. 1997. A branch in the ToxR regulatory cascade of Vibrio cholerae revealed by characterization of toxT mutant strains. Mol. Microbiol. 23323-331. [DOI] [PubMed] [Google Scholar]
  • 6.Charlier, D., A. Kholti, N. Huysveld, D. Gigot, D. Maes, T. L. Thia-Toong, and N. Glansdorff. 2000. Mutational analysis of Escherichia coli PepA, a multifunctional DNA-binding aminopeptidase. J. Mol. Biol. 302411-426. [DOI] [PubMed] [Google Scholar]
  • 7.Chatterjee, A., P. K. Dutta, and R. Chowdhury. 2007. Effect of fatty acids and cholesterol present in bile on expression of virulence factors and motility of Vibrio cholerae. Infect. Immun. 751946-1953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Devroede, N., N. Huysveld, and D. Charlier. 2006. Mutational analysis of intervening sequences connecting the binding sites for integration host factor, PepA, PurR, and RNA polymerase in the control region of the Escherichia coli carAB operon, encoding carbamoylphosphate synthase. J. Bacteriol. 1883236-3245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.DiRita, V. J., C. Parsot, G. Jander, and J. J. Mekalanos. 1991. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 885403-5407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Everiss, K. D., K. J. Hughes, and K. M. Peterson. 1994. The accessory colonization factor and toxin-coregulated pilus gene clusters are physically linked on the Vibrio cholerae 0395 chromosome. DNA Seq. 551-55. [DOI] [PubMed] [Google Scholar]
  • 11.Faruque, S. M., M. J. Albert, and J. J. Mekalanos. 1998. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol. Mol. Biol. Rev. 621301-1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ghosh, A., K. Paul, and R. Chowdhury. 2006. Role of the histone-like nucleoid structuring protein in colonization, motility, and bile-dependent repression of virulence gene expression in Vibrio cholerae. Infect. Immun. 743060-3064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gill, D. M. 1976. The arrangement of subunits in cholera toxin. Biochemistry 151242-1248. [DOI] [PubMed] [Google Scholar]
  • 14.Gupta, S., and R. Chowdhury. 1997. Bile affects production of virulence factors and motility of Vibrio cholerae. Infect. Immun. 651131-1134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 1774121-4130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Harkey, C. W., K. D. Everiss, and K. M. Peterson. 1995. Isolation and characterization of a Vibrio cholerae gene (tagA) that encodes a ToxR-regulated lipoprotein. Gene 15381-84. [DOI] [PubMed] [Google Scholar]
  • 17.Harkey, C. W., K. D. Everiss, and K. M. Peterson. 1994. The Vibrio cholerae toxin-coregulated-pilus gene tcpI encodes a homolog of methyl-accepting chemotaxis proteins. Infect. Immun. 622669-2678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hase, C. C., and J. J. Mekalanos. 1998. TcpP protein is a positive regulator of virulence gene expression in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 95730-734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Higgins, D. E., and V. J. DiRita. 1994. Transcriptional control of toxT, a regulatory gene in the ToxR regulon of Vibrio cholerae. Mol. Microbiol. 1417-29. [DOI] [PubMed] [Google Scholar]
  • 20.Higgins, D. E., E. Nazareno, and V. J. DiRita. 1992. The virulence gene activator ToxT from Vibrio cholerae is a member of the AraC family of transcriptional activators. J. Bacteriol. 1746974-6980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hogan, D. L., M. A. Ainsworth, and J. I. Isenberg. 1994. Review article: gastroduodenal bicarbonate secretion. Aliment. Pharmacol. Ther. 8475-488. [DOI] [PubMed] [Google Scholar]
  • 22.Hughes, K. J., K. D. Everiss, M. E. Kovach, and K. M. Peterson. 1995. Isolation and characterization of the Vibrio cholerae acfA gene, required for efficient intestinal colonization. Gene 15659-61. [DOI] [PubMed] [Google Scholar]
  • 23.Hughes, K. J., K. D. Everiss, M. E. Kovach, and K. M. Peterson. 1994. Sequence analysis of the Vibrio cholerae acfD gene reveals the presence of an overlapping reading frame, orfZ, which encodes a protein that shares sequence similarity to the FliA and FliC products of Salmonella. Gene 14679-82. [DOI] [PubMed] [Google Scholar]
  • 24.Hulbert, R. R., and R. K. Taylor. 2002. Mechanism of ToxT-dependent transcriptional activation at the Vibrio cholerae tcpA promoter. J. Bacteriol. 1845533-5544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hung, D. T., and J. J. Mekalanos. 2005. Bile acids induce cholera toxin expression in Vibrio cholerae in a ToxT-independent manner. Proc. Natl. Acad. Sci. USA 1023028-3033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Iwanaga, M., and T. Kuyyakanond. 1987. Large production of cholera toxin by Vibrio cholerae O1 in yeast extract peptone water. J. Clin. Microbiol. 252314-2316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Iwanaga, M., and K. Yamamoto. 1985. New medium for the production of cholera toxin by Vibrio cholerae O1 biotype El Tor. J. Clin. Microbiol. 22405-408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Iwanaga, M., K. Yamamoto, N. Higa, Y. Ichinose, N. Nakasone, and M. Tanabe. 1986. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 301075-1083. [DOI] [PubMed] [Google Scholar]
  • 29.Kirn, T. J., M. J. Lafferty, C. M. Sandoe, and R. K. Taylor. 2000. Delineation of pilin domains required for bacterial association into microcolonies and intestinal colonization by Vibrio cholerae. Mol. Microbiol. 35896-910. [DOI] [PubMed] [Google Scholar]
  • 30.Krishnan, H. H., A. Ghosh, K. Paul, and R. Chowdhury. 2004. Effect of anaerobiosis on expression of virulence factors in Vibrio cholerae. Infect. Immun. 723961-3967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Krukonis, E. S., R. R. Yu, and V. J. Dirita. 2000. The Vibrio cholerae ToxR/TcpP/ToxT virulence cascade: distinct roles for two membrane-localized transcriptional activators on a single promoter. Mol. Microbiol. 3867-84. [DOI] [PubMed] [Google Scholar]
  • 32.Lee, S. H., D. L. Hava, M. K. Waldor, and A. Camilli. 1999. Regulation and temporal expression patterns of Vibrio cholerae virulence genes during infection. Cell 99625-634. [DOI] [PubMed] [Google Scholar]
  • 33.Linn, T., and R. St Pierre. 1990. Improved vector system for constructing transcriptional fusions that ensures independent translation of lacZ. J. Bacteriol. 1721077-1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lonnroth, I., and J. Holmgren. 1973. Subunit structure of cholera toxin. J. Gen. Microbiol. 76417-427. [DOI] [PubMed] [Google Scholar]
  • 35.Maeda, S., G. D. Price, M. R. Badger, C. Enomoto, and T. Omata. 2000. Bicarbonate binding activity of the CmpA protein of the cyanobacterium Synechococcus sp. strain PCC 7942 involved in active transport of bicarbonate. J. Biol. Chem. 27520551-20555. [DOI] [PubMed] [Google Scholar]
  • 36.Marrero, K., A. Sanchez, A. Rodriguez-Ulloa, L. J. Gonzalez, L. Castellanos-Serra, D. Paz-Lago, J. Campos, B. L. Rodriguez, E. Suzarte, T. Ledon, G. Padron, and R. Fando. 2009. Anaerobic growth promotes synthesis of colonization factors encoded at the Vibrio pathogenicity island in Vibrio cholerae El Tor. Res. Microbiol. 16048-56. [DOI] [PubMed] [Google Scholar]
  • 37.Martin, R. G., and J. L. Rosner. 2001. The AraC transcriptional activators. Curr. Opin. Microbiol. 4132-137. [DOI] [PubMed] [Google Scholar]
  • 38.Matson, J. S., J. H. Withey, and V. J. DiRita. 2007. Regulatory networks controlling Vibrio cholerae virulence gene expression. Infect. Immun. 755542-5549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Medrano, A. I., V. J. DiRita, G. Castillo, and J. Sanchez. 1999. Transient transcriptional activation of the Vibrio cholerae El Tor virulence regulator toxT in response to culture conditions. Infect. Immun. 672178-2183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 41.Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 1702575-2583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nye, M. B., J. D. Pfau, K. Skorupski, and R. K. Taylor. 2000. Vibrio cholerae H-NS silences virulence gene expression at multiple steps in the ToxR regulatory cascade. J. Bacteriol. 1824295-4303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Parsot, C., and J. J. Mekalanos. 1991. Expression of the Vibrio cholerae gene encoding aldehyde dehydrogenase is under control of ToxR, the cholera toxin transcriptional activator. J. Bacteriol. 1732842-2851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Prouty, M. G., C. R. Osorio, and K. E. Klose. 2005. Characterization of functional domains of the Vibrio cholerae virulence regulator ToxT. Mol. Microbiol. 581143-1156. [DOI] [PubMed] [Google Scholar]
  • 45.Quigley, E. M., and L. A. Turnberg. 1987. pH of the microclimate lining human gastric and duodenal mucosa in vivo. Studies in control subjects and in duodenal ulcer patients. Gastroenterology 921876-1884. [DOI] [PubMed] [Google Scholar]
  • 46.Reidl, J., and K. E. Klose. 2002. Vibrio cholerae and cholera: out of the water and into the host. FEMS Microbiol. Rev. 26125-139. [DOI] [PubMed] [Google Scholar]
  • 47.Sack, D. A., R. B. Sack, G. B. Nair, and A. K. Siddique. 2004. Cholera. Lancet 363223-233. [DOI] [PubMed] [Google Scholar]
  • 48.Sanchez, J., G. Medina, T. Buhse, J. Holmgren, and G. Soberon-Chavez. 2004. Expression of cholera toxin under non-AKI conditions in Vibrio cholerae El Tor induced by increasing the exposed surface of cultures. J. Bacteriol. 1861355-1361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Schuhmacher, D. A., and K. E. Klose. 1999. Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. J. Bacteriol. 1811508-1514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Skorupski, K., and R. K. Taylor. 1996. Positive selection vectors for allelic exchange. Gene 16947-52. [DOI] [PubMed] [Google Scholar]
  • 51.Smith, K. S., and J. G. Ferry. 2000. Prokaryotic carbonic anhydrases. FEMS Microbiol. Rev. 24335-366. [DOI] [PubMed] [Google Scholar]
  • 52.Stirling, C. J., S. D. Colloms, J. F. Collins, G. Szatmari, and D. J. Sherratt. 1989. xerB, an Escherichia coli gene required for plasmid ColE1 site-specific recombination, is identical to pepA, encoding aminopeptidase A, a protein with substantial similarity to bovine lens leucine aminopeptidase. EMBO J. 81623-1627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Strater, N., D. J. Sherratt, and S. D. Colloms. 1999. X-ray structure of aminopeptidase A from Escherichia coli and a model for the nucleoprotein complex in Xer site-specific recombination. EMBO J. 184513-4522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Sträter, N., L. Sun, E. R. Kantrowitz, and W. N. Lipscomb. 1999. A bicarbonate ion as a general base in the mechanism of peptide hydrolysis by dizinc leucine aminopeptidase. Proc. Natl. Acad. Sci. USA 9611151-11155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Svennerholm, A. M., and J. Holmgren. 1978. Identification of Escherichia coli heat-labile enterotoxin by means of a ganglioside immunosorbent assay (GM-ELISA) procedure. Curr. Microbiol. 119-23. [Google Scholar]
  • 56.Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1986. Identification of a pilus colonization factor that is coordinately regulated with cholera toxin. Ann. Sclavo Collana Monogr. 351-61. [PubMed] [Google Scholar]
  • 57.Taylor, R. K., V. L. Miller, D. B. Furlong, and J. J. Mekalanos. 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin. Proc. Natl. Acad. Sci. USA 842833-2837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Thelin, K. H., and R. K. Taylor. 1996. Toxin-coregulated pilus, but not mannose-sensitive hemagglutinin, is required for colonization by Vibrio cholerae O1 El Tor biotype and O139 strains. Infect. Immun. 642853-2856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Waldor, M. K., and J. J. Mekalanos. 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 2721910-1914. [DOI] [PubMed] [Google Scholar]
  • 60.Wilson, A. C., M. Soyer, J. A. Hoch, and M. Perego. 2008. The bicarbonate transporter is essential for Bacillus anthracis lethality. PLoS Pathog 4e1000210. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 61.Withey, J. H., and V. J. DiRita. 2005. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation. Mol. Microbiol. 561062-1077. [DOI] [PubMed] [Google Scholar]
  • 62.Withey, J. H., and V. J. DiRita. 2006. The toxbox: specific DNA sequence requirements for activation of Vibrio cholerae virulence genes by ToxT. Mol. Microbiol. 591779-1789. [DOI] [PubMed] [Google Scholar]
  • 63.Withey, J. H., and V. J. DiRita. 2005. Vibrio cholerae ToxT independently activates the divergently transcribed aldA and tagA genes. J. Bacteriol. 1877890-7900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Yang, J., E. Hart, M. Tauschek, G. D. Price, E. L. Hartland, R. A. Strugnell, and R. M. Robins-Browne. 2008. Bicarbonate-mediated transcriptional activation of divergent operons by the virulence regulatory protein, RegA, from Citrobacter rodentium. Mol. Microbiol. 68314-327. [DOI] [PubMed] [Google Scholar]
  • 65.Yu, R. R., and V. J. DiRita. 1999. Analysis of an autoregulatory loop controlling ToxT, cholera toxin, and toxin-coregulated pilus production in Vibrio cholerae. J. Bacteriol. 1812584-2592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Yu, R. R., and V. J. DiRita. 2002. Regulation of gene expression in Vibrio cholerae by ToxT involves both antirepression and RNA polymerase stimulation. Mol. Microbiol. 43119-134. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES