Skip to main content
American Journal of Physiology - Renal Physiology logoLink to American Journal of Physiology - Renal Physiology
editorial
. 2009 May 27;297(3):F585–F593. doi: 10.1152/ajprenal.00186.2009

S6 kinase 1 knockout inhibits uninephrectomy- or diabetes-induced renal hypertrophy

Jian-Kang Chen 1, Jianchun Chen 1, George Thomas 2, Sara C Kozma 2, Raymond C Harris 1
PMCID: PMC2739710  PMID: 19474189

Abstract

Removal of one kidney stimulates synthesis of RNA and protein, with minimal DNA replication, in all nephron segments of the remaining kidney, resulting in cell growth (increase in cell size) with minimal cell proliferation (increase in cell number). In addition to the compensatory renal hypertrophy caused by nephron loss, pathophysiological renal hypertrophy can occur as a consequence of early uncontrolled diabetes. However, the molecular mechanism underlying renal hypertrophy in these conditions remains unclear. In the present study, we report that deletion of S6 kinase 1 (S6K1) inhibited renal hypertrophy seen following either contralateral nephrectomy or induction of diabetes. In wild-type mice, hypertrophic stimuli increased phosphorylation of 40S ribosomal protein S6 (rpS6), a known target of S6K1. Immunoblotting analysis revealed that S6K1−/− mice exhibited moderately elevated basal levels of rpS6, which did not increase further in response to the hypertrophic stimuli. Northern blotting indicated a moderate upregulation of S6K2 expression in the kidneys of S6K1−/− mice. Phosphorylation of the eukaryotic translation initiation factor 4E-binding protein 1, another downstream target of the mammalian target of rapamycin (mTOR), was stimulated to equivalent levels in S6K1−/− and S6K1+/+ littermates during renal hypertrophy, indicating that mTOR was still activated in the S6K1−/− mice. The highly selective mTOR inhibitor, rapamycin, inhibited increased phosphorylation of rpS6 and blocked 60–70% of the hypertrophy seen in wild-type mice but failed to prevent the ∼10% hypertrophy seen in S6K1−/− mice in response to uninephrectomy (UNX) although it did inhibit the basal rpS6 phosphorylation. Thus the present study provides the first genetic evidence that S6K1 plays a major role in the development of compensatory renal hypertrophy as well as diabetic renal hypertrophy and indicates that UNX- and diabetes-mediated mTOR activation can selectively activate S6K1 without activating S6K2.

Keywords: compensatory renal hypertrophy, streptozotocin, mammalian target of rapamycin complex 1 signaling, S6 kinases, rapamycin


it has been recognized for more than a century that reduction of functioning nephron number causes the remaining nephrons in the kidney to grow, presumably to augment their work capacity so that normal kidney function can be maintained (36). Such a renal response is characterized by increases in RNA and protein synthesis with minimal alterations in DNA replication, primarily resulting in increases in cell size with minimal changes in cell number (2, 12, 41). This type of growth is known as compensatory renal hypertrophy, differentiated from hyperplasia. In addition, pathological renal hypertrophy occurs in early uncontrolled diabetes that is characterized by increases in protein content and protein/DNA ratio with a transient and minimal increase in DNA replication, thus leading to increased kidney size mainly by cellular hypertrophy, with minimal hyperplasia (20, 39, 41). This type of renal growth is called diabetic renal hypertrophy, which is the earliest structural renal alteration in both type 1 and type 2 diabetes (33, 57). Diabetic renal hypertrophy is then followed by progressive accumulation of extracellular matrix proteins in the mesangium and the interstitium, thickening of glomerular and tubular basement membranes, glomerulosclerosis, and tubulointerstitial fibrosis, resulting in overt diabetic kidney disease, which is the single leading cause of end-stage renal disease worldwide (5, 10, 33, 39, 41, 57). Renal hypertrophy is modulated by a cell cycle-dependent mechanism where cyclin-dependent kinase (CDK) 4/cyclin D is activated without a subsequent engagement of CDK2/cyclin E, a process that has been suggested to be regulated by TGF-β (15, 27, 59) and the CDK inhibitor p27Kip1 (34, 58). The cell cycle is thus arrested in late G1 without progression into S phase, resulting in hypertrophy instead of hyperplasia (15, 19, 27, 28). However, for a cell to grow in size and mass, a positive signal is required to drive increased protein synthesis and/or decreased protein degradation in the cell. In this regard, our recent complementary study indicated that the mammalian target of rapamycin (mTOR) plays an essential role in mediating increased RNA and protein synthesis during compensatory renal hypertrophy (8).

mTOR is a serine/threonine protein kinase that controls protein synthesis, cell growth and metabolism in response to growth factors, nutrients, and energy status in mammalian cells (1, 14, 50). In the cells, mTOR exists in two structurally and functionally distinct multiprotein complexes, mTORC1 and mTORC2 (29, 60). mTORC1 contains G protein β-subunit-like protein (GβL) and raptor (regulatory associated protein of mTOR) (17, 22) and is highly sensitive to rapamycin, which complexes with its intracellular receptor, the FK506-binding protein FKBP12, to exert its inhibitory effect on mTORC1 (7). In contrast, mTORC2 harbors rictor (rapamycin insensitive companion of mTOR) as well as GβL (21, 48) and phosphorylates protein kinase B/Akt (49). mTORC1 functions through multiple downstream effectors in the regulation of protein synthesis and cell size. One major downstream target of mTORC1 is the eukaryotic translation initiation factor (eIF) 4E-binding protein 1 (4E-BP1). mTORC1-dependent phosphorylation of 4E-BP1 releases eIF4E and therefore allows eIF4E to bind the 5′-cap structure of mRNA, thus promoting initiation of cap-dependent de novo translation of various species of mRNA (4, 60). Another downstream effector of mTORC1 involved in protein synthesis and cell growth is the serine/threonine protein kinase p70S6 kinase 1 (S6K1), which phosphorylates the 40S ribosomal protein S6 (rpS6) (18, 23, 60).

Using a mouse model of unilateral nephrectomy (UNX), we have previously demonstrated that UNX increased phosphorylation of both rpS6 and 4E-BP1 and the content of not only 40S and 60S ribosomal subunits but also 80S monosomes and polysomes in the remaining kidney, suggesting mTORC1 activation (8). The selective mTORC1 inhibitor, rapamycin, blocked UNX-increased phosphorylation of both rpS6 and 4E-BP1 and decreased UNX-induced polysome formation and shifted the polysome profile in the direction of monosomes and ribosomal subunits. Of importance, pretreatment of the mice with rapamycin inhibited UNX-induced hypertrophy (8). These pharmacological data suggested that activation of the mTORC1 signaling pathway in the remaining kidney after UNX plays an essential role in modulating RNA and protein synthesis during development of compensatory renal hypertrophy.

Interestingly, recent studies suggest that cell growth and cell cycle progression are separable and distinct processes (13, 14), and increasing evidence indicates that S6K1 plays an important role in regulating both cell growth and organ size (11, 14, 24, 37, 40). Overexpression of S6K1 increased cell size attributable to augmented cell growth but not to delayed cell cycle progression (14). Deletion of S6K1 did not affect myoblast cell proliferation but reduced myoblast cell size to the same extent as that observed with mTOR inhibition by rapamycin (37). In the differentiated state, S6K1-null myotubes had a normal number of nuclei but were significantly smaller, and their hypertrophic response to IGF1, nutrients, and membrane-targeted Akt was blunted (37). Furthermore, homozygous disruption of S6K1 gene in mice did not affect viability or fertility of the mice but significantly reduced the size of the animals compared with their wild-type littermates, a phenotype particularly remarkable in embryos (52). This study resulted in the identification of the S6K1 homolog, S6K2 (52), and subsequent studies demonstrated that mice with homozygous S6K2 deletion tend to be slightly larger, whereas mice lacking both S6K1 and S6K2 genes exhibit a sharp reduction in viability attributable to perinatal lethality (40). Accordingly, in the present study, we examined renal hypertrophy in S6K1 knockout mice. Our results indicate that S6K1, but not S6K2, is the major downstream effector of mTORC1 that medicates renal hypertrophy in response to reduction of functioning nephrons or induction of diabetes.

MATERIALS AND METHODS

Chemicals and antibodies.

Antibodies against S6K1, total rpS6, phospho-rpS6, phospho-Akt, phospho-TSC2, phospho-ERK, total 4E-BP1, and phospho-4E-BP1 were from Cell Signaling Technology (Beverly, MA). Rapamycin was purchased from LC Laboratories (Woburn, MA). Antibodies to β-actin and other chemical reagents were purchased from Sigma-Aldrich (St. Louis, MO).

Animal care and genotyping.

Animals were housed at the Vanderbilt MRBII veterinary facility (MRBII Rm 882). Animal care and all experimental protocols in our studies complied with the regulations of and were approved by Vanderbilt University's Institutional Animal Care and Usage Committee. The S6K1 knockout mice have been characterized previously (52). S6K1 knockouts and their wild-type littermates (used as control mice) were generated by intercrossing the heterozygotes. Two pairs of primers were used for genotyping by PCR: S6K1-pr (Forward: CTATTCTCCCCAGTGAATGGAGG; Reverse: CATGATGGAACAGTCACGCACAC), which was designed to amplify a 703-bp fragment of DNA from the wild-type allele of S6K1 (Fig. 1A) and Neo-pr (Forward: CTTGGGTGGAGAGGCTATTC; Reverse: AGGTGAGATGACAGGAGATC), which was designed to produce a 280-bp band from the Neo-cassette of the homologous recombinant allele of S6K1 (Fig. 1B). PCR were performed at 95°C for 5 min followed by 95°C for 30 s, 60°C for 30 s, and 72°C for 60 s for 30 cycles, with an additional 7-min extension at 72°C. Immunoblotting of an aliquot of the kidney homogenates prepared from these mice confirmed successful deletion of S6 kinase 1 in these mice (Fig. 1C). Because our preliminary study did not reveal a significant difference in the degree of renal hypertrophy developed in S6K1+/− mice vs. their S6K1+/+ littermates (data not shown), only homozygous null (S6K1−/−) mice and their S6K1+/+ littermates (as control mice) were used in the subsequent studies.

Fig. 1.

Fig. 1.

Determination of the genotypes of the offspring derived from S6 kinase 1 (S6K1) heterozygous mice. S6K1+/− mice were intercrossed to generate S6K1 knockout mice as previously described (52). Genotypes of the offspring were determined by PCR as detailed in materials and methods. A: representative data of the genotyping by PCR using the primer set S6K1-pr. The primer sequences of S6K1-pr were indicated in materials and methods; this primer set was expected to produce a 703-bp single band only from wild S6K1 allele. MK, markers of DNA size in base pairs. B: representative data of the genotyping confirmation by PCR using an additional set of PCR primers Neo-pr (see materials and methods for the sequences of these primers). The Neo-pr primer set was designed to produce a 280-bp single band only from the mutant S6K1 allele, which contains the Neo-cassette (52). C: representative immunoblotting data confirming the genotypes determined by PCR using S6K1-pr and Neo-pr. Specifically, whole kidney homogenates from the same animals shown in A and B were immunoblotted with an antibody that recognizes p70S6K1. +/+, +/−, and −/− indicate the genotypes of S6K1 wild-type, heterozygous, and homozygous knockout mice, respectively.

Surgical procedures.

Compensatory renal hypertrophy was induced by right nephrectomy (UNX) as we have previously described (8). S6K1 knockouts (S6K1−/−) and their wild-type littermates (S6K1+/+) at 10 wk of age were utilized. Briefly, under aseptic conditions, UNX was performed through a right flank incision, sparing the adrenal gland, under anesthesia using pentobarbital sodium (50 mg/kg ip). Left kidneys of right sham-nephrectomized (Sham) mice were used as controls for UNX mice. Sham consisted of anesthesia, flank incision, delivery of the right kidney through the incision, and return to the retroperitoneum. Compensatory renal hypertrophy was evaluated after completely removing the fibrous renal capsule along with the surrounding fatty tissues and renal pedicle from left kidney and related mTOR signaling activity determined 7 days after the surgery.

Induction of diabetes in S6K1 knockout mice and their wild-type littermates.

We used the protocol for induction of streptozotocin (STZ)-induced murine diabetes recommended by the Animal Models of Diabetic Complications Consortium (AADCC, available at http://www.amdcc.org). Ten-week-old, male S6K1−/− mice (KO) and S6K1+/+ littermates (WT) were injected daily with STZ (prepared freshly in 0.1 mol/l citrate buffer, pH 4.5 and given at a dose of 50 mg/kg body wt ip) or vehicle alone for 5 consecutive days to induce diabetes. Blood glucose was measured using the OneTouch Basic Blood Glucose Monitoring System (LifeScan, Milpitas, CA) on blood samples obtained via the saphenous vein after a 6-h fast starting at 6:00 AM. Diabetic renal hypertrophy was determined after completely removing the fibrous renal capsules along with the surrounding fatty tissues and renal pedicles from both kidneys and mTOR signaling activity examined 7 days after diabetes.

Immunoblotting analysis.

Immunoblotting procedures were performed as described previously (9). Briefly, left kidneys were decapsulated, and cortices were isolated, cut into pieces, and washed twice with ice-cold PBS, followed by homogenization in a lysis buffer that contained 0.5% Nonidet P-40, 50 mM NaCl, 10 mM Tris·HCl (pH 7.4), 2 mM EDTA, 2 mM EGTA, 0.5% sodium deoxycholate, 0.1% SDS, 100 μM Na3VO4, 100 mM NaF, 30 mM sodium pyrophosphate, 1 mM PMSF, 10 μg/ml aprotinin, and 10 μg/ml leupeptin (9). Renal cortical lysates were clarified at 10,000 g for 15 min at 4°C, and protein concentrations were determined by the Bradford protein assay (Bio-Rad Laboratories, Hercules, CA). Equal amounts of protein were loaded onto 7–15% SDS-PAGE, transferred onto polyvinylidene difluoride membranes, probed with the indicated primary antibody and the appropriate secondary antibody conjugated with biotin, and incubated with preformed avidin-biotin-horseradish peroxidase complex using a commercially available kit (ABC kit; Pierce, Rockford, IL), and the immune complexes were detected by a peroxidase-catalyzed enhanced chemiluminescence detection system (ECL; Amersham Biosciences, Piscataway, NJ).

Measurement of protein/DNA ratios.

Renal cortex (0.08 g per sample) was homogenized in a 1.5-ml lysis buffer that contained 0.02% SDS, 150 mM NaCl, and 15 mM Na citrate, followed by a 10-fold dilution. DNA determination was performed in triplicate as described previously (8, 44). Briefly, aliquots of each homogenate were incubated in a 96-well plate at 37°C for 1 h. After addition of 100 μl of 1.0 μg/ml bisbenzimidazole fluorescent dye Hoechst 33258 (Sigma), the samples were read at excitation λ360 nm, emission λ460 nm using a CytoFluor II spectrofluorometer (PerSeptive Biosystems, Cambridge, MA). Aliquots of the same homogenates were used to determine protein concentration by the Bradford protein assay (Bio-Rad Laboratories). The protein/DNA ratios were calculated, and data were presented as percentage increases compared with sham-operated or vehicle-injected control mice.

RNA isolation and Northern blot hybridization.

Total RNA was isolated from the kidneys of S6K1 knockouts and their wild-type littermates, respectively, using TRI Reagent (Molecular Research Center, Cincinnati, OH). A sample (15 μg) of total RNA was size fractionated by formaldehyde-agarose (1%) gel electrophoresis and transferred onto Nytran nylon membranes (Schleicher & Schuell, Riviera Beach, FL). Radioisotope-labeled probes were prepared, and Northern hybridization was performed essentially as we described previously (9). Briefly, [α-32P]cDNA probes were labeled to a specific activity of >2 × 108 dpm/μg by random priming (Megaprime DNA Labeling System; Amersham Pharmacia Biotech). After overnight hybridization, membranes were washed twice with 2× SSC (0.3 M NaCl and 0.03 M sodium citrate), 0.1% SDS at room temperature for 15 min and 0.2× SSC, 0.1% SDS at 65°C for 30 min. Autoradiography was performed at −80°C by exposing the washed membranes to Hyperfilm (Amersham Pharmacia Biotech) with intensifying screens. To assess the uniformity of RNA loading, blots were stripped and reprobed with a cDNA probe for glyceraldehyde-3-phosphate dehydrogenase labeled with [α-32P]dCTP.

Measurement of blood urea nitrogen.

Seven days after UNX- or STZ-induced diabetes when the mice were euthanized to determine renal hypertrophy and mTOR signaling activity, blood samples were collected and blood urea nitrogen (BUN) levels were immediately measured according to the instruction of the commercially available kit, Liquid Urea Nitrogen Reagent Set (Pointe Scientific, Lincoln Park, MI).

Statistical analyses.

Data are presented as means ± SE for at least three separate experiments (each in triplicate or duplicate). An unpaired t-test was used for statistical analysis, and ANOVA and Bonferroni t-test were used for multiple-group comparisons. P < 0.05 was considered statistically significant.

RESULTS

S6K1 knockout blunted development of compensatory renal hypertrophy in response to UNX.

It is well established that UNX- or diabetes-induced increases in kidney weight are largely attributable to increases in the protein content of cells along the nephron (primarily in the proximal tubule), rather than cell proliferation or increased water content (2, 12, 41, 43, 51). Therefore, the percent increase in kidney weight/body weight ratio compared with sham-operated or vehicle-injected control mice has been used to indicate the degree of renal hypertrophy. In addition, we measured increases in protein/DNA ratio to further confirm that what we observed in the present study was renal hypertrophy, rather than hyperplasia.

Consistent with the initial report of decreased body size in S6K1 knockout mice (52), our results showed that the mean body weight of S6K1 knockout mice was significantly less than that of their wild-type littermates either in the sham-operated group (22.35 ± 0.48 vs. 25.68 ± 0.42 g; P < 0.001) or UNX group (22.21 ± 0.46 vs. 25.58 ± 0.44 g; P < 0.001), respectively (Table 1). Our data also revealed that the mean left kidney weight of S6K1 knockout mice was significantly lower than that of their wild-type littermates in the Sham group (0.141 ± 0.005 vs. 0.122 ± 0.002 g; P < 0.05).

Table 1.

Body weight, left kidney weight, and left kidney/body weight ratio in S6K1+/ + and S6K1−/− mice 7 days after Sham or UNX surgery

Mouse Genotype/Surgery Body Weight, g Left Kidney Weight, g Left Kidney-to-Body Wt. Ratio, % BUN, mg/dl
WT/Sham 25.68±0.42 0.141±0.005 0.549±0.011 31.69±2.58
WT/UNX 25.58±0.44 0.183±0.004b 0.716±0.007d 30.19±2.96
KO/Sham 22.35±0.48a 0.122±0.002c 0.545±0.002 31.57±2.41
KO/UNX 22.21±0.46a 0.134±0.003 0.603±0.005e 31.14±2.70

Values are expressed as means ± SE (n = 6 for each group). There was no statistical difference in the blood urea nitrogen (BUN) levels among the 4 experimental groups (P = NS; n = 6 for each group). S6K1, S6 kinase 1.

a

P < 0.001 knockout (KO)/Sham vs. wild-type (WT)/Sham and KO/uninephrectomized (UNX) vs. WT/UNX;

b

P < 0.001 WT/UNX vs. WT/Sham;

c

P < 0.05 KO/Sham vs. WT/Sham;

d

P < 0.001 WT/UNX vs. WT/Sham;

e

P < 0.001 KO/UNX vs. WT/UNX.

Seven days after right UNX, we observed significant increases in left kidney weight (from 0.141 ± 0.005 to 0.183 ± 0.004 g; P < 0.001) as well as left kidney weight/body weight ratio (from 0.549 ± 0.011% to 0.716 ± 0.007%; P < 0.001) in the S6K1+/+ mice (Table 1). Although the left kidney weight/body weight ratio of S6K1−/− mice was not statistically different from that of their wild-type littermates in the Sham group (0.545 ± 0.002% vs. 0.549 ± 0.011%; P = NS), the left kidney weight/body weight ratio of S6K1−/− mice was significantly lower than that of S6K1+/+ mice in the UNX group (0.603 ± 0.005% vs. 0.716 ± 0.007%; P < 0.001). As shown in Fig. 2A, our experimental data revealed that S6K1 knockout blunted 60–70% of the increases in left kidney weight/body weight ratio in response to right UNX (from 30.49 ± 1.25% down to 10.63 ± 0.83%; P < 0.0001). Such an inhibitory effect of S6K1 deletion on UNX-induced compensatory renal hypertrophy was confirmed by a significant reduction of the increases in protein/DNA ratio in S6K1 knockout mice compared with their wild-type littermates (Fig. 2B).

Fig. 2.

Fig. 2.

S6K1 knockout blunted compensatory renal hypertrophy induced by unilateral nephrectomy (UNX). S6K1−/− mice and their wild-type littermates (S6K1+/+ mice) at 10 wk of age were subjected to right UNX or Sham surgery. UNX-induced compensatory renal hypertrophy 7 days after surgery was assessed by increases in left kidney/body weight ratio (A) and increases in protein/DNA ratio of the kidney (B), compared with their Sham mice, respectively. Values are means ± SE (n = 6 for each group of UNX or Sham; ***P < 0.0001 vs. their corresponding Sham control groups).

S6K1 knockout inhibited the increased rpS6 phosphorylation in the remaining kidney induced by UNX.

Our signaling studies revealed a marked increase in rpS6 phosphorylation in the left kidney of S6K1+/+ mice in response to right UNX compared with their sham-operated S6K1+/+ mice (Fig. 3A). In contrast, UNX did not increase the phosphorylation level of rpS6 in S6K1−/− mice although S6K1−/− mice exhibited a slightly elevated basal level of rpS6 phosphorylation (Fig. 3A). Neither UNX nor S6K1 knockout affected the protein expression level of total rpS6 (Fig. 3B).

Fig. 3.

Fig. 3.

UNX-induced phosphorylation of the 40S ribosomal protein S6 (rpS6) in the remaining kidney of S6K1+/+ mice but not in their S6K1−/− littermates. S6K1−/− mice and their wild-type littermates (S6K1+/+ mice) at 10 wk of age were subjected to right UNX or Sham surgery. One week after surgery, the animals were euthanized, and kidney lysates were subjected to immunoblotting analysis with antibodies specifically recognizing Ser235/236-phosphorylated rpS6 (P-rpS6) (A), total rpS6 (B), all of the total 4E-binding protein 1 (4E-BP1) species, α, β, γ, and δ (C), or Ser65-phosphorylated 4E-BP1 (P-4E-BP1) alone (D), respectively. Note the band shift of the multispecies protein, total 4E-BP1, in response to UNX that indicates activation of mammalian target of rapamycin (C). Equal loading was confirmed by immunoblotting with a β-actin antibody (E). All of the blots shown are representative blots of 3 separate experiments with similar results.

Our previous studies indicated that, in addition to S6K, the other major target of mTOR, 4E-BP1, was also phosphorylated during hypertrophic renal growth (8). Activated mTOR phosphorylates 4E-BP1 at multiple sites in a characteristically hierarchical manner (16, 42). Hyperphosphorylated 4E-BP1 dissociates from and consequently activates eIF4E, the translation initiation factor that binds the 5′-cap structure of mRNA and regulates cap-dependent translation (16, 42). 4E-BP1 bands in SDS-PAGE are denoted α, β, γ, and δ, representing different phosphorylation states (16, 42).

Consistent with the previous study (8), UNX induced 4E-BP1 band shift to species of higher apparent relative molecular mass, suggesting increases in 4E-BP1 phosphorylation (Fig. 3C). Of interest, S6K1 knockout did not affect 4E-BP1 phosphorylation-induced band shift in response to UNX (Fig. 3C). As shown in Fig. 3D, additional immunoblotting experiments with a phosphospecific antibody to 4E-BP1 confirmed that, in both S6K1−/− mice and their S6K1+/+ littermates, UNX stimulated equivalent increases in 4E-BP1 phosphorylation at Ser65, a well-established rapamycin-sensitive phosphorylation site (16, 42). These data indicate that mTOR is activated to a similar degree in both wild-type and S6K1 knockout mice in response to UNX.

S6K1 knockout upregulated S6K2 gene expression in the kidney.

In cells, rpS6 can also be phosphorylated by S6K2 in addition to S6K1 (3, 38, 52). S6K2 mRNA levels have been shown to be upregulated in the liver, muscle, thymus, and brain from S6K1−/− mice (52). In the present study, Northern blotting analysis using an S6K2-specific cDNA probe revealed moderate upregulation of S6K2 gene expression in the kidneys of S6K1−/− mice (Fig. 4A), which was statistically significant by densitometric analysis (Fig. 4B).

Fig. 4.

Fig. 4.

S6K1 knockout upregulated the expression of S6K2 in the kidney. S6K1−/− mice and S6K1+/+ mice at 10 wk of age were euthanized, and total kidney RNA was isolated. The mRNA expression level of S6K2 was determined by Northern blot analysis. To ensure equal RNA loading, the blots were stripped and reprobed with a cDNA probe for GAPDH (A). Shown are representative data from n of 6 for each genotype. Upregulation of S6K2 expression in response to S6K1 knockout was quantitatively confirmed to be statistically significant by densitometric analysis. Densitometric values are expressed as ratios of S6K2/GAPDH densitometry quantification (B). n = 6; **P < 0.005 vs. their wild-type littermates.

Rapamycin inhibited the phosphorylation of 4E-BP1 and rpS6.

We found that the mTORC1 inhibitor, rapamycin, prevented UNX-induced rpS6 phosphorylation in wild-type mice littermates and abolished the slightly elevated basal levels of rpS6 phosphorylation in S6K1−/− mice (Fig. 5A). Thus upregulation of S6K2 gene expression might explain the slightly elevated basal level of rpS6 phosphorylation in S6K1−/− mice, compared with their wild-type littermates. Rapamycin also inhibited the increased phosphorylation of 4E-BP1 at Ser65 in both wild-type and S6K1 knockout mice (Fig. 5B).

Fig. 5.

Fig. 5.

Rapamycin (Rapa) inhibition of UNX-induced phosphorylation of rpS6 and 4E-BP1. S6K1−/− mice and their S6K1+/+ littermates at 10 wk of age were administered either rapamycin (1 mg/kg body wt ip) or vehicle (Veh) alone for 2 h before right UNX or Sham surgery, followed by administration of rapamycin or vehicle once a day. The animals were euthanized 7 days after surgery, and left kidney homogenates were subjected to immunoblotting analysis with an antibody that recognizes only Ser235/236-phosphorylated rpS6 (A) and an antibody specifically recognizing 4E-BP1 that was phosphorylated at serine 65 (B). Equal loading was confirmed by stripping and reprobing of the blot with a β-actin antibody (C). Each lane sample was from pooled kidney lysates of 3 mice in the same group (thus two lanes represent a total n of 6 animals for each group). Shown are representative blots from 1 of 3 separate experiments with similar results.

Rapamycin had no effect on the renal hypertrophy in S6K1−/− mice in response to UNX.

Deletion of S6K1 did not completely prevent the development of compensatory renal hypertrophy in response to UNX, as shown in Fig. 2, and mTOR was still activated in the remaining kidneys of S6K1−/− mice 7 days after removal of contralateral kidney, as revealed by increases in 4E-BP1 phosphorylation (Figs. 3 and 5). Accordingly, we examined whether preventing mTOR activation in S6K1−/− mice could block the residual renal hypertrophy developed in the knockout mice.

As shown in Table 2, we observed that daily administration of rapamycin for 7 successive days (with the first injection being 2 h before the surgery) following UNX significantly reduced the absolute kidney weight and kidney weight/body weight ratio of S6K1+/+ mice compared with the vehicle-treated S6K1+/+ group. In addition, the rapamycin treatment markedly reduced UNX-induced increases in kidney weight/body weight ratio (from 30.4 ± 1.3% to 9.5 ± 0.8%; P < 0.0001), equivalent to an ∼70% reduction, and also inhibited UNX-induced increases in protein/DNA ratio in the S6K1+/+ mice (Fig. 6B); in contrast, rapamycin had no significant effect on the kidney weight/body weight ratio (Table 2 and Fig. 6A) or protein/DNA ratio in S6K1−/− mice (Fig. 6B). These data confirmed our previous studies indicating a rapamycin-insensitive pathway that mediates approximately one-third of the renal hypertrophy induced by UNX.

Table 2.

Rapamycin inhibited UNX-induced compensatory renal hypertrophy in S6K1+/+ mice but not in S6K1−/− mice

Genotype/Surgery/Treatment Body Weight, g Left Kidney Weight, g Left Kidney-to-Body Wt. Ratio, % BUN, mg/dl
WT/Sham/Veh 25.75±0.45 0.142±0.004 0.552±0.006 N.M.
WT/UNX/Veh 25.47±0.68 0.183±0.006b 0.719±0.007d N.M.
WT/Sham/Rapa 25.43±0.52 0.139±0.003 0.546±0.002 31.29±2.88
WT/UNX/Rapa 24.94±0.41 0.149±0.002b 0.598±0.005d 30.19±2.63
KO/Sham/Veh 22.33±0.46a 0.123±0.003c 0.549±0.005 N.M.
KO/UNX/Veh 21.85±0.45a 0.132±0.003 0.606±0.005e N.M.
KO/Sham/Rapa 21.74±0.47a 0.119±0.004 0.547±0.009 31.04±2.39
KO/UNX/Rapa 21.60±0.39a 0.129±0.003 0.599±0.004f 31.63±2.96

Values are expressed as means ± SE (n = 6 for each group). There was no statistical difference in the BUN levels among the various experimental groups tested (P = NS; n = 6 for each group). NM, not measured.

a

P < 0.001 vs. their WT groups with the same treatments, respectively;

b

P < 0.001 WT/UNX/vehicle (Veh) vs. WT/Sham/Veh and WT/UNX/rapamycin (Rapa) vs. WT/UNX/Veh;

c

P < 0.01 KO/Sham/Veh vs. WT/Sham/Veh;

d

P < 0.001 WT/UNX/Veh vs. WT/Sham/Veh and WT/UNX/Rapa vs. WT/UNX/Veh;

e

P < 0.001 KO/UNX/Veh vs. KO/Sham/Veh.

f

P < 0.001 KO/UNX/Rapa vs. KO/Sham/Rapa.

Fig. 6.

Fig. 6.

Inhibition of rapamycin on UNX-induced compensatory renal hypertrophy in S6K1+/+ mice but not in S6K1−/− littermates. Male, 10-wk-old S6K1+/+ mice and their S6K1−/− littermates were pretreated with rapamycin (1 mg/kg body wt ip) or vehicle alone for 2 h before right UNX or Sham surgery, followed by administration of rapamycin or vehicle once a day. Seven days after the surgery, UNX-induced compensatory renal hypertrophy was assessed by increases in kidney/body weight ratios (A) as well as increases in protein/DNA ratios (B), compared with Sham-operated/vehicle-treated mice. Values in both A and B are means ± SE [n = 6 for each group; ***P < 0.001 vs. the increases in kidney/body weight ratios (A) or protein/DNA ratios (B) of vehicle-treated S6K1+/+ mice]. The increases in kidney/body weight ratios and protein/DNA ratios did not show significant statistical difference among rapamycin-treated S6K1+/+ mice, vehicle-treated S6K1−/− mice, and rapamycin-treated S6K1−/− mice.

S6K1 knockout had no significant effect on hyperglycemia but inhibited kidney hypertrophy in STZ-induced diabetes.

It is well known that diabetes can also induce renal hypertrophy with minimal hyperplasia as the earliest structural renal alteration in both type 1 and type 2 diabetes (10, 39, 41, 57). To determine whether S6K1 is also involved in diabetic renal hypertrophy, we induced diabetes with STZ. As indicated in Fig. 7A, there was no statistical difference in the development of hyperglycemia in response to STZ injections in wild-type vs. S6K1 knockout mice.

Fig. 7.

Fig. 7.

S6K1 knockout had no significant effect on hyperglycemia but inhibited kidney hypertrophy in streptozotocin (STZ)-induced diabetes. A: S6K1 knockout did not affect the development of hyperglycemia in response to STZ injection. Male, 10-wk-old S6K1−/− mice and S6K1+/+ littermates were injected daily with STZ or vehicle (0.1 M citrate buffer, pH 4.5) alone for 5 consecutive days, and fasting blood glucose was measured as described in materials and methods. Ten days after completion of the STZ injections, which was equivalent to 7 days after diabetes, the animals were euthanized for the assessment of renal hypertrophy by increases in kidney/body weight ratios (B) as well as increases in protein/DNA ratios (C), compared with their respective mice injected with vehicle alone. Values are means ± SE. (n of 6 for each group; ***P <0.001 vs. S6K1+/+ mice).

As shown in Table 3, 7 days after diabetes, the mean two-kidney weight of S6K1+/+ mice was significantly higher than that of their nondiabetic S6K1+/+ control group (0.360 ± 0.010 vs. 0.284 ± 0.008 g; P < 0.001), with a marked increase in their two-kidney weight/body weight ratios (1.102 ± 0.013% to 1.416 ± 0.016%; P < 0.001). The mean kidney/body weight ratio of diabetic S6K1+/+ control group was significantly less than that of diabetic S6K1−/− mice (1.416 ± 0.016 vs. 1.205 ± 0.012%; P < 0.001). This inhibitory effect of S6K1 deletion on diabetic renal hypertrophy was confirmed by measuring diabetes-induced increases in kidney/body weight ratio and protein/DNA ratio (Fig. 7, B and C).

Table 3.

Body weight, two kidney weight, and two kidneys-to-body weight ratio in S6K1+/+ and S6K1−/− mice 7 days after STZ-induced diabetes

Mouse Genotype/Treatment Body Weight, g Weight of Two Kidneys, g Two Kidneys-to-Body Wt. Ratio, % BUN, mg/dl
WT/Vehicle Control 25.73±0.52 0.284±0.008 1.102±0.013 30.96±2.74
WT/STZ-Diabetes 25.43±0.45 0.360±0.010b 1.416±0.016d 30.01±2.63
KO/Vehicle Control 22.42±0.54a 0.246±0.004c 1.097±0.015 31.11±2.85
KO/STZ-Diabetes 22.06±0.47a 0.266±0.005b 1.205±0.012e,f 30.40±3.08

Values are means ± SE (n = 6 for each group). No statistical difference was seen in their BUN levels among the 4 experimental groups (P = NS; n = 6 for each group).

a

P < 0.001 KO/Vehicle-Control vs. WT/Vehicle-Control and KO/streptozotocin (STZ)-Diabetes vs. WT/STZ-Diabetes;

b

P < 0.001 WT/STZ-Diabetes vs. WT/Vehicle-Control;

c

P < 0.01 KO/Vehicle-Control vs. WT/Vehicle-Control;

d

P < 0.001 WT/STZ-Diabetes vs. WT/Vehicle-Control;

e

P < 0.001 KO/STZ-Diabetes vs. WT/STZ-Diabetes;

f

P < 0.001 KO/STZ-Diabetes vs. KO/Vehicle-Control.

Diabetes stimulated rpS6 phosphorylation in S6K1+/+ mice but not in S6K1−/− mice.

After 1 wk of STZ-induced diabetes in S6K1+/+ and S6K1−/− mice, the mTOR-S6K1-rpS6 signaling activity in their kidneys was determined by immunoblotting analysis. Similar to what we observed in compensatory hypertrophy following UNX, in the diabetic kidneys, we observed a marked increase in the phosphorylation level of rpS6 in the kidneys of S6K1+/+ mice but not in the kidneys of S6K1−/− mice (Fig. 8A), whereas 4E-BP1 phosphorylation was not different between wild-type and S6K1 knockout mice (Fig. 8, C and D), indicating that diabetes also activated mTOR in S6K1−/− mice as well as in their wild-type littermates. These signaling data along with the results shown in Fig. 7 and Table 3 suggest that activation of the mTOR-S6K1-rpS6 signaling pathway also plays a major role in mediating diabetic renal hypertrophy.

Fig. 8.

Fig. 8.

Diabetes stimulated rpS6 phosphorylation in S6K1+/+ mice but not in S6K1−/− mice. Samples from the kidneys described in Fig. 7 were subjected to immunoblotting analysis with an antibody specific for Ser235/236-phosphorylated rpS6 (A), followed by stripping and reprobing with antibody against total rpS6 (B). Another aliquot of the samples was immunoblotted with an antibody that recognizes the α, β, γ, and δ species of total 4E-BP1 (C) or an antibody specifically recognizing serine 65-phosphorylated 4E-BP1 (D). Equal loading was confirmed by immunoblotting with a β-actin antibody (E). Shown are representative blots from 1 of 3 separate experiments with similar results.

As indicated in Tables 1–3, we did not observe any statistical differences in BUN levels among the various experimental groups tested.

DISCUSSION

The molecular mechanisms underlying initiation of renal hypertrophy in response to reduction of functioning nephrons or poorly controlled diabetes are fundamental to understanding the biology of the kidney. Recent studies by us and others have indicated increased mTOR activation during renal hypertrophy in response to UNX (8) or diabetes (47), and a more recent study has demonstrated a role for the mTOR regulator, AMP-activated protein kinase, in diabetes-induced renal hypertrophy (26). However, previous studies did not determine the relative contribution of the mTOR-S6K1 pathway in renal hypertrophy. In the present study, we demonstrate that deletion of S6K1 resulted in ∼70% inhibition of the renal hypertrophy seen following contralateral nephrectomy or induction of STZ-induced diabetes. Our present study represents the first demonstration that activation of the mTOR-S6K1 pathway is a common major mechanism mediating hypertrophic renal growth in both UNX and diabetic mouse models.

The regulatory role of the S6K signaling pathway in control of cell size has been demonstrated in both Drosophila and knockout mouse lines (35, 37, 40). Drosophila expresses only one form of S6K, and loss of the Drosophila S6K gene is semilethal, with the survived adults being dramatically smaller because of decreased cell size but not cell number (35). In contrast, mammals express two genes encoding homologous S6Ks, S6K1 and S6K2 (52). Mice deficient for either S6K1 or S6K2 are born at the expected Mendelian ratio but, in contrast to S6K1 knockouts, S6K2-null mice tend to be slightly larger compared with their wild-type littermates (40). S6K1 and S6K2 are ∼80% homologous and contain similar phosphorylation sites (52). However, some studies suggest that S6K1 and S6K2 respond to signaling pathways similarly (11, 38), whereas other studies have indicated differential sensitivities of S6K1 and S6K2 to particular signaling inputs (25, 30, 55). Because of the relatively recent discovery of S6K2, phosphospecific antibodies are presently unavailable to examine whether mTOR differentially mediates S6K2 phosphorylation and function. In the present study, we observed a moderate upregulation of S6K2 expression in the kidney of S6K1-null mice, which may explain the moderate elevation of basal rpS6 phosphorylation. Our data strongly support that S6K1, but not S6K2, is the major mediator of the increased rpS6 phosphorylation in response to hypertrophic stimuli. Further studies utilizing S6K2 knockout mice, which survive through adulthood (40), will help us to further delineate the specific contributions of the different S6 kinases and understand why only S6K1 but not S6K2 is activated during compensatory renal hypertrophy.

A recent study using a knockin mouse model carrying mutations at all phosphorylation sites of rpS6 demonstrated that rpS6 phosphorylation plays a critical role in regulation of cell size (46). The present study also supports a role for rpS6 phosphorylation in control of kidney-to-body weight ratio. However, we cannot rule out the contribution of other downstream effectors of S6K1 because other S6K1 substrates have also been reported. For example, S6K1 can phosphorylate the eukaryotic elongation factor 2 kinase at Ser366 to enhance protein synthesis (56). Of interest, the cell growth regulator S6K1 Aly/REF-like target has also been identified as a substrate for S6K1, but not for S6K2 (45).

Rapamycin inhibited mTOR-S6K1 signaling and repressed cardiac hypertrophy (31, 53), yet, in cardiac-specific transgenic mouse models, overexpression of S6K2 had no apparent cardiac phenotype, whereas overexpression of S6K1 induced a modest degree of cardiac hypertrophy; in contrast, deletion of either S6K1 or S6K2 had no significant effect on the development of physiological or pathological cardiac hypertrophy (32). Moreover, cardiac hypertrophy appears to be mediated by activation of the class IA phosphoinositide 3-kinase (PI3K)-PKB (also known as Akt) signaling pathway (6). However, our intensive in vivo studies in mice have revealed that UNX does not alter the signaling activity of PI3K-Akt pathway in the remaining kidney undergoing compensatory renal hypertrophy (J.-K. Chen and R. C. Harris, unpublished data). Therefore, our studies suggest that the molecular mechanism regulating compensatory renal hypertrophy may not be identical to that of cardiac hypertrophy.

Of note, phosphorylation of 4E-BP1, another downstream target of mTOR, was stimulated to equivalent levels in S6K1-null mice in response to UNX or diabetes, indicating that mTOR was still activated in the S6K1-null mice. However, our data cannot rule out a potential requirement of 4E-BP1 in concert with S6K1 in the development of hypertrophic renal growth. Since 4E-BP1 knockout mice are viable and fertile with normal life span (54), future studies utilizing 4E-BP1 knockout mice should allow us to address the importance of 4E-BP1 in hypertrophic renal growth.

In summary, the present study provides the first definitive genetic evidence that activation of mTORC1-S6K1 pathway is a major molecular signaling mechanism underlying the major fraction of renal hypertrophy. We also determined that renal ablation increased S6K1-medicated, but not S6K2-mediated, rpS6 phosphorylation in the remaining kidney, indicating for the first time that, during compensatory renal hypertrophy, mTORC1 activation can selectively activate S6K1 without activating S6K2. Furthermore, rapamycin failed to inhibit the residual renal hypertrophy in S6K1-null mice although it did completely block mTORC1 activity and thereby prevented increases in 4E-BP1 phosphorylation levels in the remaining kidney of S6K1-null mice in response to UNX. Thus our study also revealed a rapamycin-insensitive mechanism that mediates a minor portion of renal hypertrophy.

GRANTS

This work was supported by funds from American Heart Association Scientist Development Grant 0630274N and a Vanderbilt Diabetes Research and Training Center Pilot and Feasibility Grant 2P60DK020593 (to J.-K. Chen), National Institutes of Health Grants DK73802 and DK078019 (to G. Thomas), Juvenile Diabetes Research Foundation Regular Research Grant 115915 (to S. C. Kozma), and a VA Merit Award and National Institutes of Health Grants DK62794 and DK51265 (to R. C. Harris).

REFERENCES

  • 1.Abraham RT, Eng CH. Mammalian target of rapamycin as a therapeutic target in oncology. Expert Opin Ther Targets 12: 209–222, 2008. [DOI] [PubMed] [Google Scholar]
  • 2.Brenner BM Remission of renal disease: recounting the challenge, acquiring the goal. J Clin Invest 110: 1753–1758, 2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brown EJ, Beal PA, Keith CT, Chen J, Shin TB, Schreiber SL. Control of p70 s6 kinase by kinase activity of FRAP in vivo. Nature 377: 441–446, 1995. [DOI] [PubMed] [Google Scholar]
  • 4.Brunn GJ, Hudson CC, Sekulic A, Williams JM, Hosoi H, Houghton PJ, Lawrence JC Jr, Abraham RT. Phosphorylation of the translational repressor PHAS-I by the mammalian target of rapamycin. Science 277: 99–101, 1997. [DOI] [PubMed] [Google Scholar]
  • 5.Caramori ML, Mauer M. Diabetes and nephropathy. Curr Opin Nephrol Hypertens 12: 273–282, 2003. [DOI] [PubMed] [Google Scholar]
  • 6.Catalucci D, Latronico MV, Ellingsen O, Condorelli G. Physiological myocardial hypertrophy: how and why? Front Biosci 13: 312–324, 2008. [DOI] [PubMed] [Google Scholar]
  • 7.Chen J, Zheng XF, Brown EJ, Schreiber SL. Identification of an 11-kDa FKBP12-rapamycin-binding domain within the 289-kDa FKBP12-rapamycin-associated protein and characterization of a critical serine residue. Proc Natl Acad Sci USA 92: 4947–4951, 1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chen JK, Chen J, Neilson EG, Harris RC. Role of mammalian target of rapamycin signaling in compensatory renal hypertrophy. J Am Soc Nephrol 16: 1384–1391, 2005. [DOI] [PubMed] [Google Scholar]
  • 9.Chen JK, Falck JR, Reddy KM, Capdevila J, Harris RC. Epoxyeicosatrienoic acids and their sulfonimide derivatives stimulate tyrosine phosphorylation and induce mitogenesis in renal epithelial cells. J Biol Chem 273: 29254–29261, 1998. [DOI] [PubMed] [Google Scholar]
  • 10.Drummond K, Mauer M. The early natural history of nephropathy in type 1 diabetes. II. Early renal structural changes in type 1 diabetes. Diabetes 51: 1580–1587, 2002. [DOI] [PubMed] [Google Scholar]
  • 11.Dufner A, Thomas G. Ribosomal S6 kinase signaling and the control of translation. Exp Cell Res 253: 100–109, 1999. [DOI] [PubMed] [Google Scholar]
  • 12.Fine LG, Norman J. Cellular events in renal hypertrophy. Annu Rev Physiol 51: 19–32, 1989. [DOI] [PubMed] [Google Scholar]
  • 13.Fingar DC, Blenis J. Target of rapamycin (TOR): an integrator of nutrient and growth factor signals and coordinator of cell growth and cell cycle progression. Oncogene 23: 3151–3171, 2004. [DOI] [PubMed] [Google Scholar]
  • 14.Fingar DC, Salama S, Tsou C, Harlow E, Blenis J. Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Genes Dev 16: 1472–1487, 2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Franch HA, Shay JW, Alpern RJ, Preisig PA. Involvement of pRB family in TGF beta-dependent epithelial cell hypertrophy. J Cell Biol 129: 245–254, 1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gingras AC, Raught B, Sonenberg N. mTOR signaling to translation. Curr Top Microbiol Immunol 279: 169–197, 2004. [DOI] [PubMed] [Google Scholar]
  • 17.Hara K, Maruki Y, Long X, Yoshino K, Oshiro N, Hidayat S, Tokunaga C, Avruch J, Yonezawa K. Raptor, a binding partner of target of rapamycin (TOR), mediates TOR action. Cell 110: 177–189, 2002. [DOI] [PubMed] [Google Scholar]
  • 18.Hershey JWB, Merrick WC. Pathway and mechanism of initiation of protein synthesis. In: Translational Control of Gene Expression, edited by Sonenberg N, Hershey JWB, and Mathews MB. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory, 2000, p. 33–88.
  • 19.Huang HC, Preisig PA. G1 kinases and transforming growth factor-beta signaling are associated with a growth pattern switch in diabetes-induced renal growth. Kidney Int 58: 162–172, 2000. [DOI] [PubMed] [Google Scholar]
  • 20.Ibrahim HN, Hostetter TH. Diabetic nephropathy. J Am Soc Nephrol 8: 487–493, 1997. [DOI] [PubMed] [Google Scholar]
  • 21.Jacinto E, Loewith R, Schmidt A, Lin S, Ruegg MA, Hall A, Hall MN. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6: 1122–1128, 2004. [DOI] [PubMed] [Google Scholar]
  • 22.Kim DH, Sarbassov DD, Ali SM, King JE, Latek RR, Erdjument-Bromage H, Tempst P, Sabatini DM. mTOR interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell 110: 163–175, 2002. [DOI] [PubMed] [Google Scholar]
  • 23.Kozma SC, Thomas G. Regulation of cell size in growth, development and human disease: PI3K, PKB and S6K. Bioessays 24: 65–71, 2002. [DOI] [PubMed] [Google Scholar]
  • 24.Kwon CH, Zhu X, Zhang J, Baker SJ. mTor is required for hypertrophy of Pten-deficient neuronal soma in vivo. Proc Natl Acad Sci USA 100: 12923–12928, 2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lee-Fruman KK, Kuo CJ, Lippincott J, Terada N, Blenis J. Characterization of S6K2, a novel kinase homologous to S6K1. Oncogene 18: 5108–5114, 1999. [DOI] [PubMed] [Google Scholar]
  • 26.Lee MJ, Feliers D, Mariappan MM, Sataranatarajan K, Mahimainathan L, Musi N, Foretz M, Viollet B, Weinberg JM, Choudhury GG, Kasinath BS. A role for AMP-activated protein kinase in diabetes-induced renal hypertrophy. Am J Physiol Renal Physiol 292: F617–F627, 2007. [DOI] [PubMed] [Google Scholar]
  • 27.Liu B, Preisig P. TGF-β1-mediated hypertrophy involves inhibiting pRB phosphorylation by blocking activation of cyclin E kinase. Am J Physiol Renal Physiol 277: F186–F194, 1999. [DOI] [PubMed] [Google Scholar]
  • 28.Liu B, Preisig PA. Compensatory renal hypertrophy is mediated by a cell cycle-dependent mechanism. Kidney Int 62: 1650–1658, 2002. [DOI] [PubMed] [Google Scholar]
  • 29.Martin DE, Hall MN. The expanding TOR signaling network. Curr Opin Cell Biol 17: 158–166, 2005. [DOI] [PubMed] [Google Scholar]
  • 30.Martin KA, Schalm SS, Richardson C, Romanelli A, Keon KL, Blenis J. Regulation of ribosomal S6 kinase 2 by effectors of the phosphoinositide 3-kinase pathway. J Biol Chem 276: 7884–7891, 2001. [DOI] [PubMed] [Google Scholar]
  • 31.McMullen JR, Sherwood MC, Tarnavski O, Zhang L, Dorfman AL, Shioi T, Izumo S. Inhibition of mTOR signaling with rapamycin regresses established cardiac hypertrophy induced by pressure overload. Circulation 109: 3050–3055, 2004. [DOI] [PubMed] [Google Scholar]
  • 32.McMullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Dorfman AL, Longnus S, Pende M, Martin KA, Blenis J, Thomas G, Izumo S. Deletion of ribosomal S6 kinases does not attenuate pathological, physiological, or insulin-like growth factor 1 receptor-phosphoinositide 3-kinase-induced cardiac hypertrophy. Mol Cell Biol 24: 6231–6240, 2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mogensen CE, Andersen MJ. Increased kidney size and glomerular filtration rate in early juvenile diabetes. Diabetes 22: 706–712, 1973. [DOI] [PubMed] [Google Scholar]
  • 34.Monkawa T, Hiromura K, Wolf G, Shankland SJ. The hypertrophic effect of transforming growth factor-beta is reduced in the absence of cyclin-dependent kinase-inhibitors p21 and p27. J Am Soc Nephrol 13: 1172–1178, 2002. [DOI] [PubMed] [Google Scholar]
  • 35.Montagne J, Stewart MJ, Stocker H, Hafen E, Kozma SC, Thomas G. Drosophila S6 kinase: a regulator of cell size. Science 285: 2126–2129, 1999. [DOI] [PubMed] [Google Scholar]
  • 36.Nowinski WW Early history of renal hypertrophy. In: Compensatory Renal Hypertrophy, edited by Nowinski WW and Goss RJ. New York and London: Scademic, 1969, p. 1–8.
  • 37.Ohanna M, Sobering AK, Lapointe T, Lorenzo L, Praud C, Petroulakis E, Sonenberg N, Kelly PA, Sotiropoulos A, Pende M. Atrophy of S6K1(−/−) skeletal muscle cells reveals distinct mTOR effectors for cell cycle and size control. Nat Cell Biol 7: 286–294, 2005. [DOI] [PubMed] [Google Scholar]
  • 38.Park IH, Bachmann R, Shirazi H, Chen J. Regulation of ribosomal S6 kinase 2 by mammalian target of rapamycin. J Biol Chem 277: 31423–31429, 2002. [DOI] [PubMed] [Google Scholar]
  • 39.Parving HH, Mauer M, Ritz E. Diabetic nephropathy. In: The Kidney, edited by Brenner BM. Philadelphia: WB Saunders, 2004, p. 1777–1805.
  • 40.Pende M, Um SH, Mieulet V, Sticker M, Goss VL, Mestan J, Mueller M, Fumagalli S, Kozma SC, Thomas G. S6K1(−/−)/S6K2(−/−) mice exhibit perinatal lethality and rapamycin-sensitive 5′-terminal oligopyrimidine mRNA translation and reveal a mitogen-activated protein kinase-dependent S6 kinase pathway. Mol Cell Biol 24: 3112–3124, 2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Preisig PA Renal hypertrophy and hyperplasia. In: The Kidney, edited by Selden DW, Giebisch G. Philadelphia: Lippincott Williams & Wilkins, 2000, p. 727–748.
  • 42.Proud CG Control of the translational machinery in mammalian cells. Eur J Biochem 269: 5337, 2002. [DOI] [PubMed] [Google Scholar]
  • 43.Rabkin R, Shechter P, Shi JD, Boner G. Protein turnover in the hypertrophying kidney. Miner Electrolyte Metab 22: 153–156, 1996. [PubMed] [Google Scholar]
  • 44.Rao J, Otto WR. Fluorimetric DNA assay for cell growth estimation. Anal Biochem 207: 186–192, 1992. [DOI] [PubMed] [Google Scholar]
  • 45.Richardson CJ, Broenstrup M, Fingar DC, Julich K, Ballif BA, Gygi S, Blenis J. SKAR is a specific target of S6 kinase 1 in cell growth control. Curr Biol 14: 1540–1549, 2004. [DOI] [PubMed] [Google Scholar]
  • 46.Ruvinsky I, Sharon N, Lerer T, Cohen H, Stolovich-Rain M, Nir T, Dor Y, Zisman P, Meyuhas O. Ribosomal protein S6 phosphorylation is a determinant of cell size and glucose homeostasis. Genes Dev 19: 2199–2211, 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sakaguchi M, Isono M, Isshiki K, Sugimoto T, Koya D, Kashiwagi A. Inhibition of mTOR signaling with rapamycin attenuates renal hypertrophy in the early diabetic mice. Biochem Biophys Res Commun 340: 296–301, 2006. [DOI] [PubMed] [Google Scholar]
  • 48.Sarbassov DD, Ali SM, Kim DH, Guertin DA, Latek RR, Erdjument-Bromage H, Tempst P, Sabatini DM. Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol 14: 1296–1302, 2004. [DOI] [PubMed] [Google Scholar]
  • 49.Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307: 1098–1101, 2005. [DOI] [PubMed] [Google Scholar]
  • 50.Schmelzle T, Hall MN. TOR, a central controller of cell growth. Cell 103: 253–262, 2000. [DOI] [PubMed] [Google Scholar]
  • 51.Shechter P, Shi JD, Rabkin R. Renal tubular cell protein breakdown in uninephrectomized and ammonium chloride-loaded rats. J Am Soc Nephrol 5: 1201–1207, 1994. [DOI] [PubMed] [Google Scholar]
  • 52.Shima H, Pende M, Chen Y, Fumagalli S, Thomas G, Kozma SC. Disruption of the p70(s6k)/p85(s6k) gene reveals a small mouse phenotype and a new functional S6 kinase. EMBO J 17: 6649–6659, 1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Shioi T, McMullen JR, Tarnavski O, Converso K, Sherwood MC, Manning WJ, Izumo S. Rapamycin attenuates load-induced cardiac hypertrophy in mice. Circulation 107: 1664–1670, 2003. [DOI] [PubMed] [Google Scholar]
  • 54.Tsukiyama-Kohara K, Poulin F, Kohara M, DeMaria CT, Cheng A, Wu Z, Gingras AC, Katsume A, Elchebly M, Spiegelman BM, Harper ME, Tremblay ML, Sonenberg N. Adipose tissue reduction in mice lacking the translational inhibitor 4E-BP1. Nat Med 7: 1128–1132, 2001. [DOI] [PubMed] [Google Scholar]
  • 55.Wang L, Gout I, Proud CG. Cross-talk between the ERK and p70 S6 kinase (S6K) signaling pathways. MEK-dependent activation of S6K2 in cardiomyocytes. J Biol Chem 276: 32670–32677, 2001. [DOI] [PubMed] [Google Scholar]
  • 56.Wang X, Li W, Williams M, Terada N, Alessi DR, Proud CG. Regulation of elongation factor 2 kinase by p90(RSK1) and p70 S6 kinase. EMBO J 20: 4370–4379, 2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.White KE, Bilous RW. Type 2 diabetic patients with nephropathy show structural-functional relationships that are similar to type 1 disease. J Am Soc Nephrol 11: 1667–1673, 2000. [DOI] [PubMed] [Google Scholar]
  • 58.Wolf G, Jablonski K, Schroeder R, Reinking R, Shankland SJ, Stahl RA. Angiotensin II-induced hypertrophy of proximal tubular cells requires p27Kip1. Kidney Int 64: 71–81, 2003. [DOI] [PubMed] [Google Scholar]
  • 59.Wolf G, Mueller E, Stahl RA, Ziyadeh FN. Angiotensin II-induced hypertrophy of cultured murine proximal tubular cells is mediated by endogenous transforming growth factor-beta. J Clin Invest 92: 1366–1372, 1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Wullschleger S, Loewith R, Hall MN. TOR signaling in growth and metabolism. Cell 124: 471–484, 2006. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Renal Physiology are provided here courtesy of American Physiological Society

RESOURCES