Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jul 15.
Published in final edited form as: Cancer Res. 2009 Jul 7;69(14):5954–5960. doi: 10.1158/0008-5472.CAN-09-0778

ATF2 and c-Jun-Mediated Induction of FoxP3 for Experimental Therapy of Mammary Tumor in the Mouse

Yan Liu 1,*, Yin Wang 1,*, Weiquan Li 1, Pan Zheng 1,2, Yang Liu 1,3
PMCID: PMC2742913  NIHMSID: NIHMS132284  PMID: 19584270

Abstract

FOXP3 is inactivated in breast cancer cells by a number of mechanisms, including somatic mutations, deletion and epigenetic silencing. Since the mutation and deletion are usually heterozygous in the cancer samples, it is of interest to determine whether the gene can be induced for the purpose of cancer therapy. Here we report that anisomycin, a potent activator of ATF2, and JNK, induces expression of FoxP3 in both normal and malignant mammary epithelial cells. The induction is mediated by ATF2 and c-Jun. Targeted mutation of ATF2 abrogates both constitutive and inducible expression of FoxP3 in normal epithelial cells. Both ATF2 and c-Jun interact with a novel enhancer in the intron 1 of the FoxP3 locus. Moreover, shRNA silencing of ATF2 and FoxP3 reveals an important role of ATF2-FoxP3 pathway in the anisomycin-induced apoptosis of breast cancer cells. A low dose of anisomycin was also remarkably effective in treating established mammary tumor in the mice. Our data demonstrated that FoxP3 can be reactivated for cancer therapy.

Keywords: FoxP3, breast cancer, tumor suppressor gene

Introduction

The overwhelming majority of tumor suppressor genes are autosomal and their inactivations involve two genetic events (1–4). The best defined two hits of the tumor suppressors in cancer cells are usually irreversible, such as deletion or mutations (3, 4). More recently, however, it has become increasingly clear that epigenetic inactivation of tumor suppressors plays a critical role in inactivating tumor suppressor genes (5). On the other hand, due to X-inactivation, the X-linked tumor suppressor genes are operatively hemizygous, and can be inactivated by a single hit (6). This notion has been substantiated by the recent identification of two tumor suppressor genes, FoxP3 for breast cancer (7) and WTX for Wilm’s tumor (8). Since the majority of mutations and/or deletions associated with X-linked tumor suppressor genes are heterozygous (7, 8), most cancer cells have a wild-type allele that has not been irreversibly inactivated (7).

An important aspect of tumor therapy is how to restore the function of tumor suppressors. For those with two irreversible genetic changes, such as p53, this has been technically challenging, although a pharmaceutical restoration of mutant protein function has been reported (9). Since X-linked tumor suppressor genes are operationally hemizygous, only one allele is subject to genetic selection in cancer cells. The other allele is therefore genetically intact and can potentially be induced to suppress tumor growth. Based on this concept, we searched for a biochemical pathway that can be activated to induce FOXP3 expression in breast cancer cells. Here we report that anisomycin, which is commonly used to induce stress responses of cells, induces expression of FOXP3 in breast cancer cell lines. Our biochemical and genetic analyses revealed that ATF2, which was recently demonstrated to be a tumor suppressor gene in the mouse (10), is essential for the induction of FoxP3 and FoxP3-mediated apoptosis. Moreover, ATF-2 forms heterodimer with c-Jun to activate transcription of FoxP3. These data demonstrate a novel function of ATF2 in the expression of FoxP3 in the epithelial cells and suggest a novel approach for the therapy of breast cancer.

Results

Induction of FoxP3 by anisomycin

We have recently demonstrated that the expression of FoxP3 cDNA leads to rapid cell death of breast cancer cell lines (7, 11). These results raised the possibility that the induction of FoxP3 may represent a novel therapeutic approach for the treatment of breast cancer. When we screened for drugs that induce FoxP3 expression in mammary tumor cell lines, we observed a rapid induction of FoxP3 mRNA by anisomycin. As shown in Fig. 1a, significant levels of the FoxP3 transcripts were induced in a mouse mammary tumor cell line, TSA, as early as 4 hours after anisomycin treatment. Similar effects were observed in another mouse mammary tumor cell line 4T1 and human breast cancer cell line MCF-7 (Fig. 1b), which we showed to harbor the WT FOXP3 gene (7). In contrast, treatment of PMA did not result in any induction of FoxP3 (Fig. 1b). Since higher doses of anisomycin can inhibit translation, we tested induction of the FoxP3 protein by Western blot. As shown in Fig. 1c, low doses of anisomycin induced high levels of FoxP3 protein, which indicated that activation of FoxP3 locus can be achieved at doses that did not prevent translation of the FoxP3 protein. Importantly, the induction of FoxP3 protein can be prevented by FoxP3 shRNA. These data not only proved the specificity of Western blot, but also confirmed that the accumulation of FoxP3 protein depends on induction of FoxP3 mRNA.

Fig. 1. Anisomycin rapidly induces FoxP3 expression in mouse and human breast cancer cell lines.

Fig. 1

a. Induction of FoxP3 transcripts by anisomycin (0.1 μg/ml). The upper shows kinetics of FoxP3 induction in mouse mammary tumor cell line TSA, as measured by RT-PCR for cDNA covering the entire coding region. The lower panel shows the induction of FoxP3 in TSA by real-time PCR. Data shown are means and SD of three independent experiments. The transcript level of 0 hour is artificially defined as 1.0. b. Induction of FoxP3 by anisomycin (0.01, 0.05, 0.1, 0.25, 0.5, 1.0 μg/ml), but not by PMA (0.01, 0.1, 0.5, 1.0, 2.5 μg/ml) in mouse mammary tumor cell line 4T1 or human breast cancer cell line MCF7 by RT-PCR, using primers spanning from start coden to stop coden. c. Anisomycin induces FoxP3 protein, as revealed by Western blot. The specificity of analysis and dependence of FoxP3 transcript is confirmed by FoxP3 shRNA. All data are representative of at least three independent experiments.

Involvement of ATF2, JNK in FoxP3 induction

As a first step to identify the mechanism by which anisomycin induced FoxP3, we treated mammary tumor cell line with anisomycin in conjunction with inhibitors of overlapping specificity, including ATF-2/JNK inhibitor SP10096 (SP), p38α inhibitor SB203580 (SB) and p41/42 MAP kinase inhibitor PD9786 (PD). As shown in Fig. 2a, SP completely prevented the induction of FoxP3. On the other hand, SB and PD had little effect. These data raised the possibility that ATF-2 and JNK pathways may be involved in the induction of FoxP3 by anisomycin.

Fig. 2. A critical role of ATF2 and JNK1/2 in FoxP3 induction by anisomycin.

Fig. 2

a. Inhibitor of JNK and ATF-2 prevented induction of FoxP3. 4T1 cells were stimulated with anisomycin (0.1 μg/ml) in presence or absence of inhibitors (2 μg/ml) for ATF-2 and JNK SP600125 (SP), p38α SB203580 (SB) and p41/42 MAP kinase PD98059 (PD). The induction of FoxP3 was measured by RT-PCR, at 16 hours after induction. b. Effect of shRNA silencing of ATF2 and JNK1/2 on anisomycin-induced FoxP3 expression. Top, efficacy of shRNA using lentiviral vector control (scrambled) or that with given shRNA, as measured by Western blot. Levels of βactin are used as loading controls. The middle panel shows RT-PCR results as determined by electrophoresis. Two independent shRNA (called 1 and 2) were used. 4T1 cells treated with either vehicle control (−) or 0.1μg/ml of anisomycin for 16 hours. The bottom panels show real-time PCR results. The FoxP3 mRNA levels were determined by RT-PCR as detailed in Fig. 1 legends. c. ShRNA for ATF2 prevented induction of FoxP3 protein, as measured by Western blot. d. Targeted mutation of ATF2 abrogated both constitutive and inducible expression of the FoxP3 gene in mouse mammary epithelial culture. Photographs on upper and middle left panels show morphology of epithelial culture. Note higher cellular density of the ATF2−/− epithelial culture. The upper right panel shows that the primary cell culture expressed epithelial cell marker (CK19) and have no T cell contamination as judged by the lack of CD3 transcript. RT: Reverse transcriptase. The middle right panel shows constitutive and inducible expression of FoxP3 in ATF2+/+ but not ATF2−/− cultures. The lower panel shows real-time PCR quantitation of FoxP3 induction. Data shown are means and SD of three independent experiments. All data have been repeated at least 3 times.

To test this hypothesis, we generated lentiviral vectors expressing shRNA for JNK1/2 or ATF2. The efficacy of shRNA silencing is shown in Fig. 2b, while the impact of the silencing on anisomycin-mediated induction of FoxP3 is shown in Fig. 2c, d. These data demonstrated that silencing either JNK or ATF2 resulted in abrogation of the induction of the FoxP3 transcripts and protein by anisomycin. These data provide important genetic evidence for the involvement of JNK and ATF2 in anisomycin-induced FoxP3 expression.

Interestingly, a recent study demonstrated that mice with heterozygous deletion of the ATF2 gene developed spontaneous mammary tumors (10). Since FoxP3 heterozygous mutants have the same phenotype, it is intriguing that ATF2 may be responsible for constitutive and/or inducible expressions of FoxP3 in mammary epithelial cells. To address this issue, we obtained ATF2+/− mice from the frozen embryo bank of the Jackson Laboratories. The ATF2+/+ and the ATF2−/− mice were obtained by F1 cross. A previous report indicated that the only a small fraction of the ATF2−/− mice survive to adulthood (12). We obtained 2 ATF2−/− females, from which we obtained two independent primary mammary epithelial cell cultures (Fig. 2e). The epithelial origin of the cultures was demonstrated by the expression of CK19 (Fig. 2f). Since T cells are the major source of FoxP3 transcripts in vivo, we also confirmed that the primary culture has no T cell contamination by the lack of CD3 transcripts (Fig. 2f). As shown in Fig. 2g, h, WT epithelial cultures expressed significant amounts of Foxp3 transcripts, which were further induced by the treatment of anisomycin. ATF2−/− cells had no detectable FoxP3 transcripts and did not express FoxP3 after stimulation by anisomycin. These data revealed an essential role for ATF2 in both constitutive and inducible expressions of FoxP3 in normal epithelial cells. On the other hand, the thymocytes from the ATF2−/− mice had normal number of CD4+FoxP3+ T cells (data not shown). Therefore, the function of ATF2 in FoxP3 expression appears to be epithelia-specific.

Identification of the FoxP3 enhancer associated with ATF2 and c-Jun

In order to study the mechanism of ATF2/JNK-mediated induction of FoxP3, we carried out chromatin immunoprecipitation (ChIP) to identify an anisomycin-inducible binding site of the FoxP3 locus. In order to identify specific ATF2 binding sites, we treated the 4T1 cell line with or without anisomycin and carried out ChIP with either control IgG or anti-p-ATF2 antibodies. Since JNK regulate transcription by phosphorylation of c-Jun (13), we used anti-phospho-c-Jun antibodies in the ChIP. In order to identify the FoxP3 sequence associated with p-ATF2 and p-c-Jun, we first analyzed the 5′ sequence of the FoxP3 gene and identified 14 potential AP1 and CREB sites. PCR primers were designed across the 10.4 kb regions, and the amounts of each PCR product were normalized against that amplified from the input DNA. The quantitative real-time PCR results were shown in Fig. 3a, while the PCR products from two major peaks were shown in Fig. 3b. These data reveal two potential sites for ATF2/cJun interaction. The first is hereby called P2, which is 4.8 kb 5′ of exon 1. The second and the stronger binding site P10 is 4.2 kb 3′ of exon 1. Importantly, while the P2 ATF2/cJun association is not inducible by anisomycin, the P10 binding is enhanced by more than 2-fold by anisomycin. Moreover, comparison of mouse and human FoxP3 sequence revealed that the P10, but not the P2 site is highly conserved (supplemental Fig. S1). Therefore, we focused on the potential significance of P10 as the site for p-ATF2 and p-cJun interaction.

Fig. 3. Identification of cis-elements that interact with ATF2/c-Jun heterodimer.

Fig. 3

a–c, ChIP scanning of potential c-Jun and ATF2 binding sites. The 4T1 cells were treated with either vehicle control or anisomycin for 2 hours. The chromatin was cross-linked with paraformadehyde and precipitated with either control IgG, anti-phospho-ATF2 or anti-phospho-c-Jun. The amounts of DNA were quantified by PCR. a. Quantitative analysis of the ATF2 and c-Jun binding sites in the FoxP3 locus. Top panel show the genomic structure of the 5′ of the FoxP3 locus. The DNA quantitation was shown in the lower panel by bar-graph. Data shown are means of triplicate samples and have been repeated 3 times. b. PCR amplification of FoxP3 sequences P2 and P10 in ChIPs from anisomycin-treated and untreated cells. Note that while the binding of P10 to ATF2 and c-Jun are inducible, that of P2 was largely unaffected by anisomycin. c. The ATF2 and cJun bound to the AP1 site in P10. The sequence of WT probe (P10) is agatggacgtcacctaccacatcacgg (bold letters for core AP1 sequence), that for P10-Mt1 is agatggacgtctgcgcccacatcacgg (bold letter indicate mutations), while that for P10-Mt2 is agatggacgtcgacgcccacatcacgg. The data have been repeated 3 times.

Sequencing comparison identified a typical AP1 site within the P10 (supplemental Fig. S1). In order to directly demonstrate interactions of ATF2 and c-Jun to the FoxP3 promoter, we radio-labeled an oligonucleotide probe containing conserved AP1 site as well as two control oligos with mutations in the AP1 site and tested their binding to nuclear extracts. As shown in Fig. 3c, the nuclear extracts from anisomycin-treated, but not those from the untreated 4T1 cells, showed strong interaction with the WT P10 probe. The specificity was confirmed as mutations in the AP1 site significantly reduced the binding. Furthermore, the involvement of ATF2 and c-Jun was demonstrated as their specific antibodies abolished the binding of nuclear extracts to WT probe. Thus, both ChIP and electrophoresis mobility-shift assay identify a specific AP-1 site with 4.2 kb 3′ of the TSS, which binds to both p-ATF2 and p-cJun by anisomycin-inducible fashion.

To test whether the P10 sequence was a functional FoxP3 enhancer, we generated a series of constructs consisting of the basal promoter and putative enhancer elements. As shown in supplemental Fig. S2, a 265 bp sequence 5′s of TSS of the FoxP3 locus plus 50 bp down-stream of TSS is sufficient to convey a significant basal promoter activity. This fragment is therefore chosen to measure the enhancer activity. As shown in Fig. 4, addition of three copies of P2 fragment increased the promoter activity by about 2-fold, which suggests that P2 is at best a weak enhancer. Inclusion of three copies of P10 sequences, however, increased the Foxp3 promoter activity by 10-fold. Surprisingly, this appears uni-directional as the inversion of the P10 fragment eliminated its enhancer activity. Moreover, the involvement of AP1 site in P10 was confirmed as a mutation of the AP1 site significantly reduced the enhance activity. Moreover, addition of P2 to P10 failed to further enhance the promoter activity. Taken together, our data demonstrated that anisomycin induced ATF2/c-Jun interaction with a specific enhancer within the intron 1 of the FoxP3 gene.

Fig. 4. Enhancer activity of the ATF2/cJun binding sites in transcription of FoxP3.

Fig. 4

Quantitative analysis of enhancer activity. The left panel shows configurations of the constructs used, including the basal promoter regions used (PF4), while the right panel show fluorescence intensity as measured by flow cytometry. The promoter activities were normalized by the following formula: (GFP fluorescence sample/GFP fluorescence control)/(renila luciferase activity sample/renila luciferase control). The promoter-less GFP construct is used as control. Data shown are means and SD of triplicates and have been repeated 3 times

A critical role for ATF2-FoxP3 pathway in anisomycin-induced apoptosis and the therapy of breast cancer

Our recent studies have demonstrated that the induced expression of FoxP3 caused apoptosis of breast cancer cell lines (7, 11, 12). To determine whether anisomycin treatment caused apoptosis of breast cancer cells, we measured the cytotoxic effect of anisomycin on several of breast cancer cell lines, by MTT assay. As shown in Fig. 5a, both mouse (TSA) and human breast cancer cell lines (BT474, MCF-7) were highly susceptible to anisomycin, with an IC50 between 50–100 ng/ml. The reduced viability is due to apoptosis as revealed by the increased expression of active caspase 3 in TSA cells (Fig. 5b, top panels) with less than 2C DNA contents (Fig. 5b, lower panels). Given the critical role for ATF2 in FoxP3 induction, we tested the contribution of ATF2 to anisomycin-induced cell death by comparing the dose response to anisomycin in cells transfected with either vector alone or those with ATF2 shRNA. As shown in Fig. 5c and d, ATF2 and FoxP3 shRNAs increased resistance to anisomycin by nearly 3-fold. These data demonstrate a critical role for the ATF2-FoxP3 pathway in anisomycin induced cell-death of breast cancer cells.

Fig. 5. ATF2-FoxP3 pathway induces apoptosis of breast cancer cells.

Fig. 5

a. Growth inhibition of mouse and human breast cancer cell lines by anisomycin, as determined by MTT assay. 104/well of mouse cell line (TSA) or human breast cancer cell lines TB474 or MCF7 were cultured in the presence of given concentration of anisomycin for 48 hours. The amounts of viable cells were determined by MTT assay, with viability of the untreated cells defined as 100%. Data shown were means and SD of triplicate samples, and have been repeated 3 times. b. Anisomycin induction of apoptosis in TSA cell line at 24 hr after treatment. The upper panels shows staining of activated caspase 3, while the lower panel shows DNA contents. The % of gated cells was apoptotic based on their sub-2C DNA contents. Data shown have been repeated 3 times. c. Requirements for ATF2 in growth inhibition of TSA by anisomycin. d. Requirement for FoxP3 in growth inhibition TSA (left panel) and MCF-7 cells (right panel) by anisomycin. The indicated cell lines were transduced with lentiviral vector encoding either scrambled shRNA of shRNA specific for ATF2 or FoxP3. The transfected cells were enriched by short-term treatment of blastcidin at a dose of 6.5 μg/ml and subject to treatment of different doses of anisomycin. The viability was measured by MTT assay. Data shown are means and SD of triplicates and have been repeated 3 times.

To test whether induction of FoxP3 by ATF2-FoxP3 pathway can be explored for breast cancer therapy, we injected the TSA cell line into the mammary pad. Seventeen days later, when the cancer cells established locally, the mice were treated with either vehicle control or anisomycin. As shown in Fig. 6, the growth of the TSA tumor cells in syngeneic mammary pad is abrogated by anisomycin. These data demonstrate the potential of ATF2-FoxP3 pathway in the therapeutic development for breast cancer.

Fig. 6. Anisomycin confered significant therapeutic effect for established mammary tumor in the mice.

Fig. 6

5×105 TSA cells were injected into mammary fat pads of syngeneic BALb/c mice. After 17 days of injection, the mice with palpable tumors were randomly grouped and treated with anisomycin or vehicle control intraperitoneally, every 2 days for 8 times, at dose of 0.5 mg/mouse. The dose used did not give obvious side effect and was about 1/20 of LD50 in the mice. The tumor diameters were derived from the average of largest diameters in two dimensions. The tumor volumes defined as 0.75πr3, where r is radius. The growth kinetics is shown in upper panel, while photographs of tumors prior to, or at the end of treatments were shown at the bottom. Similar therapeutic effects have been observed in 3 independent experiments.

Discussion

FOXP3 is an X-linked gene that is subject to X-inactivation (7, 14). Our inquiry into the high incidence of spontaneous mammary tumors in mice heterozygous for the Scurfy mutation led to the identification of it as the first X-linked tumor suppressor for breast cancer in mouse and in woman (7). FOXP3 acts as a transcriptional repressor of oncogenes such as ErbB2 and SKP2 (7, 11). Moreover, ectopic expression of FOXP3 cause an apoptosis of breast cancer cells (7). These data demonstrated that the induction of FOXP3 in the tumor cells may prove valuable for the treatment of breast cancer.

Since the one WT allele was not irreversibly inactivated in the overwhelming majority of breast cancer samples analyzed (7), it is theoretically possible to reactivate the expression of FOXP3 locus for the treatment of breast cancer. The data presented herein demonstrated such reactivation by anisomycin.

We observed that anisomycin, a drug commonly used to activate MAP kinases, rapidly induced FOXP3 expression in multiple breast cancer cell lines tested. Using shRNA specific for JNK and ATF2, we demonstrated that the JNK and ATF2 genes are required for the induction of FoxP3 expression. Moreover, biochemical analysis allowed us to identify critical cis-element involved in the induction of FoxP3 and that this cis-element interacts with c-Jun and ATF2 to cause the activation of the FOXP3 gene. It is worth considering whether the effect of anisomycin can be related to reactivation of X-inactivated FoxP3, given recent reports of chromatin modification-dependence of c-Jun-induced transcriptions (15, 16).

Using mammary epithelial culture isolated from WT and ATF2−/− mice, we showed that the targeted mutation of ATF2 not only reduced the basal levels of FOXP3 transcripts in the mammary epithelial cells, but also eliminated its induction by anisomycin. Therefore, ATF2 plays an essential role in both constitutive and inducible expression of FoxP3. It is of great interest to note that mice heterozygous for ATF2-null allele spontaneously developed mammary tumors (10). The similarity in tumor onset suggests that the lack of FoxP3 expression may be an underlying cause for the spontaneous mammary tumors, although the ATF-2+/− mice available to us is in 129/SV background, which is not suitable to address this issue.

FOXP3 is expressed in both T cells and epithelial cells (7, 17, 18). Since the majority of the ATF2−/− mice die shortly after birth (12), a systemic analysis of the effect on expression of FOXP3 in the T-cell lineage remained to be determined. However, our preliminary analysis suggested that ATF2 is not essential for FOXP3 expression in the thymocytes (data not shown). Therefore, ATF2 may play different roles in different lineages. Consistent with this notion, both cis-element and the trans-activating factors identified here differ from what were reported in FoxP3 induction in T cells (19–22).

Finally, an important but unresolved issue is how to reactivate tumor suppressor function in the tumor cells. Classical tumor suppressors are inactivated by two irreversible hits (2). Therefore, despite an elegant recent approach (9), restoring the function of classical tumor suppressors remains a major challenge for cancer therapy. On the other hand, recent data from our group and that of another indicated that X-linked tumor suppressor genes are subject to X-inactivation (7, 8). Since X-inactivated genes are not subject to selection during tumor growth and since deletion and mutation found in the majority of the cases are heterozygous (7, 8), it may be possible to reactivate FOXP3 for the treatment of breast cancer. In this regard, we have demonstrated that anisomycin cause apoptosis in an ATF2- and FOXP3-dependent manner. Moreover, the doses used here do not interfere with protein translation and cause no obvious side effect, yet the drug causes dramatic inhibition of growth of established mammary tumors in syngeneic hosts. While more work is needed to evaluate the potential for anisomycin for breast cancer treatment, our data suggest that one may be able to reactivate X-linked tumor suppressor genes for cancer treatment.

Experimental procedure

Antibodies and reagents

Anti-ATF-2 (20F1), phospho-ATF2-(Thr71), and activated caspase-3 were purchased from Cell Signaling, Inc. Other vendors are: anti-Foxp3 (eBioscience, #14-5779-82); and anti-β-actin (I-19), c-Jun (NX), and phosphor-c-Jun (KM-1) (Santa Cruz Biotechnology, Inc.). Chemicals SP600125, SB203580, and PD98059 were purchased from CalBiochem, Inc, while anisomycin was purchased from Sigma, Inc.

Experimental animals

Mice heterozygous for Atf2 null mutation (Atf2tm1Glm/Atf2+129S2/SvPas) (12) were revived from the frozen embryo bank in the Jackson Laboratories (Bar Harbor, Maine). Heterozygous mice were crossed to produce Atf2+/+ and Atf2−/− littermates. BALB/c mice were purchased from Charles River through a National Cancer Institute Subcontract. All studies involving animal has been approved by University Committee on Use and Care of Animals at University of Michigan.

Preparation of mammary epithelial cell culture

Mouse mammary fat pads were removed from 6 to 8-week-old virgin female mice and minced into small pieces. After collagenase digestion at 37 °C in a shaking incubator in DMEM medium supplemented with 5% fetal calf serum (FBS), cells were sieved through a 70-μm cell strainer (BD Falcon) to obtain a single cell suspension. The cells were cultured in DMEM medium supplemented with 10% FBS and 10 ng/ml epithelial growth factor. At day 3 of culture, fibroblast cells were removed by a short digestion with 0.05% trypsin-EDTA as less adherent cells.

Measurement of FOXP3 transcripts

Total cDNA were prepared from breast cancer cell lines or epithelial cultures. The levels of FOXP3 mRNA were measured by RT-PCR under two conditions. Full length encoding regions were analyzed by agarose gel electrophoresis, while shorter transcripts were quantitated using realtime PCR. All primers for PCR were listed in supplemental Table 1.

ShRNA lentiviral vector

The lentivirus-based shRNA expressing vectors were created by introducing the murine U6 RNA polymerase III promoter and a murine phosphoglycerate kinase promoter (pGK)-driven EGFP expression cassette into a vector of pLenti6/V5-D-TOPO back bone without CMV promoter. Hairpin shRNA sequence of FoxP3, JNK1, 2, and Atf2 (FoxP3: 5′-aagccatggcaatagttcctt-3′; FOXP3, 5′-gcagcggacactcaatgag-3′, JNK1,2: 5′-agaaggtaggacattcctt-3′ and 5′-aagcctagtaatatagtagt-3′; Atf2: 5′-cttctgttgtagaaacaac-3′ and 5″-agcacgtaatgacagtgtca-3′) were cloned into the lentiviral shRNA expressing vectors by restriction sites of ApaI and EcoRI.

Electrophoresis mobility shift assay

Anisomycin were added to 4T1 cells in conjunction with either vehicle control or kinase inhibitor SP600125 at a dose of 2 μg/ml for 2 hours before cells lysed. The nuclear extracts were mixed with either WT or mutant probes in the presence of either control anti-c-Jun (Santa Cruz, sc-45X) or anti-ATF2 (Cell Signaling, #9226) antibodies, as indicated and analyzed by electrophoresis, as described (23).

Western Blot Protein samples for Western blot were prepared by lysing cultured cells in SDS sample buffer, resolved on 10% SDS-polyacrylamide gel electrophoresis and electroblotted onto nitrocellulose membranes. Membranes with transferred proteins were incubated with primary antibody followed by incubation with horseradish peroxidase-conjugated to the secondary antibody. Chemiluminescence reaction using the ECL kit (Amersham Biosciences) was detected by film.

Chromatin immunoprecipitation (ChIP) was carried out according to a published procedure (24). Briefly, the vehicle or 2-hr anisomycin-treated 4T1 cells were sonicated and fixed with 1% paraformaldehyde. The anti-phospho-c-Jun or anti-phosphor-ATF2 antibodies or control rabbit IgG were used to pull down chromatin associated with these proteins. The amounts of the specific DNA fragments were quantitated by real-time PCR and normalized against the genomic DNA preparation from the same cells.

Immunoflurensence Staining

TSA cells were treated or left untreated with vehicle DMSO or 50ng/ml of anisomycin for 24 hr. After that, the cells were fixed by methanol, permeabilized with 0.3% Triton-X100, and stained with rabbit antibody against cleaved Caspase 3 (Cell signaling, #9661s) overnight. The stained cells were then visualized with Cy3-conjugated anti-rabbit IgG (Jackson ImmunoResearch Lab).

MTT cell viability assay has been described in details (25).

DNA contents Anisomycin-treated or control cells were stained by Propidium Iodide (PI) using “PI/RNase Staining Buffer” from BD Biosciences (San Jose, CA) according to the manufacturer’s manual.

Supplementary Material

supplemental information

Acknowledgments

We thank Lynde Shaw and Todd Brown for assistance. This study is supported by grants from the National Cancer Institute, Department of Defense and American Cancer Society. The authors have no financial conflict of interest.

References

  • 1.Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57–70. doi: 10.1016/s0092-8674(00)81683-9. [DOI] [PubMed] [Google Scholar]
  • 2.Knudson AG., Jr Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A. 1971;68:820–3. doi: 10.1073/pnas.68.4.820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell. 1990;61:759–67. doi: 10.1016/0092-8674(90)90186-i. [DOI] [PubMed] [Google Scholar]
  • 4.Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science. 1991;253:49–53. doi: 10.1126/science.1905840. [DOI] [PubMed] [Google Scholar]
  • 5.Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med. 2003;349:2042–54. doi: 10.1056/NEJMra023075. [DOI] [PubMed] [Google Scholar]
  • 6.Spatz A, Borg C, Feunteun J. X-chromosome genetics and human cancer. Nature reviews. 2004;4:617–29. doi: 10.1038/nrc1413. [DOI] [PubMed] [Google Scholar]
  • 7.Zuo T, Wang L, Morrison C, Chang X, Zhang H, Li W, Liu Y, Wang Y, Liu X, Chan MWY, Liu J-Q, Love RR, Liu C, Godfrey V, Shen R, Huang TH, Yang T, Park BK, Wang C-Y, Zheng P, Liu Y. FOXP3 is an X-linked breast cancer suppressor gene and an important repressor of HER-2/ErbB2 oncogene. Cell. 2007;129:1275–86. doi: 10.1016/j.cell.2007.04.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Rivera MN, Kim WJ, Wells J, Driscoll DR, Brannigan BW, Han M, Kim JC, Feinberg AP, Gerald WL, Vargas SO, Chin L, Iafrate AJ, Bell DW, Haber DA. An X chromosome gene, WTX, is commonly inactivated in Wilms tumor. Science. 2007;315:642–5. doi: 10.1126/science.1137509. [DOI] [PubMed] [Google Scholar]
  • 9.Bykov VJ, Issaeva N, Shilov A, Hultcrantz M, Pugacheva E, Chumakov P, Bergman J, Wiman KG, Selivanova G. Restoration of the tumor suppressor function to mutant p53 by a low-molecular-weight compound. Nat Med. 2002;8:282–8. doi: 10.1038/nm0302-282. [DOI] [PubMed] [Google Scholar]
  • 10.Maekawa T, Shinagawa T, Sano Y, Sakuma T, Nomura S, Nagasaki K, Miki Y, Saito-Ohara F, Inazawa J, Kohno T, Yokota J, Ishii S. Reduced levels of ATF-2 predispose mice to mammary tumors. Mol Cell Biol. 2007;27:1730–44. doi: 10.1128/MCB.01579-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zuo T, Liu R, Zhang H, Chang X, Liu Y, Wang L, Zheng P, Liu Y. FOXP3 is a novel transcription repressor for the breast cancer oncogene SKP2. J Clin Invest. 2007;117:3765–73. doi: 10.1172/JCI32538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Reimold AM, Grusby MJ, Kosaras B, Fries JW, Mori R, Maniwa S, Clauss IM, Collins T, Sidman RL, Glimcher MJ, Glimcher LH. Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice. Nature. 1996;379:262–5. doi: 10.1038/379262a0. [DOI] [PubMed] [Google Scholar]
  • 13.Su B, Jacinto E, Hibi M, Kallunki T, Karin M, Ben-Neriah Y. JNK is involved in signal integration during costimulation of T lymphocytes. Cell. 1994;77:727–36. doi: 10.1016/0092-8674(94)90056-6. [DOI] [PubMed] [Google Scholar]
  • 14.Tommasini A, Ferrari S, Moratto D, Badolato R, Boniotto M, Pirulli D, Notarangelo LD, Andolina M. X-chromosome inactivation analysis in a female carrier of FOXP3 mutation. Clin Exp Immunol. 2002;130:127–30. doi: 10.1046/j.1365-2249.2002.01940.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rahman I. Oxidative stress and gene transcription in asthma and chronic obstructive pulmonary disease: antioxidant therapeutic targets. Current drug targets. 2002;1:291–315. doi: 10.2174/1568010023344607. [DOI] [PubMed] [Google Scholar]
  • 16.Tsai CL, Li HP, Lu YJ, Hsueh C, Liang Y, Chen CL, Tsao SW, Tse KP, Yu JS, Chang YS. Activation of DNA methyltransferase 1 by EBV LMP1 Involves c-Jun NH(2)-terminal kinase signaling. Cancer Res. 2006;66:11668–76. doi: 10.1158/0008-5472.CAN-06-2194. [DOI] [PubMed] [Google Scholar]
  • 17.Chen GY, Chen C, Wang L, Chang X, Zheng P, Liu Y. Cutting Edge: Broad Expression of the FoxP3 Locus in Epithelial Cells: A Caution against Early Interpretation of Fatal Inflammatory Diseases following In Vivo Depletion of FoxP3-Expressing Cells. J Immunol. 2008;180:5163–6. doi: 10.4049/jimmunol.180.8.5163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fontenot JD, Gavin MA, Rudensky AY. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 2003;4:330–6. doi: 10.1038/ni904. [DOI] [PubMed] [Google Scholar]
  • 19.Floess S, Freyer J, Siewert C, Baron U, Olek S, Polansky J, Schlawe K, Chang HD, Bopp T, Schmitt E, Klein-Hessling S, Serfling E, Hamann A, Huehn J. Epigenetic control of the foxp3 locus in regulatory T cells. PLoS biology. 2007;5:e38. doi: 10.1371/journal.pbio.0050038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kim HP, Leonard WJ. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. J Exp Med. 2007;204:1543–51. doi: 10.1084/jem.20070109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tone Y, Furuuchi K, Kojima Y, Tykocinski ML, Greene MI, Tone M. Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat Immunol. 2008;9:194–202. doi: 10.1038/ni1549. [DOI] [PubMed] [Google Scholar]
  • 22.Venuprasad K, Huang H, Harada Y, Elly C, Subramaniam M, Spelsberg T, Su J, Liu YC. The E3 ubiquitin ligase Itch regulates expression of transcription factor Foxp3 and airway inflammation by enhancing the function of transcription factor TIEG1. Nat Immunol. 2008;9:245–53. doi: 10.1038/niXXXX. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang CY, Cusack JC, Jr, Liu R, Baldwin AS., Jr Control of inducible chemoresistance: enhanced anti-tumor therapy through increased apoptosis by inhibition of NF-kappaB. Nat Med. 1999;5:412–7. doi: 10.1038/7410. [DOI] [PubMed] [Google Scholar]
  • 24.Im H, Grass JA, Johnson KD, Boyer ME, Wu J, Bresnick EH. Measurement of protein-DNA interactions in vivo by chromatin immunoprecipitation. Methods Mol Biol. 2004;284:129–46. doi: 10.1385/1-59259-816-1:129. [DOI] [PubMed] [Google Scholar]
  • 25.Wang Y, Liu Y, Wu C, McNally B, Liu Y, Zheng P. Laforin confers cancer resistance to energy deprivation-induced apoptosis. Cancrer Research. 2008;68:4039–44. doi: 10.1158/0008-5472.CAN-07-6314. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplemental information

RESOURCES