Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Sep 1.
Published in final edited form as: J Mol Neurosci. 2009 Jan 15;39(1-2):157–168. doi: 10.1007/s12031-008-9170-7

Endoplasmic Reticulum Stress–Induced Cell Death in Dopaminergic Cells: Effect of Resveratrol

Shankar J Chinta 1, Karen S Poksay 2, Gaayatri Kaundinya 3, Matthew Hart 4, Dale E Bredesen 5,6, Julie K Andersen 7,✉, Rammohan V Rao 8,✉
PMCID: PMC2745484  NIHMSID: NIHMS138859  PMID: 19145491

Abstract

Resveratrol, a naturally occurring polyphenol, exhibits antioxidant, antiaging, and anticancer activity. Resveratrol has also been shown to inhibit tumor initiation, promotion, and progression in a variety of cell culture systems. Earlier, we showed that paraquat, a bipyridyl herbicide, triggers endoplasmic reticulum stress, cell dysfunction, and dopaminergic cell death. Due to its antioxidant activity, we assessed the ability of resveratrol to rescue cells from the toxic effects of paraquat. While resveratrol did not have any protective effect at low concentrations, it triggered endoplasmic reticulum (ER) stress-induced cell death at higher concentrations (50–250 µM). The present study was carried out to determine the mechanism by which resveratrol triggers ER stress and cell death in dopaminergic N27 cells. Our studies demonstrate that resveratrol triggers ER stress and cell dysfunction, caspase activation, p23 cleavage and inhibition of proteasomal activity in dopaminergic N27 cells. While over expression of uncleavable p23 was associated with decreased cell death, down-regulation of p23 protein expression by siRNA resulted in enhancement of ER stress-induced cell death triggered by resveratrol indicating a protective role for the small co-chaperone p23 in dopaminergic cell death.

Keywords: Endoplasmic reticulum, Resveratrol, ER stress, Caspase, Apoptosis, Programmed cell death

Introduction

The endoplasmic reticulum (ER) has several important functions in the cell including post-translational modification, folding, and assembly of newly synthesized secretory proteins; its proper functioning is essential for cell survival. As a membranous compartment associated with such critical roles mentioned above, the ER is extremely sensitive to changes that affect its structure, integrity, and function (Kaufman 1999; Ma and Hendershot 2002; Ron 2002; Sitia and Braakman 2003). Thus, any external or internal factors that impinge on ER structure and function will ultimately cause disruption in protein synthesis, translation, and folding resulting in unfolded or misfolded proteins. The accumulation of unfolded or misfolded proteins results in the failure of the ER to cope with the excess protein load which is termed “ER stress” (Harding et al. 2002; Kopito 2000; Paschen and Frandsen 2001; Rutkowski and Kaufman 2004; Sitia and Braakman 2003). Cells, in turn, activate the “unfolded protein response” (UPR) to avert ER stress. Prolonged ER stress and UPR activation completely overwhelms cellular protective mechanisms ultimately triggering cell death (Bakhshi et al. 2008; Bredesen et al. 2006; Egger et al. 2007; Rao et al. 2001; Rao et al. 2002a, b; Rao et al. 2004a, b; Rao et al. 2006). Using various ER stress inducers including thapsigargin, brefeldin, and tunicamycin, we have identified the roles of several ER stress-induced cell death modulators and effectors (Egger et al. 2007; Rao et al. 2004a, b; Rao et al. 2006).

In a recent study, we reported that dopaminergic N27 cells treated with paraquat (PQ) resulted in ER stress-induced cell death featuring p23 cleavage, caspase processing, activation of ER-associated pro-apoptotic Bcl-2 proteins and inhibition of proteasomal activity (Chinta et al. 2008). Similar phenomena were also observed in cells treated with MPP+ or rotenone (unpublished). We hypothesized that PQ and other Parkinson’s disease (PD)-associated toxins may trigger oxidative stress that in turn results in protein modification, misfolding, and impaired protein degradation (Andersen 2000, 2004; Mattson 2006; Rajagopalan and Andersen 2001) finally leading to ER stress-induced cell death. While searching for suitable compounds that could block the ER stress effects triggered by PQ or MPP+, we focused our attention on resveratrol, a well known anti-oxidant (Calabrese et al. 2008; de Almeida et al. 2008; Hwang et al. 2008; Rubiolo et al. 2008). To our surprise, while low concentrations of resveratrol were ineffective in rescuing dopaminergic cells from PQ or MPP+ toxicity, higher concentrations of resveratrol exacerbated ER stress and caspase-mediated programmed cell death (pcd). The present studies were performed to elucidate the pathways by which resveratrol triggers ER stress-induced cell death in dopaminergic N27 cells.

Experimental Procedures

Cells, Culture Conditions and Cell Extracts

Immortalized rat mesencephalic dopaminergic N27 cells were cultured in RPMI containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. These cells were derived from dopamine-producing neurons of the rat fetal midbrain via SV40 large T antigen immortalization and exhibit increased levels of tyrosine hydroxylase and dopamine transporter making them a good model system to study effects on the midbrain dopaminergic neurons selectively lost in PD (Adams et al. 1996; Clarkson et al. 1998; Zhou et al. 2000). PC12 rat pheochromocytoma cells were cultured in DMEM (Sigma) supplemented with 5% FBS and 5% horse serum. Human neuroglioma H4 cells (ATCC#HTB-148) were grown in a monolayer in DMEM containing 10% FBS and 1% penicillin/streptomycin. Microglia cells (BV-2) were cultured in DMEM supplemented with 5% FBS and 1% penicillin/streptomycin. Resveratrol (trans-3,4′,5-trihydroxystilbene) was purchased from Sigma–Aldrich. A 20-mM stock solution of resveratrol was prepared in 75% ethanol and further diluted in cell culture medium to make working concentrations. Total cell extracts were prepared as previously described (Rao et al. 2001, 2002a, b). Briefly, untreated or resveratrol-treated cells were resuspended in RIPA buffer (50 mM Tris, pH 7.5, 0.5% deoxycholate, 1% Triton X-100, 0.1% sodium dodecyl sulfate (SDS), 150 mM NaCl) with protease inhibitors (Complete, Mini, Roche), sonicated for 10 s on ice and centrifuged at 10,000×g for 10 min at 4°C. The supernatant was collected and protein concentration was determined using Coomassie plus protein assay reagent (Pierce). 100–200 µg of protein from total extracts was used for Western blotting.

Cell-free cytosolic extracts were prepared as previously described (Rao et al. 2001, 2002a, b, 2004a, b). Briefly, the untreated or resveratrol-treated cell pellet was resuspended in hypotonic extraction buffer, transferred to a 2-ml Dounce homogenizer and allowed to swell for 20–30 min on ice. Cells were lysed with 50 gentle strokes with a B-type pestle. The desired extent of lysis (>90%) was monitored under the microscope by trypan blue staining. The cell lysate was centrifuged for 30 min at 16,000×g (4°C). The supernatant was collected, protein concentration determined and 100–200 µg protein was used for caspase activity assays and to examine caspase cleavage by Western blotting.

Western Blotting

SDS-polyacrylamide gel electrophoresis (PAGE) and Western blot analyses were performed as described earlier (Rao et al. 2001, 2002a, b, 2004a, b). Membranes were probed with either a 1:500 dilution of anti-KDEL monoclonal antibody (Stressgen), a 1:500 dilution of anti-phospho-eIF2α rabbit monoclonal antibody, anti-eIF2α mouse monoclonal antibody, anti-caspase-7, or anti-caspase-3 antibodies (all from Cell Signaling Laboratories), a 1:1,000 dilution of anti-p23 monoclonal antibody (BD Biosciences), or a 1:500 dilution of anti-GADD153 antibody (Santa Cruz). To confirm uniform loading of proteins across conditions, immunoblots were reprobed with a 1:100,000 dilution of anti-GAPDH rabbit polyclonal antibody (Research Diagnostics Inc). The films were scanned and the integrated optical density (OD) of the bands was estimated using the ChemiImager 4400 imaging system (Alpha Innotech Corp). The band density was expressed as a percentage ratio of densito-metric optical density of the protein of interest to that of GAPDH.

Plasmids, cDNA Transfection, siRNA Synthesis, and Transfection

Wild-type (WT) Flag-p23 and caspase mutant Flag-p23D142N cDNA were generated as described earlier (Rao et al. 2006). Transient transfections were performed using TransIT-Neural transfection reagent obtained from MIRUS Bio Corporation. Typically, 2×106 cells were seeded into 10-cm dishes and transfected 1 day later with 6 µg of pcDNA3, WT p23 cDNA or p23D142N cDNA using a ratio of 1 µg:3 µl of DNA:TransIT-neural transfection reagent. The transfection efficiency using these conditions was approximately 50–60%. Small interfering RNAs (siRNA) were generated by in vitro transcription using the Silencer siRNA Construction Kit from Ambion as described earlier (Rao et al. 2004a, b, 2006). siRNAs were designed to target two or more regions of p23 based on predicted accessible (loop) and unique (specific) regions. The following siRNA sequences were designed to specifically target the mouse p23 gene: p23 (GenBank: AF153479) regions 419–439 (5′AAGTAGATGGAGCAGATGATG) and 446–466 (5–AAΓACAΓTΓATΓATΓAAAAΓA). Transfection of siRNA was carried out as described earlier (Rao et al. 2006) using GeneSilencer siRNA transfection reagent (Gelantis) according to the manufacturer’s instructions. To estimate the efficiency of the transfections, fluorescently labeled siRNAs targeting the luciferase gene (region 152–173) from the luciferase expressing vector pGL2-control (Promega) were also used. Forty-eight hours after p23 siRNA transfection, cell extracts were prepared and subjected to SDS-PAGE and Western blot analysis.

In order to study the effect of ER stress on cells following p23 reduction, cells were transfected with p23 siRNA. Twenty-four hours after transfection, cells were exposed to 100 µM resveratrol for 24 h. Resveratrol-induced cell death was quantified by MTT assay and cell death was determined as the percentage of live cells over the total number of cells.

Caspase Activity Assay

The fluorogenic substrate benzyloxycarbonyl-Asp-Glu-Val-Asp-7-amino-4 trifluoromethylcoumarin (BOC-DEVD-AFC; Enzyme Systems Products) was dissolved in DMSO as a 10-mM stock solution. Cell extracts (50–100 µg of protein) from untreated or resveratrol-treated cells were incubated with 100 µM peptide substrate. Q-VD-OPH (QVD, MP Biomedicals) was dissolved in DMSO according to the manufacturer’s data sheet and further diluted with cell-culture media. Caspase activity was determined by measuring the release of amino-4-trifluoromethylcoumarin from the synthetic substrate using a continuous recording instrument as described earlier (Rao et al. 2002a, b). Caspase activity was analyzed using a SpectraMAX 340 plate reader (Molecular Devices) at excitation and emission wavelengths of 444 and 538 nm, respectively.

Proteasome Activity

Assessment of 20S proteasome activity was carried out using Chemicon’s 20S proteasome activity assay that is based on the detection of the fluorophore 7-amino-4-methylcoumarin (AMC) after cleavage from the labeled substrate LLVY-AMC. Briefly, cell extracts (25–50 µg of protein) from untreated or resveratrol-treated cells were incubated with 1 mM substrate at 37°C for 1 h. The free AMC fluorescence was quantified using a Spectramax plate reader at excitation and emission wavelengths of 380 and 460 nm respectively.

Evaluation of Cell Death

Assessment of cell death was carried out by pelleting floating and adherent cells (after trypsinization) as previously described (Ellerby et al. 1997; Rao et al. 2001, 2002a, b). The cell pellet was resuspended in 1× phosphate-buffered saline (PBS)/0.4% Trypan blue and cells were counted using a hemocytometer. Cell death was determined as the percentage of dead cells over the total number of cells. Statistical significance was determined by two-way analysis of variance (ANOVA).

In addition, the MTT assay was also performed according to the manufacturer’s protocol (Sigma) for evaluation of cell death (Chinta and Andersen 2006). Briefly, cells were seeded into 24-well plates at a density of 50,000/well. Following treatment with resveratrol, 50 µl of 5 mg/ml MTT was added to the cells (500 µl) and incubated at 37°C for 2 h. The medium was discarded, the dark blue formazan crystalline product was dissolved in dimethyl sulfoxide and the results were quantified by measuring the absorbance in a Spectramax plate reader (Molecular Devices) at 570 nm. Cell death was determined as the percentage of live cells over the total number of cells.

Evaluation of cell death by flow cytometry was performed as described (Bakhshi et al. 2008; Egger et al. 2007). Briefly, media and cells from untreated or resveratrol-treated samples were collected by trypsinization, gently spun down, and stained with 3 µg/ml GFPAn-V and 5 µg/ml propidium iodide in Annexin-V binding buffer (10 mM Hepes, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2), incubated at room temperature for 15 min, diluted in 200 µl of Annexin-V binding buffer, and analyzed using a LSR flow cytometer (BD Biosciences). Data were processed with CellQuest Pro (BD Biosciences). This method appears to be more sensitive for measuring dying and dead cells and may explain the slight difference in the viability of N27 cells at 24 h of resveratrol treatment as measured by this method and MTT assay (Fig. 1A–C).

Figure 1.

Figure 1

Resveratrol triggers cell death in dopaminergic N27cells. N27 cells were either left untreated or treated with resveratrol for 48 h at different concentrations a or treated with 100 µM for 12–48 h. b Surviving versus apoptotic cells were quantified by the MTT assay as described in the Methods section and results are expressed as percent of untreated surviving cells. Data (mean ± SD) are from three independent experiments performed in triplicate. c Representative flow cytometry dot plots from cells stained with GFPAn-V/propidium iodide after 24 h of resveratrol treatment. The average cell counts listed in each dot-plot quadrant are the percent of annexin-V positive cells which represent dying and dead cells. Data are from four independent experiments performed in triplicate

Statistical Analysis

All experiments were performed at least three times unless otherwise indicated. Cell death assays and enzyme activity measurements were performed in triplicate and repeated independently three times. Results are expressed as mean ± SD. Data from cell death, enzyme activity assays and band densitometry were statistically analyzed using one-way ANOVA (GraphPad Prism), followed by between-group comparisons using the Newman–Keuls test. A value of p< 0.05 was considered statistically significant.

Results

Resveratrol Triggers ER Stress-Induced Cell Death in Dopaminergic Cells

The effect of resveratrol on the viability of dopaminergic N27 cells was examined by treating cells with different concentrations of resveratrol for 48 h (Fig. 1A) or with 100 µM resveratrol for various time periods (Fig. 1B). As shown in Fig. 1, resveratrol induced both dose and time-dependent decreases in dopaminergic cell numbers as compared with untreated cells. We also tested the effects of resveratrol on other neural/glial cells. PC12, H4 neuro-glioma, and BV2 microglial cells were also susceptible to resveratrol-induced cell death that was typically associated at concentrations greater than 200 µM (data not shown). Therefore, to determine the mechanism by which resveratrol triggers cell death, further studies were carried out on dopaminergic N27 cells.

To determine whether the decrease in dopaminergic N27 cell viability was attributable to apoptosis, we analyzed cell death by flow cytometry. Cells exposing phosphatidylserine which serves as a marker of apoptosis, can be labeled with a His-GFP-Annexin-V (GFPAn-V) fusion protein (Bakhshi et al. 2008; Egger et al. 2007) and loss of plasma membrane integrity is followed by uptake of propidium iodide (PI; Egger et al. 2007). Analysis of GFPAn-V/PI-stained N27 cells showed that treatment with resveratrol led to the exposure of phosphatidylserine and increased uptake of PI (Fig. 1C). These observations were quantified by flow cytometry of GFPAn-V/PI-stained cells. After 24 h of resveratrol treatment, flow cytometry analysis revealed that approximately 50% of the cells were GFPAn-V positive with 100 µM resveratrol treatment (Fig. 1C). We believe that this method may be more sensitive for measuring dying and dead cells and may explain the slight difference in the viability of N27 cells at 24 h of resveratrol treatment compared to the cell viability by MTT assay (Fig. 1B).

ER stress is defined as an imbalance between the load of client proteins facing the ER and the organelle’s ability to process that load (Rao et al. 2004a, b; Welihinda et al. 1999). This process is marked by the induction of protein expression of several ER stress sensor proteins including the GRP family of chaperone proteins (Liu et al. 1997; Rao et al. 2001, 2002a, b), phosphorylation of eIF2α (Harding et al. 2002; Rutkowski and Kaufman 2004) and upregulation of proapoptotic GADD 153/CHOP protein expression. As shown in Fig. 2A and B, resveratrol treatment of dopaminergic N27 cells resulted in the induction of protein expression of GRP94, GRP78, and proapoptotic GADD153 and also triggered increased phosphorylation of eIF2α suggesting that resveratrol triggers an ER stress response in dopaminergic N27 cells.

Figure 2.

Figure 2

Resveratrol triggers ER stress-induced cell death in dopaminergic N27cells. a Cell extracts (150 µg protein) from untreated or resveratol-treated (100 µM) dopaminergic cells were analyzed by Western blot for GRP94(94 kDa), GRP78(78 kDa), GADD153(38 kDa), or eIF2α(38 kDa). The eIF2α blot was reprobed with antiserum specific for phospho-eIF2α (40 kDa). Blots were reprobed with GAPDH antiserum to assess equality of loading. Each blot is representative of three independent experiments. b The band density (integrated density value) is expressed graphically as a percentage ratio of densitometric optical density of the protein of interest to that of GAPDH with denotations of significance obtained from statistical analyses of pooled raw data. Data (mean ± SD) are from four independent experiments. *p<0.05 relative to the band density of the untreated control sample. c Salubrinal protects cells against ER stress-induced apoptosis triggered by resveratrol. Dopaminergic N27 cells were either left untreated or exposed to resveratol (100 µM) in the presence or absence of salubrinal (15 µM). Surviving versus dead cells were analyzed by MTT assay as described in the Methods section and results are expressed as percent of untreated surviving cells. Data (mean ± SD) are from three independent experiments performed in triplicate. *p<0.05 relative to the activity of the resveratrol treated sample

Salubrinal (Sal), an inhibitor of serine/threonine phosphatase PP1, blocks dephosphorylation of eIF2α, and thereby inhibits ER stress-induced cell death. Sal also blocks cleavage of ER-specific caspase-12 and decreases misfolded protein aggregates in cells, thus lowering the chronic ER stress response and increasing cell survival (Boyce et al. 2005; Reijonen et al. 2008; Smith et al. 2005; Sokka et al. 2007). To study the effect of Sal on resveratrol-treated N27 cells, we added Sal (15 µM) in combination with resveratrol (100 µM). As shown in Fig. 2C, Sal partially blocked ER stress-induced cell death triggered by resveratrol and significantly increased the survival of dopaminergic N27 cells.

Resveratrol Triggers Caspase-Dependent ER Stress-Induced Cell Death

We and others had earlier demonstrated that ER stress-induced cell death features caspase-7 cleavage and activation (Rao et al. 2001, 2002a, b) resulting in the generation of a large and small subunit (Riedl and Salvesen 2007). We tested whether caspase-7 and caspase-3 are cleaved during ER stress-induced cell death triggered by resveratrol. As shown in Fig. 3A, resveratrol treatment of dopaminergic N27 cells resulted in the processing and cleavage of caspase-7 and caspase-3. Cleavage of caspase-7 and caspase-3 was also associated with the generation of the cleaved form of the proteins.

Figure 3.

Figure 3

Requirement of downstream caspases in ER stress-induced cell death triggered by resveratrol. a Cell-free extracts from dopaminergic N27 cells were prepared as described in the Methods section and analyzed by Western blot. Membranes were probed with anti-caspase-3 antibody or anti-caspase-7 antibody. Blots were reprobed with GAPDH antiserum to assess equality of loading. Each blot is a representative of three independent experiments. b N27 cells were treated with resveratol (100 µM) for 48 h in the presence or absence of the cell permeable caspase specific inhibitor Q-VD-OPH (25 µM). Cell extracts (50 µg protein) were incubated with 100 µM benzyloxycarbonyl-Asp Glu-Val-Asp-7-amino-4-trifluoromethylcoumarin (Z-DEVD-AFC) peptide substrate. Caspase activity was determined by measuring the release of amino-4-trifluoromethylcoumarin from the synthetic substrate using a continuous recording instrument as described in the Methods section. Caspase activity was expressed as percent of control DEVDase activity per milligram protein. Data (mean ± SD) are from three independent experiments performed in triplicate. *p<0.05 relative to the activity of the resveratrol-treated sample

Caspase activity measurements on cell extracts were also performed using Asp-Glu-Val-Asp-7-amino-4-trifluoromethylcoumarin (DEVD-AFC) as a substrate. As shown in Fig. 3B, N27 cells treated with resveratrol activated caspases as demonstrated by increased DEVDase activity. Q-VD-OPH (QVD), a broad spectrum cell-permeable caspase inhibitor (Caserta et al. 2003; Dursun et al. 2006; Yang et al. 2004) significantly suppressed the DEVDase activity triggered by resveratrol. Similarly, treatment of dopaminergic N27 cells with resveratrol in the presence of QVD significantly enhanced cell viability (data not shown).

Expression of p23 in Resveratrol-Treated Dopaminergic Cells and Effect of RNA Interference

We previously demonstrated that p23, an HSP90 co-chaperone protein, plays a role in mediating ER stress-induced cell death; p23 is cleaved to yield a 19-kD product during ER stress-induced cell death and cleavage of p23 is associated with increased cell death (Rao et al. 2006). As shown in Fig. 4A, resveratrol treatment of dopaminergic N27 cells resulted in the processing of p23 and formation of the 19-kD cleaved fragment similar to our earlier observations (Rao et al. 2006). The antibody we employed recognized both full length p23 and the 19-kD cleaved product (Fig. 4A, top panel). In addition, we also generated a neo-epitope antibody that recognized only the cleaved fragment (19 kD) in resveratrol-treated samples and not the parent p23 (Fig. 4A, center panel).

Figure 4.

Figure 4

Resveratrol triggers cleavage of caspase substrates. a Dopaminergic N27 cells were treated with resveratol (100 µM) for the indicated times. Cell extracts (100 µg of protein) were prepared as described in the Methods section and analyzed by Western blot. Membranes were probed with anti-p23 antibody or neo-specific anti-p19 antibody. Blots were reprobed with GAPDH antiserum to assess equality of loading. Each blot is representative of three independent experiments. b p23 caspase mutant (p23D142N) inhibits ER stress-induced cell death triggered by resveratrol. Dopaminergic N27 cells were either left untransfected or were transfected with 6 µg of pcDNA3, wild-type Flag-p23 or Flag-p23D142N construct. After 24 h, cells were treated with 100 µM resveratol for 24 h. Cells were gently lifted and washed once with PBS at room temperature. Surviving versus dead cells were analyzed by MTT assay as described in the Methods section and data were normalized to untreated non-transfected control set to 100%. Data (mean ± SD) are from three independent experiments performed in triplicate. c Transfection of siRNA-targeting p23. Small interfering RNAs (siRNAs) were designed to target two regions of p23. Dopaminergic N27 cells were either left untransfected (lane 1) or co-transfected with a combination of two siRNAs (80 nM) designed to target the p23 gene transcript (nucleotides 419–429 and 446–466; lane 3) as described in Methods. To estimate the efficiency of transfection, fluorescently labeled siRNA targeting the luciferase gene was used (lane 2). Cells were gently lifted 48 h after siRNA transfection and washed once with PBS at room temperature. Cell lysates were immunoblotted with anti-p23 and anti-HSP90 antibodies. None of the siRNAs inhibited the expression of HSP90. Cell extracts were also probed with anti-GAPDH as a loading control. d Effect of RNA interference on ER stress-induced cell death. Dopaminergic N27 cells were co-transfected with a combination of two siRNAs (80 nM) designed to target the p23 gene transcript (nucleotides 419–429 and 446–466) as described in Methods. 24 h after transfection, cells were exposed to resveratol (100 µM) for 24 h. Cells were gently lifted and washed once with PBS at room temperature. Surviving versus dead cells were analyzed by MTT assay as described in the Methods section and data were normalized to untreated non-transfected control levels set to 100%. Data (mean ± SD) are from three independent experiments performed in triplicate

We had also previously demonstrated that p23 is cleaved by caspases at a specific D142 site and that mutation of the caspase-susceptible p23D142N site not only blocks caspase cleavage of p23 and formation of the 19 kD product (p23ΔC18) but also attenuates ER stress-induced cell death triggered by various ER stress inducers (Rao et al. 2006). We tested whether expression of casapse mutant p23 (p23D142N) would result in a reduction of dopaminergic N27 cell death triggered by resveratrol. Cells were either left untransfected or transfected with a mock vector, Flag-p23 or Flag-p23D142N expression construct. The efficiency of transfection was monitored by immunoblot analysis using anti-Flag antibody (Chinta et al. 2008; Rao et al. 2006). The protein expression of bothWTp23 and p23D142N constructs was similar (data not shown). Following transfection, resveratrol was added to the cells and cell viability was measured 24 h later as described in Methods. As shown in Fig. 4B, while the expression of the mock vector or WTp23 did not result in a significant protection from resveratrol treatment, the caspase mutant p23 significantly suppressed dopaminergic N27 cell death triggered by resveratrol; there was a greater degree of protection in p23D142N transfected cells exposed to resveratrol as compared to mock or WTp23 transfected cells.

To complement the above results and to evaluate the effects of reducing p23 concentration in the cells, we used RNA interference (RNAi) to downregulate the expression of p23. Small interfering RNAs (siRNAs) were designed to target two regions of the p23 gene based on predicted accessible (loop) and unique (specific) regions. As shown in Fig. 4C, a combination of siRNA targeting nucleotides 419–429 and 446–466 (lane 3) was very effective in reducing the expression of p23 protein (by approximately 85%). The siRNAs did not affect the expression of HSP90 suggesting their specificity. The effect of RNAi on ER stress-induced cell death was also studied by treating dopaminergic N27 cells with resveratrol after transfection with the p23 siRNAs. As shown in Fig. 4D, downregulation of p23 expression by siRNA rendered cells more susceptible to pcd triggered by resveratrol.

Resveratrol Inhibits 20S Proteasomal Activity

To determine whether proteasome activity is altered in dopaminergic N27 cells exposed to resveratrol, 20S proteasome activity was measured in cell extracts isolated from cells exposed to 100-µM resveratrol for different time periods. Cell extracts were tested for the ability to hydrolyze the peptide substrate LLVY-AMC. As shown in Fig. 5A, resveratrol treatment of dopaminergic N27 cells led to a significant decrease (approximately 50%) in 20S proteasome activity compared to the activity in untreated cells. Inhibition of proteasome activity was also associated with increased expression of ubiquitinated proteins as analyzed by Western blotting (Fig. 5B).

Figure 5.

Figure 5

Resveratrol inhibits 20S proteasomal activity and triggers accumulation of ubiquitinated proteins. a Dopaminergic N27 cells were treated with resveratol (100 µM) for the indicated times. 20S proteasomal activity was determined by measuring the release of 7-amino-4-methylcoumarin (AMC) following cleavage of the labeled substrate. Fluorescence was measured in a Spectramax plate reader at excitation and emission wavelengths of 380 and 460 nm, respectively. Proteasomal activity was expressed as percent of relative fluorescence units of AMC from untreated cells (RFU units) per milligram protein. Data (mean ± SD) are from three independent experiments performed in triplicate; *p<0.05 relative to untreated control sample. b Dopaminergic N27 cells were treated with resveratol (100 µM) for the indicated times. Cell extracts (100 µg protein) were analyzed by immunoblotting with anti-ubiquitin antibody

Discussion

Misfolded proteins and associated ER stress are emerging as virtually constant features of neurodegenerative diseases including Parkinson’s disease (Bredesen et al. 2006; Forman et al. 2003; Holtz and O’Malley 2003; Kitamura et al. 2002; Rao et al. 2004a, b; Ryu et al. 2002; Takahashi et al. 2003). The exact mechanism by which misfolded proteins trigger dopaminergic neuronal cell death in Parkinson’s disease remains unclear. Toxins including MPTP (1-methyl 4-phenyl 1,2,3,6-tetrahydropyridine) 6-OHDA, rotenone and paraquat trigger oxidative stress and death of dopaminergic neurons suggesting that dopaminergic neurons may be particularly vulnerable to oxidative challenges (Andersen 2004). Oxidative stress results in protein modification, increased protein misfolding, and impaired degradation (Andersen 2004; Mattson 2006) ultimately triggering ER stress-associated neuronal cell death (Bredesen et al. 2006; Rao et al. 2004a, b). Thus, it is imperative to discover small molecules that can either block misfolded protein toxicity or protect cells from chronic ER stress and cell death.

Resveratrol, found in various plants like grapes and berries, has been the focus of numerous in vitro and in vivo studies owing to its multifunctional properties including antioxidant and anti-inflammatory activities, anti-platelet aggregation effects, anti-atherogenic properties, growth-inhibiting activities, immunomodulation, and chemoprevention (Calabrese et al. 2008; de Almeida et al. 2008; Hwang et al. 2008; Rubiolo et al. 2008). More recently, work from several laboratories has provided interesting insights into the effects of this compound on the life span of yeasts, worms, and flies (Bauer et al. 2004; de la Lastra and Villegas 2005; Howitz et al. 2003; Wood et al. 2004) implicating the potential of resveratrol as an antiaging agent in treating age-related human diseases.

Recently, we reported that paraquat triggers ER stress-induced cell death in dopaminergic neurons (Chinta et al. 2008). Since paraquat is known to trigger oxidative stress leading to misfolded proteins and ER stress, we turned our attention to resveratrol to see if it could perhaps block PQ-induced toxicity and cell death. Instead of rescuing the cells and to our surprise, resveratrol actually triggered ER stress and dopaminergic cell death at concentrations of 25–100 µM. The toxicity was not restricted to just dopaminergic N27 cells since other glial- and neural-like cells including PC12, BV-2 microglial cells, and H4 cells were also susceptible to resveratrol toxicity albeit at concentrations greater than 200 µM. Upon exposure to resveratrol, dopaminergic N27 cells showed marked elevation in the expression of the GRP family of proteins, phosphorylation of eIF2α and induction of GADD153 protein expression, all indicating the involvement of ER stress. Inhibition of ER stress-induced cell death by a specific PeIF2α phosphatase inhibitor salubrinal confirmed the involvement of ER stress in triggering dopaminergic N27 cell death.

Activation of caspases, inhibition of caspase-mediated cell death by a specific caspase inhibitor and cleavage of p23, all indicated involvement of a caspase-dependent cell death pathway triggered by resveratrol. While the significance of resveratrol induced p23 cleavage is still not clear, mutation of the p23D142N site attenuated the cell death process triggered by resveratrol. It is possible that p23 cleavage resulting in the 19-kD product abolishes the ability of p23 to act as an anti-apoptotic protein, thus, rendering dopaminergic cells more susceptible to pcd triggered by resveratrol (Rao et al. 2006). Similarly, the increase in apoptosis seen after downregulating p23 by siRNA supports the conclusion that p23 may play a protective role during ER stress.

Several cellular mechanisms exist by which the balance between ER protein synthesis and degradation is disrupted resulting in ER stress and cell death. Some of these include (a) inhibition of Ca2+-ATPase activity resulting in cytosolic Ca2+ accumulation (Liu et al. 1998; Yu et al. 1999), (b) disruption of protein disulfide bond formation (Nakamura and Lipton 2008; Uehara et al. 2006), and (c) inhibition of the cellular proteasome activity triggering the accumulation of proteins destined for degradation (Bush et al. 1997; Fribley and Wang 2006; Ishii et al. 2007). Our data suggest that inhibition of 20S proteasome activity triggering the accumulation of ubiquitinated proteins may be one of the mechanisms by which resveratrol triggers ER stress-induced dopaminergic cell death.

Recent reports suggest that resveratrol crosses the blood brain barrier and elicits its antioxidant properties thereby reversing oxidative and other forms of cellular stress (Blanchet et al. 2008; Bureau et al. 2008; Jin et al. 2008; Lu et al. 2008; Okawara et al. 2007; Pallas et al. 2008; Rocha-Gonzalez et al. 2008). The neuroprotective activity of resveratrol has been mostly demonstrated in slice cultures or animal models, and the concentration of resveratrol in the majority of these studies ranged from 10 to 100 µM (Blanchet et al. 2008; Bureau et al. 2008; Okawara et al. 2007; Pallas et al. 2008). Recent studies have also demonstrated the neuroprotective effects of resveratrol in animals exposed to agents that cause degeneration of dopaminergic neurons and trigger PD like symptoms including MPTP and 6-OHDA (Jin et al. 2008; Lu et al. 2008). While resveratrol was partially able to reverse the toxic effects of these drugs, none of the above studies reported the direct effects of resveratrol alone on dopaminergic neurons. One study reported the toxic effects of resveratrol towards neurons at concentrations above 25 µM in comparison to oxyresveratrol that seemed to be protective at all concentrations studied (Chao et al. 2008).

It is also interesting to note that while daily oral administration of transresveratrol to rats at doses up to 300 mg/kg of body weight for 4 weeks did not result in any apparent adverse effects, resveratrol-associated renal toxicity was observed at higher concentrations (Crowell et al. 2004; Juan et al. 2002). Similarly, there have been only a few controlled human clinical trials to date, and in these trials, resveratrol did not cause any notable adverse effects (Boocock et al. 2007; Walle et al. 2004). However, these studies did not focus on the effects in the brain. It also remains to be determined whether repeated dosing schedules can achieve higher systemic concentrations of resveratrol than those observed in the above study after a single dose and whether such high concentrations may trigger toxicity in the brain.

It is not clear from our data why neural cells and in particular dopaminergic cells are more sensitive to resveratrol toxicity. While our studies do not provide the exact mechanism by which resveratrol elicits its toxic effects, recent reports have indicated that red wine polyphenols have a propensity to stimulate H2O2 production and formation of reactive oxygen species (Duarte et al. 2004) that in some settings may trigger cellular stress. It is possible that cellular stress including oxidative and ER stress-triggered toxicity in neural cells may arise due to a high metabolic rate and lower rate of neural cell turnover compared to cells from other tissues. Neural cells, in particular dopaminergic neurons, are particularly prone to oxidative stress due to their high rate of oxygen metabolism, low levels of antioxidants, and high iron content (Andersen 2000; Andersen 2004; Mattson 2006; Rajagopalan and Andersen 2001). In addition, modification of resveratrol to some unknown metabolites including resveratrol glucuronides and sulfates (Wenzel and Somoza 2005) that may be toxic to dopaminergic neurons may be another mechanism that contributes to neural cell susceptibility to resveratrol toxicity. More experiments are needed to demonstrate unequivocally the relationship of resveratrol and ER stress and further studies in this direction would be helpful in unraveling the exact mechanism by which resveratrol exhibits toxicity towards neural and in particular dopaminergic cells.

Acknowledgements

We thank members of the Bredesen laboratory and Andersen laboratory for helpful comments and discussions and Molly Susag for administrative assistance. This work was supported by grants from the National Institutes of Health NS33376 to D.E.B. and R.V.R.

Abbreviations

ER

endoplasmic reticulum

pcd

programmed cell death

eIF2α

eukaryotic initiation factor-2 alpha

GRP

glucose-regulated protein

Contributor Information

Shankar J. Chinta, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA

Karen S. Poksay, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA

Gaayatri Kaundinya, Marin Academy, 1600 Mission Ave, San Rafael, CA 94901, USA.

Matthew Hart, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA.

Dale E. Bredesen, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA University of California, San Francisco, CA 94143, USA.

Julie K. Andersen, Email: jandersen@buckinstitute.org, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA.

Rammohan V. Rao, Email: rrao@buckinstitute.org, The Buck Institute for Age Research, 8001 Redwood Blvd., Novato, CA 94945, USA.

References

  1. Adams FS, La Rosa FG, Kumar S, Edwards-Prasad J, Kentroti S, Vernadakis A, et al. Characterization and transplantation of two neuronal cell lines with dopaminergic properties. Neurochemical Research. 1996;21:619–627. doi: 10.1007/BF02527762. [DOI] [PubMed] [Google Scholar]
  2. Andersen JK. What causes the build-up of ubiquitin-containing inclusions in Parkinson’s disease? Mechanisms of Ageing and Development. 2000;118:15–22. doi: 10.1016/s0047-6374(00)00150-0. [DOI] [PubMed] [Google Scholar]
  3. Andersen JK. Oxidative stress in neurodegeneration: Cause or consequence? Nature Medicine. 2004;10 Suppl:S18–S25. doi: 10.1038/nrn1434. [DOI] [PubMed] [Google Scholar]
  4. Bakhshi J, Weinstein L, Poksay KS, Nishinaga B, Bredesen DE, Rao RV. Coupling endoplasmic reticulum stress to the cell death program in mouse melanoma cells: Effect of curcumin. Apoptosis. 2008;13:904–914. doi: 10.1007/s10495-008-0221-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bauer JH, Goupil S, Garber GB, Helfand SL. An accelerated assay for the identification of lifespan-extending interventions in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:12980–12985. doi: 10.1073/pnas.0403493101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blanchet J, Longpre F, Bureau G, Morissette M, Dipaolo T, Bronchti G, et al. Resveratrol, a red wine polyphenol, protects dopaminergic neurons in MPTP-treated mice. Progress in Neuro-Psychopharmacology & Biological Psychiatry. 2008;32:1243–1250. doi: 10.1016/j.pnpbp.2008.03.024. [DOI] [PubMed] [Google Scholar]
  7. Boocock DJ, Faust GE, Patel KR, Schinas AM, Brown VA, Ducharme MP, et al. Phase I dose escalation pharmacokinetic study in healthy volunteers of resveratrol, a potential cancer chemopreventive agent. Cancer Epidemiology, Biomarkers & Prevention. 2007;16:1246–1252. doi: 10.1158/1055-9965.EPI-07-0022. [DOI] [PubMed] [Google Scholar]
  8. Boyce M, Bryant KF, Jousse C, Long K, Harding HP, Scheuner D, et al. A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress. Science. 2005;307:935–939. doi: 10.1126/science.1101902. [DOI] [PubMed] [Google Scholar]
  9. Bredesen DE, Rao RV, Mehlen P. Cell death in the nervous system. Nature. 2006;443:796–802. doi: 10.1038/nature05293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bureau G, Longpre F, Martinoli MG. Resveratrol and quercetin, two natural polyphenols, reduce apoptotic neuronal cell death induced by neuroinflammation. Journal of Neuroscience Research. 2008;86:403–410. doi: 10.1002/jnr.21503. [DOI] [PubMed] [Google Scholar]
  11. Bush KT, Goldberg AL, Nigam SK. Proteasome inhibition leads to a heat-shock response, induction of endoplasmic reticulum chaperones, and thermotolerance. The Journal of Biological Chemistry. 1997;272:9086–9092. doi: 10.1074/jbc.272.14.9086. [DOI] [PubMed] [Google Scholar]
  12. Calabrese V, Cornelius C, Mancuso C, Pennisi G, Calafato S, Bellia F, et al. Cellular stress response: a novel target for chemoprevention and nutritional neuroprotection in aging, neurodegenerative disorders and longevity. Neurochemical Research. 2008;33(12):2444–2471. doi: 10.1007/s11064-008-9775-9. [DOI] [PubMed] [Google Scholar]
  13. Caserta TM, Smith AN, Gultice AD, Reedy MA, Brown TL. Q-VD-OPh, a broad spectrum caspase inhibitor with potent antiapoptotic properties. Apoptosis. 2003;8:345–352. doi: 10.1023/a:1024116916932. [DOI] [PubMed] [Google Scholar]
  14. Chao J, Yu MS, Ho YS, Wang M, Chang RC. Dietary oxyresveratrol prevents parkinsonian mimetic 6-hydroxydopamine neurotoxicity. Free Radical Biology & Medicine. 2008;45:1019–1026. doi: 10.1016/j.freeradbiomed.2008.07.002. [DOI] [PubMed] [Google Scholar]
  15. Chinta SJ, Andersen JK. Reversible inhibition of mitochondrial complex I activity following chronic dopaminergic glutathione depletion in vitro: Implications for Parkinson’s disease. Free Radical Biology & Medicine. 2006;41:1442–1448. doi: 10.1016/j.freeradbiomed.2006.08.002. [DOI] [PubMed] [Google Scholar]
  16. Chinta SJ, Rane A, Poksay KS, Bredesen DE, Andersen JK, Rao RV. Coupling endoplasmic reticulum stress to the cell death program in dopaminergic cells: effect of paraquat. Neuromolecular Medicine. 2008 doi: 10.1007/s12017-008-8047-9. Epub ahead of print. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Clarkson ED, Rosa FG, Edwards-Prasad J, Weiland DA, Witta SE, Freed CR, et al. Improvement of neurological deficits in 6-hydroxydopamine-lesioned rats after transplantation with allogeneic simian virus 40 large tumor antigen gene-induced immortalized dopamine cells. Proceedings of the National Academy of Sciences of the United States of America. 1998;95:1265–1270. doi: 10.1073/pnas.95.3.1265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Crowell JA, Korytko PJ, Morrissey RL, Booth TD, Levine BS. Resveratrol-associated renal toxicity. Toxicological Sciences. 2004;82:614–619. doi: 10.1093/toxsci/kfh263. [DOI] [PubMed] [Google Scholar]
  19. de Almeida LM, Leite MC, Thomazi AP, Battu C, Nardin P, Tortorelli LS, et al. Resveratrol protects against oxidative injury induced by H(2)O(2) in acute hippocampal slice preparations from Wistar rats. Archives of Biochemistry and Biophysics. 2008;480(1):27–32. doi: 10.1016/j.abb.2008.09.006. [DOI] [PubMed] [Google Scholar]
  20. de la Lastra CA, Villegas I. Resveratrol as an anti-inflammatory and anti-aging agent: Mechanisms and clinical implications. Molecular Nutrition & Food Research. 2005;49:405–430. doi: 10.1002/mnfr.200500022. [DOI] [PubMed] [Google Scholar]
  21. Duarte J, Andriambeloson E, Diebolt M, Andriantsitohaina R. Wine polyphenols stimulate superoxide anion production to promote calcium signaling and endothelial-dependent vasodilatation. Physiological Research. 2004;53:595–602. [PubMed] [Google Scholar]
  22. Dursun B, He Z, Somerset H, Oh DJ, Faubel S, Edelstein CL. Caspases and calpain are independent mediators of cisplatin-induced endothelial cell necrosis. American Journal of Physiology. Renal Physiology. 2006;291:F578–F587. doi: 10.1152/ajprenal.00455.2005. [DOI] [PubMed] [Google Scholar]
  23. Egger L, Madden DT, Rheme C, Rao RV, Bredesen DE. Endoplasmic reticulum stress-induced cell death mediated by the proteasome. Cell Death and Differentiation. 2007;14:1172–1180. doi: 10.1038/sj.cdd.4402125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ellerby HM, Martin SJ, Ellerby LM, Naiem SS, Rabizadeh S, Salvesen GS, et al. Establishment of a cell-free system of neuronal apoptosis: Comparison of premitochondrial, mitochondrial, and postmitochondrial phases. The Journal of Neuroscience. 1997;17:6165–6178. [PMC free article] [PubMed] [Google Scholar]
  25. Forman MS, Lee VM, Trojanowski JQ. ‘Unfolding’ pathways in neurodegenerative disease. Trends in Neurosciences. 2003;26:407–410. doi: 10.1016/S0166-2236(03)00197-8. [DOI] [PubMed] [Google Scholar]
  26. Fribley A, Wang CY. Proteasome inhibitor induces apoptosis through induction of endoplasmic reticulum stress. Cancer Biology & Therapy. 2006;5:745–748. doi: 10.4161/cbt.5.7.2971. [DOI] [PubMed] [Google Scholar]
  27. Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional and translational control in the Mammalian unfolded protein response. Annual Review of Cell and Developmental Biology. 2002;18:575–599. doi: 10.1146/annurev.cellbio.18.011402.160624. [DOI] [PubMed] [Google Scholar]
  28. Holtz WA, O’Malley KL. Parkinsonian mimetics induce aspects of unfolded protein response in death of dopaminergic neurons. The Journal of Biological Chemistry. 2003;278:19367–19377. doi: 10.1074/jbc.M211821200. [DOI] [PubMed] [Google Scholar]
  29. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, et al. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature. 2003;425:191–196. doi: 10.1038/nature01960. [DOI] [PubMed] [Google Scholar]
  30. Hwang JT, Kwon DY, Park OJ, Kim MS. Resveratrol protects ROS-induced cell death by activating AMPK in H9c2 cardiac muscle cells. Genes and Nutrition. 2008;2:323–326. doi: 10.1007/s12263-007-0069-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ishii Y, Waxman S, Germain D. Targeting the ubiquitin-proteasome pathway in cancer therapy. Anti-cancer Agents in Medicinal Chemistry. 2007;7:359–365. doi: 10.2174/187152007780618180. [DOI] [PubMed] [Google Scholar]
  32. Jin F, Wu Q, Lu YF, Gong QH, Shi JS. Neuroprotective effect of resveratrol on 6-OHDA-induced Parkinson’s disease in rats. European Journal of Pharmacology. 2008;600(1–3):78–82. doi: 10.1016/j.ejphar.2008.10.005. [DOI] [PubMed] [Google Scholar]
  33. Juan ME, Vinardell MP, Planas JM. The daily oral administration of high doses of trans-resveratrol to rats for 28 days is not harmful. The Journal of Nutrition. 2002;132:257–260. doi: 10.1093/jn/132.2.257. [DOI] [PubMed] [Google Scholar]
  34. Kaufman RJ. Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes & Development. 1999;13:1211–1233. doi: 10.1101/gad.13.10.1211. [DOI] [PubMed] [Google Scholar]
  35. Kitamura Y, Inden M, Miyamura A, Kakimura J, Taniguchi T, Shimohama S. Possible involvement of both mitochondria-and endoplasmic reticulum-dependent caspase pathways in rotenone-induced apoptosis in human neuroblastoma SH-SY5Y cells. Neuroscience Letters. 2002;333:25–28. doi: 10.1016/s0304-3940(02)00964-3. [DOI] [PubMed] [Google Scholar]
  36. Kopito RR. Aggresomes, inclusion bodies and protein aggregation. Trends in Cell Biology. 2000;10:524–530. doi: 10.1016/s0962-8924(00)01852-3. [DOI] [PubMed] [Google Scholar]
  37. Liu H, Bowes RC, 3rd, van de Water B, Sillence C, Nagelkerke JF, Stevens JL. Endoplasmic reticulum chaperones GRP78 and calreticulin prevent oxidative stress, Ca2+ disturbances, and cell death in renal epithelial cells. The Journal of Biological Chemistry. 1997;272:21751–21759. doi: 10.1074/jbc.272.35.21751. [DOI] [PubMed] [Google Scholar]
  38. Liu H, Miller E, van de Water B, Stevens JL. Endoplasmic reticulum stress proteins block oxidant-induced Ca2 + increases and cell death. The Journal of Biological Chemistry. 1998;273:12858–12862. doi: 10.1074/jbc.273.21.12858. [DOI] [PubMed] [Google Scholar]
  39. Lu KT, Ko MC, Chen BY, Huang JC, Hsieh CW, Lee MC, et al. Neuroprotective effects of resveratrol on MPTP-induced neuron loss mediated by free radical scavenging. Journal of Agricultural and Food Chemistry. 2008;56:6910–6913. doi: 10.1021/jf8007212. [DOI] [PubMed] [Google Scholar]
  40. Ma Y, Hendershot LM. The mammalian endoplasmic reticulum as a sensor for cellular stress. Cell Stress & Chaperones. 2002;7:222–229. doi: 10.1379/1466-1268(2002)007<0222:tmeraa>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mattson MP. Neuronal life-and-death signaling, apoptosis, and neurodegenerative disorders. Antioxidants & Redox Signalling. 2006;8:1997–2006. doi: 10.1089/ars.2006.8.1997. [DOI] [PubMed] [Google Scholar]
  42. Nakamura T, Lipton SA. Emerging roles of S-nitrosylation in protein misfolding and neurodegenerative diseases. Antioxidants & Redox Signalling. 2008;10:87–101. doi: 10.1089/ars.2007.1858. [DOI] [PubMed] [Google Scholar]
  43. Okawara M, Katsuki H, Kurimoto E, Shibata H, Kume T, Akaike A. Resveratrol protects dopaminergic neurons in midbrain slice culture from multiple insults. Biochemical Pharmacology. 2007;73:550–560. doi: 10.1016/j.bcp.2006.11.003. [DOI] [PubMed] [Google Scholar]
  44. Pallas M, Verdaguer E, Tajes M, Gutierrez-Cuesta J, Camins A. Modulation of sirtuins: New targets for antiageing. Recent Patents CNS Drug Discov. 2008;3:61–69. doi: 10.2174/157488908783421492. [DOI] [PubMed] [Google Scholar]
  45. Paschen W, Frandsen A. Endoplasmic reticulum dysfunction-a common denominator for cell injury in acute and degenerative diseases of the brain? Journal of Neurochemistry. 2001;79:719–725. doi: 10.1046/j.1471-4159.2001.00623.x. [DOI] [PubMed] [Google Scholar]
  46. Rajagopalan S, Andersen JK. Alpha synuclein aggregation: Is it the toxic gain of function responsible for neurodegeneration in Parkinson’s disease? Mechanisms of Ageing and Development. 2001;122:1499–1510. doi: 10.1016/s0047-6374(01)00283-4. [DOI] [PubMed] [Google Scholar]
  47. Rao RV, Bredesen DE. Misfolded proteins, endoplasmic reticulum stress and neurodegeneration. Current Opinion in Cell Biology. 2004;16:653–662. doi: 10.1016/j.ceb.2004.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rao RV, Hermel E, Castro-Obregon S, del Rio G, Ellerby LM, Ellerby HM, et al. Coupling endoplasmic reticulum stress to the cell death program. Mechanism of caspase activation. The Journal of Biological Chemistry. 2001;276:33869–33874. doi: 10.1074/jbc.M102225200. [DOI] [PubMed] [Google Scholar]
  49. Rao RV, Castro-Obregon S, Frankowski H, Schuler M, Stoka V, Del Rio G, et al. Coupling Endoplasmic Reticulum Stress to the Cell Death Program. AN Apaf-1-INDEPENDENT INTRINSIC PATHWAY. The Journal of Biological Chemistry. 2002a;277:21836–21842. doi: 10.1074/jbc.M202726200. [DOI] [PubMed] [Google Scholar]
  50. Rao RV, Peel A, Logvinova A, del Rio G, Hermel E, Yokota T, et al. Coupling endoplasmic reticulum stress to the cell death program: Role of the ER chaperone GRP78. FEBS Letters. 2002b;514:122–128. doi: 10.1016/s0014-5793(02)02289-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rao RV, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program. Cell Death and Differentiation. 2004a;11:372–380. doi: 10.1038/sj.cdd.4401378. [DOI] [PubMed] [Google Scholar]
  52. Rao RV, Poksay KS, Castro-Obregon S, Schilling B, Row RH, Del Rio G, et al. Molecular components of a cell death pathway activated by endoplasmic reticulum stress. The Journal of Biological Chemistry. 2004b;279:177–187. doi: 10.1074/jbc.M304490200. [DOI] [PubMed] [Google Scholar]
  53. Rao RV, Niazi K, Mollahan P, Mao X, Crippen D, Poksay KS, et al. Coupling endoplasmic reticulum stress to the cell-death program: A novel HSP90-independent role for the small chaperone protein p23. Cell Death and Differentiation. 2006;13:415–425. doi: 10.1038/sj.cdd.4401761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Reijonen S, Putkonen N, Norremolle A, Lindholm D, Korhonen L. Inhibition of endoplasmic reticulum stress counteracts neuronal cell death and protein aggregation caused by N-terminal mutant huntingtin proteins. Experimental Cell Research. 2008;314:950–960. doi: 10.1016/j.yexcr.2007.12.025. [DOI] [PubMed] [Google Scholar]
  55. Riedl SJ, Salvesen GS. The apoptosome: Signalling platform of cell death. Nature Reviews. Molecular Cell Biology. 2007;8:405–413. doi: 10.1038/nrm2153. [DOI] [PubMed] [Google Scholar]
  56. Rocha-Gonzalez HI, Ambriz-Tututi M, Granados-Soto V. Resveratrol: A natural compound with pharmacological potential in neurodegenerative diseases. CNS Neurosci Ther. 2008;14:234–247. doi: 10.1111/j.1755-5949.2008.00045.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Ron D. Translational control in the endoplasmic reticulum stress response. The Journal of Clinical Investigation. 2002;110:1383–1388. doi: 10.1172/JCI16784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Rubiolo JA, Mithieux G, Vega FV. Resveratrol protects primary rat hepatocytes against oxidative stress damage: Activation of the Nrf2 transcription factor and augmented activities of antioxidant enzymes. European Journal of Pharmacology. 2008;591:66–72. doi: 10.1016/j.ejphar.2008.06.067. [DOI] [PubMed] [Google Scholar]
  59. Rutkowski DT, Kaufman RJ. A trip to the ER: Coping with stress. Trends in Cell Biology. 2004;14:20–28. doi: 10.1016/j.tcb.2003.11.001. [DOI] [PubMed] [Google Scholar]
  60. Ryu EJ, Harding HP, Angelastro JM, Vitolo OV, Ron D, Greene LA. Endoplasmic reticulum stress and the unfolded protein response in cellular models of Parkinson’s disease. The Journal of Neuroscience. 2002;22:10690–10698. doi: 10.1523/JNEUROSCI.22-24-10690.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sitia R, Braakman I. Quality control in the endoplasmic reticulum protein factory. Nature. 2003;426:891–894. doi: 10.1038/nature02262. [DOI] [PubMed] [Google Scholar]
  62. Smith WW, Jiang H, Pei Z, Tanaka Y, Morita H, Sawa A, et al. Endoplasmic reticulum stress and mitochondrial cell death pathways mediate A53T mutant alpha-synuclein-induced toxicity. Human Molecular Genetics. 2005;14:3801–3811. doi: 10.1093/hmg/ddi396. [DOI] [PubMed] [Google Scholar]
  63. Sokka AL, Putkonen N, Mudo G, Pryazhnikov E, Reijonen S, Khiroug L, et al. Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain. The Journal of Neuroscience. 2007;27:901–908. doi: 10.1523/JNEUROSCI.4289-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Takahashi R, Imai Y, Hattori N, Mizuno Y. Parkin and endoplasmic reticulum stress. Annals of the New York Academy of Sciences. 2003;991:101–106. doi: 10.1111/j.1749-6632.2003.tb07467.x. [DOI] [PubMed] [Google Scholar]
  65. Uehara T, Nakamura T, Yao D, Shi ZQ, Gu Z, Ma Y, et al. S-nitrosylated protein-disulphide isomerase links protein misfolding to neurodegeneration. Nature. 2006;441:513–517. doi: 10.1038/nature04782. [DOI] [PubMed] [Google Scholar]
  66. Walle T, Hsieh F, DeLegge MH, Oatis JE, Jr, Walle UK. High absorption but very low bioavailability of oral resveratrol in humans. Drug Metabolism and Disposition: The Biological Fate of Chemicals. 2004;32:1377–1382. doi: 10.1124/dmd.104.000885. [DOI] [PubMed] [Google Scholar]
  67. Welihinda AA, Tirasophon W, Kaufman RJ. The cellular response to protein misfolding in the endoplasmic reticulum. Gene Expression. 1999;7:293–300. [PMC free article] [PubMed] [Google Scholar]
  68. Wenzel E, Somoza V. Metabolism and bioavailability of trans-resveratrol. Molecular Nutrition & Food Research. 2005;49:472–481. doi: 10.1002/mnfr.200500010. [DOI] [PubMed] [Google Scholar]
  69. Wood JG, Rogina B, Lavu S, Howitz K, Helfand SL, Tatar M, et al. Sirtuin activators mimic caloric restriction and delay ageing in metazoans. Nature. 2004;430:686–689. doi: 10.1038/nature02789. [DOI] [PubMed] [Google Scholar]
  70. Yang L, Sugama S, Mischak RP, Kiaei M, Bizat N, Brouillet E, et al. A novel systemically active caspase inhibitor attenuates the toxicities of MPTP, malonate, and 3NP in vivo. Neurobiology of Disease. 2004;17:250–259. doi: 10.1016/j.nbd.2004.07.021. [DOI] [PubMed] [Google Scholar]
  71. Yu Z, Luo H, Fu W, Mattson MP. The endoplasmic reticulum stress-responsive protein GRP78 protects neurons against excitotoxicity and apoptosis: Suppression of oxidative stress and stabilization of calcium homeostasis. Experimental Neurology. 1999;155:302–314. doi: 10.1006/exnr.1998.7002. [DOI] [PubMed] [Google Scholar]
  72. Zhou W, Hurlbert MS, Schaack J, Prasad KN, Freed CR. Overexpression of human alpha-synuclein causes dopamine neuron death in rat primary culture and immortalized mesencephalon-derived cells. Brain Research. 2000;866:33–43. doi: 10.1016/s0006-8993(00)02215-0. [DOI] [PubMed] [Google Scholar]

RESOURCES