Secretin as a neurohypophysial factor regulating body water homeostasis

Abstract

Hypothalamic magnocellular neurons express either one of the neurohypophysial hormones, vasopressin or oxytocin, along with different neuropeptides or neuromodulators. Axonal terminals of these neurons are generally accepted to release solely the two hormones but not others into the circulation. Here, we show that secretin, originally isolated from upper intestinal mucosal extract, is present throughout the hypothalamo–neurohypophysial axis and that it is released from the posterior pituitary under plasma hyperosmolality conditions. In the hypothalamus, it stimulates vasopressin expression and release. Considering these findings together with our previous findings that show a direct effect of secretin on renal water reabsorption, we propose here that secretin works at multiple levels in the hypothalamus, pituitary, and kidney to regulate water homeostasis. Findings presented here challenge previous understanding regarding the neurohypophysis and could provide new concepts in treating disorders related to osmoregulation.

The pituitary is essential for life. It consists of adenohypophysis and neurohypophysis and is responsible for the release of hormones that regulate all major body functions, including water homeostasis, blood pressure, growth, development, and reproduction. Currently, only two nonapeptide hormones, vasopressin (Vp) and oxytocin (Oxt), are widely accepted to be released from the neurohypophysis. The two peptides differ by a single amino acid substitution and are synthesized within the magnocellular neurosecretory cells in the paraventricular nucleus (PVN) and supraoptic nucleus (SON). Oxytocin is best known for its role in parturition and lactation, whereas Vp is critical to water conservation in the renal collecting ducts via translocation and expression of aquaporin-2 (AQP2). In addition to Vp, many studies have indicated the presence of Vp-independent mechanisms in the kidney. In isolated collecting duct segments, Jeon et al. (1) found that the highest plasma concentration of Vp (10 pM) under severe dehydration could increase osmotic water permeability to only 44% of the maximal value. Our group has shown recently that secretin (SCT), a hormone that modulates water and electrolyte transport in pancreatic ductal cells (2), liver cholangiocytes (3, 4), and epididymal epithelial cells (5), is part of the Vp-independent mechanisms in regulating renal water reabsorption (6). Because we observed changes in plasma SCT levels during chronic hyperosmolality and the presence of intense SCT-immunoreactivity (IR) signals in the posterior pituitary, the present study intended to investigate a putative role of SCT as a pituitary hormone in the hypothalamo–neurohypophysial system, a central integrative structure that regulates coordinated responses to perturbations in water balance and osmotic stability.

Results and Discussion

Secretin Induces Expression of the Immediate Early Gene c-fos in the Vasopressinergic Neurons of the Hypothalamic PVN and SON.

The concentrations of SCT and Vp were 122 ± 6 and 142 ± 35 ng/g of protein in the rat hypothalamus and 799 ± 87 and 4,684 ± 426 ng/g of protein in the rat pituitary. Consistent with previous findings that showed a high concentration of SCT in the neurointermediate lobe of pituitary (7), the current study revealed intense IR signals for both SCT and its receptor (SCTR) almost exclusively in the posterior lobe (Fig. 1A), where they were distributed evenly throughout the neuronal fibers with SCT-IR enriched in Herring bodies and axonal terminals but not in pituicytes. In the hypothalamus, abundant SCT and SCTR were detected primarily in the PVN and SON by both in situ hybridization and immunohistochemical staining (Fig. 1B). These findings are in agreement with previous studies showing distinct localization of SCT-IR to the PVN and SON and intercalated hypothalamic nuclei (8) and binding of ¹²⁵I-SCT to hypothalamic homogenate (9). Additionally, SCT-IR was found throughout the hypothalamo–neurohypophysial tracts. Within SON, SCT and SCTR were found to be present in the magnocellular neurons (>20 μm) and in the varicose or beaded fibers located in the ventral position of the nucleus, whereas within the PVN high proportions of large (>20 μm) and small (<20 μm) neurons were shown to express SCT and SCTR. The latter findings indicated that SCT and SCTR are expressed in both parvocellular and magnocellular subdivisions of the PVN.

Fig. 1.

Cellular distribution of secretin (SCT) and SCT receptor (SCTR) in the hypothalamus and pituitary. (Ai) SCT and SCTR immunoreactivity (IR) in a panoramic view of the pituitary. Both SCT and SCTR were shown to localize almost exclusively in the pars nervosa but not in the pars distalis and pars intermedia of the adenohypophysis. Negative controls (SCT-1 and SCT-2) were performed using primary SCT antiserum preabsorbed with 0.1 mM SCT and pituitary andenylate cyclase-activating polypeptide (PACAP), respectively. SCTR-1, primary SCTR antiserum preabsorbed with 0.1 mM immunizing peptide; SCTR-2, prebleed rabbit serum as primary antiserum; PN, pars nervosa; PI, pars intermedia; PD, pars distalis. (Aii) Bright-field photomicrograph of a rat pituitary section labeled with anti-SCT antiserum. SCT-IR is shown in brown against a blue background of hematoxylin staining. Note that intensely stained structures of various sizes (arrows) are present in the neurohypophysis, representing dilations of the axon formally known as Herring bodies. Negative controls as in A1 were not shown. (B1 and B2) Localization of SCT and SCTR in the paraventricular nucleus (PVN) and supraoptic nucleus (SON). (Bi) SCTR-IR was observed in the soma of magnocellular neurons, whereas SCT-IR was found in both the soma and the axonal projections (arrow) of the parvocellular and magnocellular neurons. (Bii) In situ hybridization showing the presence of SCT and SCTR transcripts within the PVN and SON. The riboprobes for SCT and SCTR were made reverse and complementary to sequences corresponding to base pairs 34–488 of the rat SCT (GenBank accession no. NM_022670) and 211–639 that encode the N-terminal extracellular region of the rat SCTR (GenBank accession no. NM_031115) cDNAs, respectively. (Biii) Localization of SCT in the hypothalamo–neurohypophysial tracts. The SCT-containing axons were shown to project laterally from the PVN and run inferiorly above and below the fornix toward the SON. Processes from the SON then cross ventrally to these axonal tracts from the PVN and continue medially along the basal of hypothalamus to the median eminence.

To investigate the potential activity of SCT within the hypothalamus, the expression of the immediate early Fos protein, which is a well-established marker to identify activated neurons in the autonomous and central nervous system after chemical, mechanical, or sensory stimuli, was examined 1 h after intracerebroventricular (ICV) injection of SCT. Fig. 2A shows the effects of SCT on activating Fos-IR in the rat hypothalamus compared with that of the saline control. In control rats treated with isotonic saline, in agreement with Pirnik et al. (10), Chang et al. (11), and Kobelt et al. (12), no Fos signal was found in neither the PVN nor the SON. In SCT-injected rats, however, Fos-IR was detected over the whole areas of the PVN and SON. The Fos signals were found only in the nuclei of certain magnocellular neurons in the PVN and SON, thereby suggesting a regulated and differential response to SCT among individual magnocellular cells.

Fig. 2.

Hypothalamic neuronal activation after secretin (SCT) treatment. (A) Fos-IR in the rat paraventricular nucleus (PVN) and supraoptic nucleus (SON) 1 h after intracerebroventricular administration of vehicle (C) or SCT. Low levels of Fos-IR were observed in the PVN and SON after saline injection (C). Injection of 0.45 μg of SCT, however, induced Fos expression in magnocellular neurons of both the PVN and the SON. 3V, third ventricle. (B) Localization of SCT-induced Fos (F) in Vp- and Oxt-containing magnocellular neurons. Fos-IR was observed in the nuclei of Vp-expressing cells (arrows). M, merged image. (C) Secretin-induced changes in Vp and Oxt gene expression in the rat hypothalamic PVN and SON. Values are shown as means ± SEM fold changes compared with expression levels of Vp or Oxt in control animals (PBS-infused control group, n = 3; SCT-infused group, n = 4). (D) Effects of SCT on the release of Vp in vitro and in vivo. (Di) SCT stimulates Vp release from rat hypothalamic explants. This effect is specific to SCT and is mediated via a PKA-dependent pathway, because it was abrogated in the presence of the SCT antagonist secretin-(5–27) or the PKA inhibitor H89. After a 40-min preequilibrium period and two 5-min incubations (10 and 5 min) in normal artificial cerebrospinal fluid (ACSF) medium to determine basal release, the explants in treatment group were stimulated with 100 nM SCT (5 and 10 min). For the control, explants were incubated in ACSF solution at all time points. (Dii) Centrally injected SCT triggers Vp release into peripheral circulation by sampling blood from the right jugular vein. The Vp levels after SCT injection were compared with the baseline level at time 0, *, P < 0.01. (Diii) SCT is not able to trigger Vp release from rat pituitary explants. Experimental conditions were the same as those in Di.

SCT Induces Vp Gene Expression and Its Secretion from the Hypothalamo–Pituitary Axis.

To identify the downstream mechanism of SCT, double-immunofluorescent labeling of Fos with either Vp or Oxt was performed (Fig. 2B). Up-regulation of Fos was observed in the cytoplasm of both Vp- and Oxt-expressing neurons, whereas Fos protein was detected only within the nuclei of vasopressinergic neurons but not in the nuclei of oxytocinergic neurons. Expression of this immediate early gene in magnocellular cells has been shown already to link various physiological stimulations to Vp gene expression (13–15). Thus, we hypothesized that SCT could stimulate Vp expression via the cAMP/protein kinase A (PKA)/Fos pathway. To test this hypothesis, ICV injection of SCT coupled to laser capture microdissection and real-time PCR (Fig. 2C) was performed. The ICV-SCT markedly up-regulated Vp transcript levels in the PVN and SON (64.1 ± 13.5-fold in PVN and 51.9 ± 17.6-fold in SON) and to a lesser extent Oxt expression (5.9 ± 1.9-fold in PVN and 1.7 ± 0.5-fold in SON). Neurons residing in the PVN were found to be more responsive than those in the SON to SCT stimulation. We next tested whether SCT could modulate locally the release of Vp from and within the hypothalamo–neurohypophysial axis (Fig. 2D). Our in vitro data indicated that Vp is spontaneously released from hypothalamic and pituitary explants (0.031 ± 0.0005 and 0.967 ± 0.041 ng/mL from hypothalamic and pituitary explants, respectively), and 100 nM SCT could increase markedly Vp release from the hypothalamic explants, reaching 0.131 ± 0.02 ng/mL after 5 min of incubation (Fig. 2Di). This effect was SCT-specific and PKA-dependent, because coincubation of the antagonist secretin (5–27) (1 μM) or PKA inhibitor H89 (5 μM) could reduce significantly the SCT-evoked Vp release. In in vivo studies, ICV administration of SCT (0.45 μg) was able to increase Vp concentrations in blood samples collected from the right jugular vein (Fig. 2Dii). The plasma Vp levels in SCT-treated rats reached 3.78-fold within 30 min compared with those at time 0 or before peptide injection. Note also that Vp levels of control animals remained relatively constant throughout the sampling period, indicating that the observed changes in Vp levels were not due to acute hypovolemia nor the experimental procedure. Because SCT could not induce Vp release from isolated pituitary (Fig. 2Diii), SCT therefore should stimulate Vp release into the circulation via direct modulation of the activity of vasopressinergic neurons at the hypothalamus rather than at their axonal terminals in the neurohypophysis. Thus, the stimulatory effect of SCT on Vp release appears to require the integrity of the hypothalamo–neurohypophysial structure.

SCT Is a Neurosecretory Hormone Released from the Posterior Pituitary into the Systemic Circulation in Response to Hyperosmolality.

To extend our previous study showing the function of SCT in regulating water reabsorption in kidney tubules (6), we monitored changes in the expression of SCT and SCTR in response to an increase in plasma osmolality by dehydration (Fig. 3A). The basal hypothalamic SCT and Vp mRNA levels in ad libitum animals were 1.42 ± 0.13 and 8.34 ± 0.27 fmol/hypothalamus, respectively. After 3 days of water deprivation, which should cause chronic hypovolemia (16, 17), SCT and SCTR expression levels were elevated significantly in the hypothalamus and pituitary (SCT, 1.58 ± 0.11-fold in hypothalamus and 3.74 ± 1.05-fold in pituitary; SCTR, 1.95 ± 0.20-fold in hypothalamus and 3.10 ± 0.55-fold in pituitary). These data, together with SCT's effects in augmenting Vp synthesis and release (Fig. 2 C and D), implicated the importance of SCT in contributing to a sustained elevation of Vp levels during extended periods of hyperosmolality or during dehydration.

Fig. 3.

Up-regulation and release of SCT in or from the hypothalamo–neurohypophysial axis during plasma hyperosmolality. (A) Up-regulation of SCT and SCTR expression in the hypothalamus and pituitary after water deprivation. Data are presented as means ± SEM. Asterisks indicate statistically significant differences (P < 0.05) when the water-deprived animals were compared with control animals. (B) Effects of chronic hyperosmolality on daily plasma SCT levels. Tap water was available ad libitum to the control group, whereas restricted water access or 0.9% saline was given to the treatment group. Blood was withdrawn daily from the tail to prepare plasma for the measurement of SCT using a rat SCT enzyme immunoassay kit (n = 6–9). *, P < 0.05 and **, P < 0.01 vs. basal value. (C) Release of SCT from rat pituitaries in response to depolarization with 80 mM K⁺. (Ci) Neuronal depolarization triggers SCT release from pituitary explants. After a 40-min preequilibrium period and two 5-min incubations (10 and 5 min) in normal artificial cerebrospinal fluid (ACSF) medium to determine basal release, the explants in the treatment group were stimulated for 5 min with 80 mM K⁺. Control experiments were performed without K⁺ treatment. Basal release was found to be relatively constant over time. (Cii) Action-potential- and Ca²⁺-mediated release of SCT from the pituitary. Outflow of SCT from pituitary explants was evoked by 80 mM K⁺ alone or in the presence of toxin or channel blocker. The toxins used were 1 μM TTX, 100 μM high-voltage-activated calcium channel blocker CdCl₂ (Cd²⁺), 100 μM low-voltage-activated calcium channel blocker NiCl₂ (Ni²⁺), 90 nM ω-agatoxin IVA (ω-Aga), 5 μM nicardipine, 300 nM Q-type calcium channel blocker ω-conotoxin MVIIC (MVIIC), 100 nM ω-conotoxin GVIA (GVIA), and 30 nM SNX-482. Results are presented in mean fold changes ± SEM of three to five determinations each in triplicate. Comparison of treated groups and controls was based on ANOVA for multiple comparisons followed by the Student–Newman–Keuls test. *, P < 0.05 and **, P < 0.01 vs. basal SCT outflow; *, P < 0.05 and **, P < 0.01 vs. K⁺-evoked SCT outflow. (D) Secretin levels in circulation upon stimulation of the PVN. (Di) Blood samples (150 μL) were collected for a duration of 5 min from the jugular vein through an indwelling catheter after 2 min of repeated monopolar pulse stimulation at various current intensities (0.1-ms pulses at 50 Hz, 10 s on, 10 s off, 100–500 μA). (Dii) Blood samples (150 μL) were collected every 4 min from the jugular vein from 12 min before to 44 min (4-min interval) after a 200-μA monopolar pulse stimulation (indicated with an arrow; 0.1-ms pulses at 50 Hz, 10 s) of the PVN. *, P < 0.05; **, P < 0.01.

Table 1.

Oligonucleotides used in this study

Name	Sequence (5′ → 3′)
rGAPDH-F	ATGACTCTACCCACGGCAAG
rGAPDH-R	CTGGAAGATGGTGATGGGTT
rSCT-F	GCCCGTCCCAAGCCATTAG
rSCT-R	ATGGTCGACAGCAGGCCTTGGT
rSCTR-F	CAGAACGCAAAGGGGAGCAACAGTG
rSCTR-R	TGAGTTTCAGCAGGTACGCATGCCG
rVP-F	GCAAGAGGGCCACATCCGACAT
rVP-R	TCGGCCACGCAGCTCTCATC
rOXT-F	AAGAGGGCTGCGCTAGACCT
rOXT-R	CTCGGAGAAGGCAGACTCAG

Because we also observed changes in plasma SCT levels in mice under water deprivation (6), the effects of chronic hyperosmolality on plasma SCT levels in rats therefore were monitored. This was accomplished by subjecting rats to 4 days of restricted water access or 5 days of 0.9% saline consumption, both of which are well-established dehydration paradigms to promote persistent secretion of Vp (16). In our study, the basal levels of SCT and Vp in plasma were 0.074 ± 0.004 and 0.116 ± 0.008 ng/mL, respectively. During chronic hyperosmolality, plasma SCT concentrations also were elevated, reaching 0.554 ± 0.092 ng/mL on the fourth day of water restriction and 0.733 ± 0.056 ng/mL on the fifth day of saline consumption (Fig. 3B). Although our data do not exclude that changes in plasma SCT levels could be caused by stress inherent in the dehydration paradigms, we showed here that SCT is released from its source into the circulation in chronic hyperosmotic conditions.

All of the data presented in this work support the notion that SCT could be released from the neurohypophysis into peripheral circulation under various physiological conditions. We therefore used K⁺ (80 mM) as a depolarizing stimulus and measured in vitro release of SCT from pituitary explants. Similar to Vp, SCT also is released spontaneously from the pituitary explants, albeit its basal level is approximately one order of magnitude lower than that of Vp (Vp, 0.967 ± 0.041 ng/mL; SCT, 0.142 ± 0.011 ng/mL). Exposure of pituitary explants to 80 mM K⁺ significantly evoked SCT release (Fig. 3 Ci and Cii; 0.468 ± 0.043 ng/mL; ≈3.29-fold vs. basal release), which was abolished in the presence of the sodium channel blocker TTX (0.76 ± 0.03-fold vs. basal release), indicating that it is action-potential-dependent (Fig. 3Cii). The release of SCT is also high-voltage-gated (HVA) calcium-channel-dependent since only cadmium (Cd²⁺, 1.28 ± 0.11-fold vs. basal) but not nickel (Ni²⁺, 3.33 ± 0.34-fold vs. basal) was able to block it. To characterize further the Ca²⁺ channel subtypes (L-, N-, P-, or Q-type) that are involved in this process, specific HVA blockers were used (Fig. 3C2). Application of R-type calcium channel blocker SNX-482 (30 nM) had no effect (3.29 ± 0.1-fold vs. basal), showing that SCT release from the pituitary does not depend on the R-type HVA channel. However, significant inhibitions were observed in the presence of the P-type channel blocker ω-Agatoxin IVA (1.56 ± 0.18-fold vs. basal, a 52.6% blockage, P < 0.01), the L-type channel blocker nicardipine (1.77 ± 0.21-fold vs. basal, a 46.2% blockage, P < 0.01), and the N-type channel blocker ω-conotoxin GVIA (2.08 ± 0.21-fold vs. basal, 36.8% blockage, P < 0.05). In summary, L-, N-, and P-type HVA channels are involved in the K⁺-evoked secretin release from the rat pituitary.

After in vitro studies, we next sought to establish in vivo release of SCT from the pituitary by electrical stimulation of PVN followed by monitoring SCT concentrations from plasma samples collected from the jugular vein. As illustrated in Fig. 3D, we found that direct stimulation of the PVN with either a single (Fig. 3Dii; 0.1-ms pulses at 50 Hz for a duration of 10 s, 200 μA) or repeated monopolar pulses (Fig. 3Di; 100–500 μA, 0.1-ms pulses at 50 Hz, 10 s on, 10 s off, for 2 min) could evoke release of SCT into systemic circulation, when compared with control animals with no electrical stimulation. This release of SCT was observed only when the PVN area was stimulated but not in other positions (data not shown). Positions of the probe and the site of stimulation were confirmed by a marked increase in blood pressure upon stimulation (18) and by histological examination after the experiments. In summary, our data indicated that chronic hyperosmolality could lead to the release of SCT from the posterior pituitary into systemic circulation by activating magnocellular neurons in the PVN of the hypothalamus.

To confirm that SCT is a neurosecretory factor, plasma SCT levels were monitored in hypophysectomized rats before and after water deprivation. Plasma SCT levels were found to be unaltered in hypophysectomized rats under such conditions (0.073 ± 0.002 and 0.083 ± 0.024 ng/mL before and after 18 h water deprivation, respectively; P > 0.5; n = 20), again indicating that the source of elevated SCT during chronic hyperosmolaltity was the pituitary. Taken together, these observations not just confirm the potential of secretin as a posterior pituitary hormone but also provide explanations to abnormalities underlying type D syndrome of inappropriate antidiuresis (SIADH). In these patients, Vp release and response are normal, although abnormal renal expression, translocation of AQP2, or both were found (19). Secretin as a neurosecretory hormone from the posterior pituitary, therefore, could be the long-sought Vp-independent mechanism to solve the riddle that has puzzled clinicians and physiologists for decades. Finally, as a neurosecretory hormone released from the posterior pituitary, future studies of SCT should provide a new target for prevention or therapeutic intervention for disorders, particularly SIADH, of body water homeostasis.

Materials and Methods

ICV Cannulation and Drug Administration.

A 30-gauge stainless steel guide cannula was placed into the lateral ventricle as described in refs. 20 and 21. Animals were allowed to recover for 4 days before peptide injection. Rat SCT peptide was purchased from Bachem.

Electrical Stimulation of the PVN.

The femoral artery and the jugular vein were cannulated for systolic blood pressure measurement and blood sampling, respectively, before the placement of a double-barreled micropipette [one barrel of which was filled with Woods metal connected to a constant-current stimulator driven by a stimulus generator (World Precision Instruments); the other barrel was filled with Pontamine sky blue] into the PVN [1.5–1.8 mm posterior to bregma, 0.4–0.7 mm lateral to the midline, 7.5–8.0 mm from the surface of the brain (22)]. In control experiments, the stimulating electrode was positioned at a site lateral to the PVN. Positioning of the probe at the PVN (18) was established initially by an observed increase in systolic blood pressure upon electrical stimulation (0.1-ms pulses at 50 Hz for a duration of 10 s, 200 μA). The indifferent electrode was an alligator clip attached to occipital muscle. The animal was allowed to rest for 45 min before repeated monopolar pulses with different intensities (100–500 μA) were applied (0.1-ms pulses at 50 Hz, 10 s on, 10 s off) for 2 min. Blood samples (5 min in duration) were collected immediately before and after electrical stimulation through the attached polyethylene tubing (PE-50, 0.58 mm i.d. × 0.965 mm o.d., Becton Dickinson). For the continual blood sampling study, a current intensity of 200 μA was selected for single monopolar pulse stimulation (0.1-ms pulses at 50 Hz, 10 s). Blood samples (150 μL of each) were collected from a time of 12 min at 4-min intervals for ≈1 h. The maximum duration for blood sampling of each experimental animal was adjusted according to their total permissible sample volume based on the equation developed by the National Cancer Institute—Frederick Animal Care and Use Committee [volume (mL) = 0.0091 × animal's body weight (g)], which is <13% of the circulating blood volume. At the end of the experiment, the stimulation site was verified histologically.

Hypophysectomy.

The anterior and posterior lobes of the pituitary were removed by suction using a parapharyngeal approach (23). The aspirated anterior and posterior pituitaries were examined to confirm the completeness of hypophysectomy. For sham hypophysectomy, the same procedure was performed, except that the pituitary was not aspirated. The incision was closed with a suture, and analgesia was provided as needed based on clinical observations of pain or distress.

Peptide Release Experiments.

Immediately after decapitation, the hypothalamus and pituitary were dissected out quickly. Peptide release experiments were performed as described in ref. 24. The concentration of the target peptide was measured using rat SCT and Vp enzyme immunoassay kits (Phoenix Pharmaceuticals).

In Situ Hybridization.

Sense and antisense riboprobes for rat SCT and SCTR were generated from their respective partial cDNA clone containing pBlueScript KS+ using a digoxigenin RNA labeling Kit (Roche Diagnostics). Coronal brain sections were rehydrated, treated with proteinase K, and then acetylated before incubation at 50 °C for 1 h with prehybridization buffer (pH 7.5) containing 50% formamide, 0.6 M NaCl, 10 mM Tris·HCl, 1.3× Denhardt's solution, 1 mM EDTA, 550 μg/mL denatured salmon sperm DNA, and 50 μg/mL yeast tRNA. Hybridization was conducted overnight at 50 °C in the same buffer (except that salmon sperm DNA concentration was reduced to 60 μg/mL) supplemented with 10 mM DTT, 10% dextran sulfate, and 600 pg of heat-denatured RNA riboprobes. Posthybridization treatment and incubation with anti-digoxigenin antibody conjugated to alkaline phosphatase (Roche Diagnostics) were conducted as described in ref. 25.

Immunohistochemical Staining.

Immunohistochemical staining was performed as described earlier in ref. 6 and visualized by immunoperoxidase–3,3′-diaminobenzidine staining using the SuperPicTure polymer detection kit (Zymed Laboratories, Invitrogen Life Technologies). Fluorescence signals were captured using the Leica Quantimet 570 computerized image analysis system. The antibodies used were rabbit anti-Fos (1:280 dilution; Santa Cruz Biotechnology), rabbit anti-SCT (1:250 dilution; Phoenix Pharmaceuticals), rabbit anti-SCTR [1:200 dilution (5, 6)], goat antiserum against Oxt or Vp (1:250 and 1:400 dilution, respectively; Santa Cruz Biotechnology), Alexa Fluor 594 donkey anti-goat IgG (1:500 dilution; Molecular Probes, Invitrogen), and Alexa Fluor 488 chicken anti-rabbit IgG (1:500 dilution; Molecular Probes).

To assess whether the Fos antibody is specifically reactive to Fos protein expressed in rat PVN, an ECL Western blot analysis system (Amersham) was used. A single band was obtained at ≈55 kDa.

Laser Capture Microdissection.

Eight-micrometer sections of frozen brain tissues were fixed in ice-cold methanol and then prestained with hematoxylin under RNase-free conditions for histological identification of the specific hypothalamic nucleus of interest. After complete dehydration, sections were microdissected using a Pixcell IIe laser capture microdissection system with an infrared diode laser (Arcturus) and high-sensitivity caps (CapSure LCM Caps).

RNA Extraction, First-Strand cDNA Synthesis, and Real-Time PCR.

RNA extraction and first-strand cDNA synthesis were performed as described earlier in ref. 5, whereas the expression levels of various genes were measured by real-time PCR using the SYBR Green PCR kit (Applied Biosystems) as described in ref. 6.

Drugs.

The porcine SCT antagonist secretin-(5–27) was purchased from Bachem. The PKA inhibitor H89, sodium channel blocker TTX, Q-type calcium channel blocker ω-conotoxin MVIIC, and R-type calcium channel blocker SNX-482 were purchased from Alomone Labs. The polypeptide toxin for the N-type calcium channel, ω-conotoxin GVIA, was purchased from Tocris. The P-type calcium channel blocker ω-agatoxin IVA from Agelenopsis aperta used in this study was the synthetic version purchased from Calbiochem. All other chemicals and the L-type calcium channel blocker nicardipine used in the peptide release experiment were purchased from Sigma.

Statistical Analysis.

For quantitative real-time PCR analysis, data are shown as the means ± SEM from at least three independent experiments, each in triplicate. All data were analyzed by one-way ANOVA and followed by a Dunnett's test using the computer software PRISM (version 3.0; GraphPad).