Abstract
To study the function of the PacC transcription factor in Wangiella dermatitidis, a black, polymorphic fungal pathogen of humans with yeast-phase predominance, the PACC gene was cloned, sequenced, disrupted and expressed. Three zinc finger DNA-binding motifs were found at the N-terminus, and a signaling protease cleavage site at the C-terminus. PACC was more expressed at neutral-alkaline pH than at acidic pH. Truncation at about 40 residues of the coding sequence upstream of the conserved protease processing cleavage site of PacC affected growth on a nutrient-rich medium, increased sensitivity to Na+ stress, decreased yeast growth at neutral-alkaline pH, and repressed hyphal growth on a nutrient-poor medium at 25°C.Truncation at the coding sequence for the conserved signaling protease box of PacC impaired growth and reduced RNA expression of the class II chitin synthase gene at acidic pH. The results suggested that PacC is important not only for the adaptation of W. dermatitidis to different ambient pH conditions and Na+ stress conditions, but also for influencing yeast-hyphal transitions in this agent of phaeohyphomycosis.
Keywords: pH, transcription factor, Na+ stress, filamentous growth, conidiation, morphogenesis
INTRODUCTION
Wangiella (Exophiala) dermatitidis is a black polymorphic fungal pathogen of humans with yeast predominance. As an agent of phaeohyphomycosis, it causes a number of different clinical manifestations in humans ranging from chronic superficial and subcutaneous infections to rapidly progressing systemic and sometimes neurotropic infections that frequently lead to patient death (Matsumoto et al., 1994: Zheng et al., 2007). Although often referred to as an asexual black yeast species, W. dermatitidis is in fact a conidiogenous hyphal fungus that has been molecularly classified among the Cheatothyriomycetidae, one of the two subclasses of the Eurotiomycetes class of the Ascomycota (Geiser et al., 2006). Designation of W. dermatitdis as polymorphic instead of dimorphic is because it can grow not only as polarized yeast and hyphae, but also can grow in a nonpolarized, isotropically-enlarging mode that produces a number of additional morphotypes called sclerotic cells, planate cells and sclerotic bodies depending on whether they have no internal septa, one internal septum or multiple intersecting internal septa, respectively (Szaniszlo, 2002; Abramczyk et al., 2009). The ability of the morphotypes of pathogenic fungi to switch from one growth form to another has long been postulated to be a virulence determinant, although the evidence for this with W. dermatitidis is lacking. Nonetheless, because the polymorphism of W. dermatitidis can be induced in vitro by different conditions, and more than 100 other black fungi produce one or more similar morphotypes in vivo during human infections, this species is considered a model for their study (Szaniszlo, 2002). For example, under nitrogen limiting conditions W. dermatitidis usually produces hyphal growth. In contrast, when grown in most rich media at near neutral pH the yeast morphotype prevails, whereas when cultured in the same rich media, but at pH 2.5 with adequate calcium or at pH 6.5 with limited calcium, W. dermatitidis produces sclerotic-form growth (Karuppayil and Szaniszlo, 1997; Szaniszlo, 2002). In addition, CDC42 encodes a Rho/Rac member of small GTP-binding proteins in W. dermatitidis, and the dominant active mutation CDC42G14V activates sclerotic growth at 37°C, and represses the filamentous growth of the temperature-sensitive hyphal form mutant Hf1 (Ye and Szaniszlo, 2000). Recently the APSES transcription factor StuAp and the general transcriptional repressor Tup1p have also been found to be important for the regulation of hyphal growth in W. dermatitidis (Liu et al., 2008; Wang and Szaniszlo, 2007).
In the manner of W. dermatitidis, many other fungi are known to grow in a wide range of pH. Under these conditions, pH signaling transcription factors play essential roles in maintaining different gene expression patterns. Among filamentous fungi, PacC sometimes acts as a transcription factor in a pH signaling pathway (Penalva and Arst, 2004; Penalva et al., 2008). When ambient pH is elevated, PacC expression is induced with the result that other genes are activated or repressed by the induced PacC. PACC constitutive mutants (paccc) have also been shown to grow poorly at acidic pH, whereas PACC loss-of-function mutants (pacc+/−) have been shown to grow poorly at alkaline pH (Penalva and Arst, 2004). Usually, PacC binds to the recognition site GCCAAG of the pH responsive genes (Espeso et al., 1997; Tilburn et al., 1995). The location of the PacC recognition sites upstream of the initiation codon in a PACC gene suggests that the expression of PACC is auto-regulated (Tilburn et al., 1995).
Studies of PacC show it has a DNA-binding domain containing three zinc fingers (Mingot et al., 1999; Tilburn et al., 1995), with a nuclear localization signal located in zinc finger 3 (Fernandez-Martinez et al., 2003; Mingot et al., 2001). In Aspergillus nidulans, PacC is reported to be activated by a two-step protease cleavage process (Diez et al., 2002; Mingot et al., 1999; Tilburn et al., 1995). Through the pH signaling pathway, PalA is bound to the full length PacC72, which may recruit the signaling protease PalB to cleave PacC72 at the signaling protease box, producing PacC53 (Vincent et al., 2003). PacC53 can then be cleaved by the processing protease, yielding the functional form PacC27, which is the predominant form found in the nucleus (Espeso and Arst, 2000; Fernandez-Martinez et al., 2003; Mingot et al., 2001). Constitutively active mutants can be constructed by truncation to remove the C terminus downstream of the signaling protease box, whereas loss-of-function mutations can be constructed by truncation before the processing protease box (Penalva and Arst, 2004).
Genes regulated by PacC mainly include those encoding transporters, such as the sodium pump gene ENA1 and genes for siderophore transport (Caracuel et al., 2003a; Eisendle et al., 2004), those encoding permeases, such as the γ-aminobutyrate (GABA) permease-encoding gene GABA (Espeso and Arst, 2000), those encoding secreted enzymes, such as the acid phosphatase gene PACA, the alkaline phosphatase gene PACD, the alkaline protease gene PRTA, and the xylanase genes XLNA and XLNB (MacCabe et al., 1998; Tilburn et al., 1995), and those involved in the synthesis of exported metabolites such as the isopenicillin N synthase gene IPNA (Espeso and Penalva, 1996). In Saccharomyces cerevisiae, the transcription factor genes NRG1 and SMP1 have also been found to be targeted by the PacC ortholog, Rim101, which binds to the promoters of NRG1 and SMP1 to repress their expression (Lamb and Mitchell, 2003). In S. cerevisiae, deletion of RIM101 decreases invasive growth (Li and Mitchell, 1997). In Candida albicans, deletion of RIM101 represses filamentation at alkaline pH (Ramon et al., 1999), and constitutive mutation of RIM101 by-passes the pH restrictions on filamentation (El Barkani et al., 2000). Many cell wall proteins also are regulated by Rim101 in C. albicans, including the 1,3-β-glucanosyltransferase genes, PHR1 and PHR2 (Muhlschlegel and Fonzi, 1997; Ramon and Fonzi, 2003; Saporito-Irwin et al., 1995), and hypha-specific genes, HWP1, RBT1 and RBR1 (Lotz et al., 2004). Interestingly, PacC is also known to be involved in fungal virulence. For example, when certain A. nidulans mutation strains were examined in a neutropenic murine model of pulmonary aspergillosis, pacc loss-of-function mutants were found to grow less and show less penetration of the lungs than the wild-type (Bignell et al., 2005). In contrast, constitutive paccc strains were found to increase the mortality of mice and to produce more lung penetration. These results demonstrate that PacC plays an important role in aspergillosis pneumonia pathogenesis. In addition, the C. albicans rim101Δ strain is known to be less virulent in a mouse model, less infectious to kidneys, and less infectious to endothelia cells (Davis et al., 2000a). However, in Fusarium oxysporum, the PACC loss-of-function mutation increased virulence and the PACC constitutive mutation decreased virulence in the infection of tomato roots (Caracuel et al., 2003b). Apparently the regulation of virulence by PacC is diverse among fungal strains growing in different conditions.
To investigate the regulation of PACC, with respect to the growth of W. dermatitidis under different pH conditions, the PACC gene was cloned, characterized, and mutated, and the resulting mutants were then studied.
MATERIALS AND METHODS
Strains, culture conditions and microscopy
The well-characterized Wangiella dermatitidis strain 8656 (ATCC34100 [Exophiala dermatitidis CBS 525.76]) was the wild-type strain used in this study (Szaniszlo, 2002). The E. coli strain DH10B was used for the W. dermatitidis partial genomic library construction and the strain used for cloning was XL-1-blue. Routine culture of W. dermatitidis was on YPD agar (YPDA) and in YPD broth (YPDB) as described previously (Liu et al., 2004; Wang and Szaniszlo, 2007). To evaluate growth of W. dermatitidis cultured at different pH, YPDA containing 100 mM HEPES was titrated to pH 8 with NaOH, and to pH 4.5, pH 3.5, and pH 2.5 with HCl. For the induction of sclerotic forms, W. dermatitidis was grown in modified Czapek Dox broth [MCDB; 3.5% Czapek Dox, 0.1% yeast extract, pH adjusted with HCl (Wang and Szaniszlo, 2000)]. For the induction of the filamentous growth, W. dermatitidis was grown on potato dextrose agar (PDA; Difco Scientific, Detroit, Mich.) as described previously (Wang and Szaniszlo, 2007). For slide cultures, a thin square of PDA agar was placed on a slide and then inoculated on each side before being overlaid with a cover slip and incubated over water in a closed Petri dish. Microscopic pictures were taken with a Leica DFC camera and a Leica DMLB upright light microscope.
Degenerate PCR
To design degenerate PCR primers, the amino acid sequences of PacC family members from 10 filamentous fungi (A. nidulans, A. parasiticus, A. oryzae, A. niger, Penicillium chrysogenum, Sclerotinia sclerotiorum, Acremonium chrysogenum, Gibberella moniliformis, Gibberella fujikuroi, F. oxysporum) were aligned to find the conserved regions. Degenerate primers were derived and synthesized based on their conserved zinc finger regions with sequences: WPF1, CAYGTIGGIMGIAARWSXACXAAYAA and WPR1: ISWRTCRTCIGCRTGXGTYTTXACRTG (Y=C+T, M=A+C, R=A+G, W=A+T, S=C+G, X=A+T+C+G). PCR amplifications were carried out with 2 µM of each primer, 0.5 mM dNTP, 0.5 µg genomic DNA and 0.05 U/µl Taq polymerase mixed in 1.5 mM Mg++, 50 mM KCl, 10 mM Tris-HCl (pH 9) buffer. The PCR reaction conditions were as follows: 5 min at 94°C for premelting; 50 cycles of 1 min at 94°C for denaturation, 1 min at 55°C for annealing, and 1 min at 72°C for extension; 7 min at 72°C for completion of the extension. The resulting PCR products were then cloned into pGEM-T easy vector (Promega, Madison, Wis.) and sequenced. The sequencing showed that plasmid pT-WdPACC204 contained a 204-bp-amplified sequence corresponding to the zinc finger regions of the PacC proteins.
Construction and screening of a W. dermatitidis partial genomic library
Southern analysis of the genomic DNA was carried out by digestion with different restriction enzymes as described previously (Wang and Szaniszlo, 2007). After a W. dermatitidis cosmid genomic library (Feng et al., 2001) was screened without success using the 204-bp sequence as a probe, a partial genomic library was constructed for isolating the full-length gene. Because Southern analysis showed that a XhoI fragment containing the PACC gene was about 6 kb, genomic DNA was first digested with XhoI and then after electrophoresis, an ∼6 kb fragment was cut from the gel, purified by using the QIAquick gel extraction kit (Qiagen, Valencia, Calif.) and finally ligated into the E. coli vector pBSKS that had been previously digested with XhoI and dephosphorylated with calf intestine alkaline phosphotase (CIAP, Promega). A clone containing the PACC sequence was then successfully obtained by screening more than 104 colonies by hybridization using the 204-bp sequence as a probe. Sequencing was carried out with gene-specific primers using big dye chemistries and capillary-based ABI 3130 and ABI 3739 DNA analyzers (Applied Biosystems, Foster City, Calif.) (Core Facility of the Institute of Cellular and Molecular Biology, University of Texas at Austin). The sequencing showed that a 5859 bp W. dermatitidis sequence was inserted in the XhoI site of pBSKS. This plasmid was named pBSKS-WP5859.
RT-PCR
To locate the positions of the introns, RNA was extracted with hot acidic phenol from W. dermatitidis cells grown in YPDB for 24 h at 37°C and treated with RQ1 RNase-Free DNase (Promega). RT-PCR was carried out with primers WP17F: CTGCTCGAGATGTCTGAACTCGCCGAGACCAG, and WP18R: TCGCTCGAGGCGTTTGCGAGCCTCATAATC, using the One-step RT-PCR kit (Qiagen). After the amplification products were cloned into pGEM-T easy vector (Promega) and sequenced, the cDNA sequence was aligned with the genomic DNA sequence to identify introns.
PACC mutagenesis
To create the W. dermatitidis PACC mutation strains by a one-step replacement method, fragments containing the hph selection marker (Liu et al., 2004) flanked by PACC 5' and 3' sequences were constructed. For the loss-of-function mutation, a 5' flanking sequence was amplified by PCR with primers WPF10: GGATCCCGAGTGTCAATTCAGCTGGA, and WPR10: CTACTGGTTATGGTGATGTTGACCA (the BamHI site that was introduced is underlined, and the stop codon is italicized). The products amplified were cloned into the pGEM-T easy vector (Promega) to produce plamid pT-WP1 for sequencing. For the constitutive mutation, a 5' flanking sequence was amplified by PCR with primers WPF11: GGATCCTCAGCTTCCCCAGATCATTC, and WPR11: CTAACGGCGACGCTCTTCCTGATCATA (the BamHI site that was introduced is underlined, and the stop codon is italicized). The amplified products were cloned to pGEM-T easy vector (Promega), to produce plasmid pT-WP2 for sequencing. After 0.5-kb BamHI-SalI fragments were released from both pT-WP1 and pT-WP2, they were cloned into the pBCKS vector (Stratagene, La Jolla, Calif.), generating plasmids pBCKS-WP1 and pBCKS-WP2, respectively. After release of a 1.4-kb SalI fragment containing the hph marker from pCB1636 (Fungal Genetics Stock Center, University of Kansas Medical Center, Kansas City, Kans.), it was inserted into the SalI site of pBCKS-WP1 and pBCKS-WP2 to produce pBCKS-WP3 and pBCKS-WP4, respectively. The 3' flanking sequence was amplified by PCR with primers WPF12: GAACAGAGGCGTGGAGGTTA, and WPR12: GGTACCACGCGTACGACCCCTTACTA (the introduced KpnI site is underlined). The amplified products were cloned to pGEM-T easy vector (Promega) to produce plasmid pT-WP3 for sequencing. A 0.5-kb SalI-KpnI fragment was released from pT-WP3 and ligated into the XhoI-KpnI sites of pBCKS-WP3 and pBCKS-WP4 to produce pBCKS-WP5 and pBCKS-WP6, respectively. After the 2.4-kb XbaI-KpnI fragments were released from pBCKS-WP5 and pBCKS-WP6, they were gel purified and used to transform yeast cells of the W. dermatitidis wild-type strain by electroporation (Wang and Szaniszlo, 2000; Zheng and Szaniszlo, 1999). Transformants were selected on YPDA containing 50 µg/ml hygromycin. PCR with primers WPF16: CATCGACCCTGCTCTTGCA and WPR16: CGATGAGTCGCATGTTCTGAA were used to screen the transformants. The amplification products were analyzed by electrophoresis in a 3% agarose gel together with a 2-log DNA marker (New England Biolabs, Ipswich, Mass.) as a size reference. Southern analysis of genomic DNA digested with SalI and hybridized with the 204-bp PACC probe was used to confirm the mutants.
Analysis of W. dermatitidis growth by spot assays
The spot assays were carried out as described previously (Wang and Szaniszlo, 2000) with log-phase yeast cells of W. dermatitidis cultured in YPDB at 25°C. After 10-fold serial dilution, cells in 5 µl were spotted with a micropipette onto agar media, and then incubated at 25°C and 37°C.
Northern analysis
For the Northern analysis, log-phase yeast cells of W. dermatitidis cultured in YPDB at 25°C were washed and then used to inoculate pH 7 and pH 3 MCDB at 106 cells/ml, and pH 2.5 MCDB at 107 cells/ml. After cells were cultured for several days with vigorous shaking at 25°C, the pH was measured to insure its constancy. Total RNA was isolated with the RNeasy kit (Qiagen). The concentration of RNA was determined using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Del.). RNA electrophoresis was in a 1% agarose gel containing 2 M formaldehyde, and a 0.24–9.5 kb RNA ladder (Invitrogen, Carlsbad, Calif.) was run simultaneously as a size marker. After transfer of RNA from the gel to the nylon membrane, transfer efficiency was checked. For the PACC probe, the 204-bp PACC fragment from pT-WdPACC204 was used. For the CHS1 probe, a fragment was amplified by PCR with specific primers (Wang et al., 2002). After Northern hybridization, radioactive signals were detected by exposure to a phosphoimager screen, which was then scanned with a Molecular Imager FX Pro Plus multiimager system (Bio-Rad, Hercules, Calif.).
Nucleotide sequence accession number
The sequence of the W. dermatitidis PACC gene was submitted to the GenBank database. The accession number is EU367502.
RESULTS
Isolation and sequence characterization of the W. dermatitidis PACC gene
To clone the W. dermatitidis PACC gene, ten PacC family members of filamentous fungi were aligned, and then degenerate primers were designed based on the nucleotide sequences of their conserved zinc finger DNA-binding domains. A PCR product amplified with the degenerate primers was then cloned, which was shown by sequence analysis to encode a protein fragment corresponding to that of a PacC zinc finger domain. Using this fragment as a probe, Southern analysis of genomic DNA digested with different restriction enzymes indicated that PACC existed as a single copy in the W. dermatitidis genome (data not shown).
Because a PACC hybridization signal was not found in a screen of a W. dermatitidis cosmid genomic library, a W. dermatitidis subgenomic library was constructed and screened for its isolation. Detection and sequencing of an isolated plasmid revealed that an inserted W. dermatitidis sequence was 5,958 bp, and contained the PACC ORF consisting of bp 2,855 to 4,912. Analysis of the upstream sequence using the MatInspector software (www.genomatix.de) identified three important consensus PacC binding sites at −796 bp, −949 bp and −1122 bp upstream of the ORF start codon, suggesting that these elements are required in W. dermatitidis for the regulation of PACC expression. The binding site detected at −796 bp was on the sense strand, and the other two binding sites were on the anti-sense strand. Comparison of the cDNA sequence obtained by RT-PCR and the genomic DNA sequence revealed the presence of two introns of 60 bp and 57 bp. The first intron was between the coding sequence for Y108 and E109 in the first zinc finger, whereas the second intron, which does not introduce stop codons or frame shifts, was located between the coding sequence for S252 and S253, and is about 30 residues upstream of the conserved processing protease cleavage site. Both introns began with GT at their 5' ends and end with AG at their 3' ends, and therefore conformed to the “GT-AG” rule.
Analysis of W. dermatitidis PACC ORF showed that it encoded a putative protein of 646 aa (Figure 1) with a theoretical isoelectric point (pI) of 5.83 and a molecular weight (Mw) of 69.8 kDa. Protein structure predictions showed that the predicted PacC protein contained three C2H2-type zinc fingers for DNA binding (residues 90 to 115, residues 126 to 150 and residues 156 to 178, based on Pfam database), had Asn- (12–27), Ala- (32–47) and Gln- (56–78) rich regions before the zinc finger motifs, and was an α-helix-rich protein. BLASTP (www.ncbi.nlm.nih.gov/BLAST) analysis indicated that the PacC protein of W. dermatitidis was most similar to the PacC proteins of other Ascomycota conidiogenous fungi. Like other PacC family members, it also had a processing protease cleavage site (278–280) and a signaling protease box (484–510).
Fig. 1.
Multiple alignment of the PacC protein of W. dermatitidis with its closely related ortholog in A. nidulans by the CLUSTALW program. A. nidulans (AnPacC) accession #: EAA63426: stars indicate the identical amino acids, two dots show the similar amino acids, and single dots present the less conserved amino acids. The three zinc finger motifs are underlined with thick lines. The processing protease cleavage site and the signaling protease box [according to AnPacC ( Penalva and Arst, 2004)] are indicated by thin lines. The ending points of PacC+/− and PacCc trunctations in the W. dermatitidis mutants are shaded.
The PACC gene is more expressed at neutral-alkaline pH than at acidic pH
Northern analysis of RNA from wild-type cells cultured for 24 h in pH 7 and pH 3 MCDB at 25°C showed that PACC was more highly expressed at pH 7 than at pH 3 (Figure 2). Thus, PACC RNA expression was pH regulated, suggesting that its encoded protein, plays an important role in the regulation of W. dermatitidis growth at different pH conditions.
Fig. 2.
Northern analysis of PACC expression.Total RNA prepared from wild-type cells of W. dermatitidis grown in pH 7 and pH 3 MCDB liquid media at 25°C for 24 h was hybridized with a PACC probe.
The loss-of function and constitutive PACC mutants of W. dermatitidis were constructed by one-step replacements
Because the W. dermatitidis PacC protein structure is similar to that of the A. nidulans PacC structure, loss-of-function (pacc+/−) and constitutive (paccc) mutant forms of PACC were derived to be similar to those of that fungus (Tilburn et al., 1995). In the W. dermatitidis pacc+/− mutant, PacC was truncated after residue Q243 at about 40 residues upstream of the conserved processing protease cleavage site, whereas in the paccc mutant, PacC was truncated after residue R501 in the conserved signaling protease box (Figure 3A, B). Initial screening of the hygromycin resistant, putative pacc+/− and paccc mutants was by PCR diagnosis of their genomic DNA with specific primers. Whereas the wild type showed a 100-bp PCR-amplified band, the mutants selected for further analysis were devoid of this band (data not shown). Among the putative pacc+/− strains, three of 39 transformants had the desired deletion and all three of these particular transformants produced smaller colonies, whereas among the putative paccc transformants, approximately one out of six had the deletion and none exhibited an abnormal phenotype on the YPDA-hygromycin medium compared to the other transformants. Further analysis of the pacc+/− and paccc strains by Southern hybridization of SalI digested genomic DNA, using the 204-bp PACC fragment in the DNA binding domain as a probe, showed that unlike the wild type, which showed a 7-kb band, all the putative pacc+/− strains had a 0.9-kb band and all the putative paccc strains had a 1.7-kb band, consistent with designs (Figure 3C). Because preliminary studies of all the pacc+/− strains and all the paccc strains had identical phenotypes, the detailed comparisons with the wild type described below were only with the pacc+/−-1 and paccc-1 strains. Northern analysis of PACC RNA showed that in the pacc+/−-1 mutant, the size was smaller and the amount was about 2-fold lower than that in the wild-type at pH 7.4; whereas in the paccc-1 mutant, the sizes were 3 kb, 2.4 kb, 1.8 kb and 1.4 kb, and the total amount was more than that in the wild-type at pH 7.4 and pH 2.5 (Figure 3D). The apparently diverse sizes of PACC RNA in the paccc-1 mutant suggested that its expression was influenced by different transcription start sites, alternative splicing or RNA stability. Retesting of the pacc+/−-1 mutant on YPDA in the absence of hygromycin confirmed that this loss-of-function mutation strain also produced smaller colonies when hygromycin was not present, whereas the amount of growth of the paccc-1 mutant was similar to that of the wild type, although somewhat darker (Figure 4).
Fig. 3.
Construction of the PACC mutations by a one-step gene replacement method. (A) Strategy for the construction of pacc+/− A 0.5-kb 5’ fragment and a 0.5-kb 3’ fragment were constructed to flank the hph marker. This fragment was transformed into W. dermatitidis to produce a recombination with genomic DNA. A Stop codon was introduced at the end of the 5’ sequences after Q243, which is denoted by a star. (B) Strategy for the construction of paccc A 0.5-kb 5’ fragment and a 0.5-kb 3’ fragment were constructed to flank the hph marker. This fragment was transformed into W. dermatitidis to produce a recombination with genomic DNA. A stop codon was introduced at the end of the 5’ sequences after R501, which is denoted by a star. (C). Southern analysis. Genomic DNA of the wild-type strain and mutation strains were digested with SalI and electrophoresed on a 0.8% agarose gel. DNA was hybridized with the 204-bp PACC probe, which is indicated by the horizontal arrows. The sizes of the hybridization bands are indicated. (D). Northern analysis. RNA of the wild-type strain and mutation strains grown in pH 7.4 and pH 2.5 MCDB media was hybridized with the 204-bp PACC probe. The sizes of the hybridization bands are indicated.
Fig. 4.
The pacc+/−−1 mutant grew slower than the WT and the paccc−1 mutant when cultured under the standard condition. Yeast cells of the WT, paccc−1 and pacc+/−−1 were streaked on YPDA and incubated at 25°C for 5 days before photography.
PACC influences the growth of W. dermatitidis when cultured under different pH conditions on YPDA
To investigate the effects of pH on the growth of the wild type and mutants, cells were diluted and spotted on YPDA titrated to pH 8, pH 4.5, pH 3.5 and pH 2.5, and cultured at 25°C and 37°C for three days (Figure 5). In general, the wild type grew somewhat better on YPDA adjusted to pH 8, pH 4.5 and pH 3.5 at 37°C than it did at 25°C, and grew less on YPDA adjusted to pH 2.5 at 37°C than it did at 25°C. At 25°C, the growth of the wild type was also reduced on YPDA at pH 8, pH 3.5 and pH 2.5 compared with that produced at pH 4.5. In contrast, at 37°C, the growth of the wild type was only reduced to any great extent on YPDA at pH 2.5, compared with the growth it produced at pH 8, pH 4.5 and pH 3.5. At both temperatures, the pacc+/−-1 mutant grew poorer on YPDA at all the pH levels tested compared to the wild type, with the exception that the growth of the mutant and wild type was equivalent at 37°C and at pH 2.5. In addition, the growth defect of pacc+/−-1 also appeared more pronounced at 25°C than at 37°C. At both temperatures, the growth of paccc-1 mutant was less at pH 3.5 and pH 2.5 than at pH 8 and pH 4.5, compared with the wild type. These results indicated that PacC played a role in the regulation of the yeast reproductive growth of W. dermatitidis under the different pH conditions tested.
Fig. 5.
The PACC mutants were affected by different pH conditions on YPDA. Spot assays: WT, paccc−1 and pacc+/−−1 yeast cells were 10-fold diluted, spotted and incubated at 25°C and 37°C for 3 days before photography. The pacc+/−−1 mutant grew poorer at pH 8 than at acidic pH, compared with the wild type. The growth of the paccc−1 mutantwas reduced at pH 3.5 and pH 2.5 compared to the wild type.
The PACC constitutive mutation affects W. dermatitidis growth and CHS1 expression at acidic pH
In pH 2.5 MCDB at 25°C, W. dermatitidis is induced to form sclerotic morphotypes (Wang and Szaniszlo, 2000). To investigate the effects of the PACC mutations on the induction of these morphotypes, cells were cultured in pH 2.5 MCDB (Figure 6A). As expected, after two days of incubation, wild-type cells had begun to produce sclerotic cells and some planate cells. Interestingly, the pacc+/−-1 loss-of-function mutation did not affect the conversion to a sclerotic morphotype. In contrast the paccc-1 constitutive mutation repressed the conversion of obviously enlarged sclerotic cells to planate cells and sclerotic bodies. In fact, all of the paccc-1 cells were swelled even more than those of the wild type. In addition, more of the paccc-1 cells contained large vacuoles when compared with the wild type and the pacc+/−-1 cells (data not shown). In pH 4.5 MCDB, however, the wild type and the paccc-1 and pacc+/−-1 mutants all grew comparably as budding yeast cells (data not shown).
Fig. 6.
At acidic pH paccc−1 was not impaired in isotropic growth but septation of the resulting sclerotic cells did not occur. (A) paccc−1 grown in pH 2.5 MCDB at 25°C was affected in sclerotic form production. After 2 days, cells were photographed with a light microscope fitted with a 100 x oil objective. WT and pacc+/−−1 had begun producing sclerotic cells and planate cells. Representative planate cells in the WT and pacc+/−−1 are indicated by arrows. All the cells of the paccc-1 mutant swelled more than those of the WT cells, implying that solutes and water had entered and inflated the cells. The scale bar represents 5 µm and is applicable to each image. (B) CHS1 expression was affected by the PACC constitutive mutation. Total RNA was prepared from cells grown in pH 2.5 MCDB at 25°C for 2 days. The 10 µg RNA was loaded and hybridized with a CHS1 probe. CHS1 expression was largely decreased in the paccc−1 mutant compared with that of the wild type and the pacc+/−−1 mutant at pH 2.5. The decreased expression of CHS1 may contribute to the poorer growth of paccc−1 at acidic pH.
Because we observed that the paccc-1 mutant was somewhat darker than the wild-type strain, a situation often found previously to be related to cell wall integrity defects in W. dermatitidis (Liu et al., 2004; Wang et al., 1999; Zheng et al., 2006), we investigated whether the product of PACC might affect the expression of any of its previously studied chitin synthase genes. Northern analysis showed that only the expression of its class II chitin synthase gene was obviously affected, as documented by a decreased level of CHS1 RNA in the paccc-1 mutant compared with that of the wild type and the pacc+/−-1 mutant when each was grown identically at pH 2.5 (Figure 6B). Surprisingly, CHS1 was the only chitin synthase gene that was detected to be significantly affected by PACC mutation under this or the other conditions tested (data not shown).
The pacc+/−-1 mutant is most sensitive to Na+ stress
Because PacC proteins are often involved in the regulation of Na+ stress, the effects of Na+ stress on the wild type and the PACC mutation strains spotted on YPDA (pH 4.5) and YPDA supplemented with 0.4 M NaCl and cultured at 25°C and 37°C were evaluated (Figure 7). The growth of the wild type was moderately reduced on YPDA supplemented with 0.4 M NaCl at both temperatures. Although the growth pattern of the paccc-1 mutant was similar to that of the wild type on both media at both temperatures, the growth of the pacc+/−-1 mutant was severely reduced on the YPDA+0.4 M NaCl when cultured identically. In addition, the pacc+/−-1 mutant grew even less on the YPDA+0.4 M NaCl at 37°C than at 25°C, indicating the sensitivity of pacc+/−-1 to 0.4 M NaCl was enhanced at 37°C.
Fig. 7.
The pacc+/−−1 mutant was more sensitive to Na+ stress. Spot assays. WT, paccc−1 and pacc+/−−1 cells were 10−fold diluted, spotted and incubated at 25°C and 37°C for 4 days. The pacc+/−−1 mutant grew poorer on YPDA+0.4 M NaCl than on YPDA, compared with the wild type and the paccc−1 mutant.
PacC regulates yeast-hyphal transitions in W. dermatitidis
In C. albicans and S. cerevisiae, the PacC ortholog, Rim101, is involved in the dimorphic switching between yeast and hyphae or pseudohyphae and deletion of RIM101 represses filamentous growth (El Barkani et al., 2000; Li and Mitchell, 1997; Ramon et al., 1999). Therefore, we investigated whether PacC also regulates the yeast-hyphal transitions in W. dermatitidis. For this yeast cells of each strain were spread on a block of PDA (pH 5.6) and incubated at 25°C. Under these conditions, the pacc+/−-1 mutant produced only a few filaments at the edges of colonies, even after 7 days of incubation, whereas the wild type and paccc-1 strain produced many filaments at their edges in only 4 days (Figure 8). Moreover, these PDA slide cultures were prepared in a way that allowed aerial hyphae and conidiophores, if produced, to grow horizontally out of the agar into the air between a slide and a cover glass. At 25°C, many aerial hyphae and conidia were produced by the wild type and the pacc+/−-1 and paccc-1 mutants (Figure 9). These results thus suggested that PacC positively regulated filamentous growth in W. dermatitidis, but did not positively regulate its conidiogenesis if hyphae were produced.
Fig. 8.
The PacC protein regulated filamentous growth in W. dermatitidis. Yeast cells of the WT and the paccc−1 and pacc+/−−1 mutants were spread in a block on PDA, respectively, and then incubated at 25°C. At the times indicated, the colony edges were photographed with a light microscope fitted with a 5 x objective. The pacc+/−−1 mutant produced only a few filaments at the edges of the agar medium even after 7 days of incubation, whereas the wild type and the paccc−1 mutant produced many filaments at the edge even at 4 days of incubation. The scale bar is 0.2 mm and is applicable to all the growth in the figure.
Fig. 9.
The pacc+/−−1 mutation did not block conidiogenesis. The WT and the paccc−1 and pacc+/−−1 mutants were inoculated on PDA in slide cultures and incubated at 25°C. After two weeks of incubation, conidiophores and conidia were photographed with a compound light microscope fitted with a 63 x objective. The clusters of conidia are indicated by arrows. The scale bar represents 10 µm and is applicable to all the growth in the figure.
DISCUSSION
W. dermatitidis can grow in a wide range of pH conditions. At pH 3 and above, W. dermatitidis in most rich media grows reproductively as budding yeast and in most less rich, nitrogen-deficient media as a filamentous mold (Szaniszlo, 2002; Szaniszlo et al., 1976). However, if the pH of the rich culture media is 2.5 or if less acidic media are calcium-deficient, then this polymorphic fungus grows in a variety of non-polarized sclerotic forms, and its polarized yeast and hyphal growth is repressed (Karuppayil and Szaniszlo, 1997; Szaniszlo, 2002; Szaniszlo et al., 1976). As an initial step in the study of the regulation of growth in W. dermatitidis cultured under different pH conditions, the PACC gene, which encodes an important pH pathway transcription factor in other fungi, was cloned and the effects of its mutation studied.
Comparison of the deduced protein sequence of the W. dermatitidis PacC showed that it was much conserved among PacC family members (Figure 1). The most conservation was in its second and third zinc fingers, consistent with the situation in A. nidulans, in which those zinc fingers have been found to make direct interactions with DNA and to be involved in nuclear localization (Espeso et al., 1997; Fernandez-Martinez et al., 2003; Mingot et al., 2001; Tilburn et al., 1995). In addition, the position of the first intron in the PACC gene of W. dermatitidis was also very conserved (Caracuel et al., 2003b; Flaherty et al., 2003; MacCabe et al., 1996; Rollins and Dickman, 2001; Schmitt et al., 2001; Suarez and Penalva, 1996; Tilburn et al., 1995). However, the position of the second intron was unique and suggestive of alternative splicing, because the presence of the second intron does not introduce a stop codon or a frame shift. In addition, and as predicted by MatInspector software, three PacC binding sites were found to exist between −796 bp and −1122 bp upstream of the PACC translation start codon, which suggests that PACC expression in W. dermatitidis is auto-regulated by its encoded protein. However, most important to the goal of this particular study was our finding by Northern analysis that the RNA expression of the PACC gene in the wild-type strain of W. dermatitidis was notably higher at neutral-alkaline pH than it was at acidic pH (Figure 2), suggesting that PACC is a marker gene of pH signaling in this pathogenic fungus. This in turn implies that its product, PacC, might be crucial for maintaining the growth of W. dermatitidis at different pH conditions in the human body.
Loss-of-function (pacc+/−) and constitutive (paccc) strains with mutant forms of PACC were derived to study its function in W. dermatitidis. The pacc+/−-1 loss-of-function strain grew less than the wild type under normal conditions at both 25°C and 37°C (Figure 4), suggesting that the genes of W. dermatitidis involved in growth at normal temperatures are activated by PacC. This finding contrasts with those derived with S. cerevisiae, C. albicans and Ustilago maydis, in which the deletion of RIM101 does not affect growth rate at normal temperatures (Arechiga-Carvajal and Ruiz-Herrera, 2005; Davis et al., 2000b; Li and Mitchell, 1997), but is in agreement that found with A. nidulans where the PACC null deletion mutant is decreased in its rate of growth at the normal temperature (Tilburn et al., 1995). Interestingly, we also found that paccc-1 was somewhat blacker than the wild type and that pacc+/−-1 was somewhat less dark than the wild type on YPDA (Figure 4), suggesting that PacC may be involved in the activation of melanin biosynthesis in W. dermatitidis. Our subsequent finding that the growth patterns of the PACC mutation strains were tightly pH related provided further supporting evidence for our ultimate conclusion that PacC plays critical regulatory roles in the responses of W. dermatitidis to pH.
Of the five chitin synthase genes of W. dermatitidis analyzed in this study, only the RNA level of its CHS1gene, which encodes a class II chitin synthase, was clearly decreased at pH 2.5 in the paccc-1 strain compared with that of the wild type and the pacc+/−-1 strains (Figure 6B). Because the chs1Δ mutant also grew poorly at pH 2.5 (data not shown), and is darker (Zheng et al., 2006), the decreased CHS1 expression may have a relationship with the poor growth of paccc-1 at this condition. However, it appears that CHS1 RNA expression was not obviously regulated by pH 2.5 and pH 7, and also was not obviously regulated by the PACC loss-of-function mutation at pH 7 (data not shown). Also the promoter of CHS1 was not found to contain a PacC consensus binding site. Thus the expression of CHS1 in W. dermatitidis may be only indirectly regulated by its PacC protein.
The pacc+/−-1 mutant was very sensitive to 0.4 M Na+ on YPDA (Figure 7), which suggests that PacC may regulate a plasma membrane Na+-ATPase pump in W. dermatitidis, a hypothesis consistent with the finding that the sodium pump gene ENA1 is activated by PacC in F. oxysporum and by Rim101 in S. cerevisiae (Caracuel et al., 2003a; Lamb et al., 2001). Sodium dodecyl sulfate (SDS), a cell wall perturbation reagent, and caffeine, a drug that affects parts of a potential cell wall integrity pathway, are reported to inhibit the growth of the S. cerevisiae rim101Δ mutant (Castrejon et al., 2006). In contrast, the treatments of W. dermatitidis in spot assays with YPDA supplemented with 0.002% SDS and with YPDA supplemented with 4 mM caffeine did not reduce the growth of the pacc+/−-1 mutant to any greater extent than they did with the wild type at 25°C and 37°C (data not shown). These results suggested that the pacc+/−-1 mutant was hypersensitive to 0.4 M Na+ but not very sensitive to 0.002% SDS and 4 mM caffeine.
It is important to note that in yeast species, such as S. cerevisiae and C. albicans, the PacC homolog Rim101 was found to be involved in yeast-hyphal transitions. Here we show that in W. dermatitidis, a filamentous, conidiogenous mold, capable of polymorphic vegetative growth, PacC also regulates yeast-hyphal transitions. In this respect, we found that the pacc+/−-1 mutant strain was largely decreased in filamentous growth on PDA at 25°C (Figure 8), but conidiation still occurred (Figure 9), suggesting that the conidiation genes were not repressed. This result differs from our previous findings that the putative transcription factors StuA and Tup1 of W. dermatitidis, which both have orthologs known to function in conidiogenesis in A. nidulans, are involved in activating the regulation of both yeast-hyphal transition and conidiogenesis in W. dermatitidis (Liu et al., 2008; Wang and Szaniszlo, 2007). In addition, both the stuaΔ1A and tup1 Δ-1 strains in W. dermatitidis produced convoluted colony surface growth on YPDA at 37°C (Liu et al., 2008; Wang and Szaniszlo, 2007), whereas pacc+/−-1 did not produce this colony phenotype (data not shown). Finally the overexpression of StuA in W. dermatitidis strongly repressed filamentous growth on PDA at 25°C and 37°C and convoluted growth on YPDA at 37°C (Wang and Szaniszlo, 2007), whereas constitutive expression of PacC slightly activated filamentous growth on PDA at 25°C and 37°C and convoluted growth on YPDA at 37°C (data not shown). These results suggest that PacC, StuA and Tup1 in W. dermatitidis may have common regulatory targets, and also have their own specific regulatory targets. Further exploration of these possibilities is therefore warranted.
ACKNOWLEDGEMENTS
This research was supported by a grant to P.J.S. from the National Institute of Allergy and Infectious Disease (AI33049).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Abramczyk D, Park C, Szaniszlo PJ. Cytolocalization of the class V chitin synthase in the yeast, hyphal and sclerotic morphotypes of Wangiella (Exophiala) dermatitidis. Fungal Gen. Biol. 2009;46:28–41. doi: 10.1016/j.fgb.2008.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arechiga-Carvajal ET, Ruiz-Herrera J. The RIM101/pacC homologue from the basidiomycete Ustilago maydis is functional in multiple pH-sensitive phenomena. Eukaryot. Cell. 2005;4:999–1008. doi: 10.1128/EC.4.6.999-1008.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bignell E, Negrete-Urtasun S, Calcagno AM, Haynes K, Arst HN, Jr, Rogers T. The Aspergillus pH-responsive transcription factor PacC regulates virulence. Mol. Microbiol. 2005;55:1072–1084. doi: 10.1111/j.1365-2958.2004.04472.x. [DOI] [PubMed] [Google Scholar]
- Caracuel Z, Casanova C, Roncero MI, Di Pietro A, Ramos J. pH response transcription factor PacC controls salt stress tolerance and expression of the P-Type Na+ -ATPase Ena1 in Fusarium oxysporum. Eukaryot. Cell. 2003a;2:1246–1252. doi: 10.1128/EC.2.6.1246-1252.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Caracuel Z, Roncero MI, Espeso EA, Gonzalez-Verdejo CI, Garcia-Maceira FI, Di Pietro A. The pH signalling transcription factor PacC controls virulence in the plant pathogen Fusarium oxysporum. Mol. Microbiol. 2003b;48:765–779. doi: 10.1046/j.1365-2958.2003.03465.x. [DOI] [PubMed] [Google Scholar]
- Castrejon F, Gomez A, Sanz M, Duran A, Roncero C. The RIM101 pathway contributes to yeast cell wall assembly and its function becomes essential in the absence of mitogen-activated protein kinase Slt2p. Eukaryot. Cell. 2006;5:507–517. doi: 10.1128/EC.5.3.507-517.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davis D, Edwards JE, Jr, Mitchell AP, Ibrahim AS. Candida albicans RIM101 pH response pathway is required for host-pathogen interactions. Infect. Immun. 2000a;68:5953–5959. doi: 10.1128/iai.68.10.5953-5959.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davis D, Wilson RB, Mitchell AP. RIM101-dependent and-independent pathways govern pH responses in Candida albicans Mol. Cell. Biol. 2000b;20:971–978. doi: 10.1128/mcb.20.3.971-978.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Diez E, Alvaro J, Espeso EA, Rainbow L, Suarez T, Tilburn J, Arst HN, Jr, Penalva MA. Activation of the Aspergillus PacC zinc finger transcription factor requires two proteolytic steps. EMBO J. 2002;21:1350–1359. doi: 10.1093/emboj/21.6.1350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eisendle M, Oberegger H, Buttinger R, Illmer P, Haas H. Biosynthesis and uptake of siderophores is controlled by the PacC-mediated ambient-pH Regulatory system in Aspergillus nidulans. Eukaryot. Cell. 2004;3:561–563. doi: 10.1128/EC.3.2.561-563.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El Barkani A, Kurzai O, Fonzi WA, Ramon A, Porta A, Frosch M, Muhlschlegel FA. Dominant active alleles of RIM101 (PRR2) bypass the pH restriction on filamentation of Candida albicans. Mol. Cell. Biol. 2000;20:4635–4647. doi: 10.1128/mcb.20.13.4635-4647.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Espeso EA, Arst HN., Jr On the mechanism by which alkaline pH prevents expression of an acid-expressed gene. Mol. Cell. Biol. 2000;20:3355–3363. doi: 10.1128/mcb.20.10.3355-3363.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Espeso EA, Penalva MA. Three binding sites for the Aspergillus nidulans PacC zinc-finger transcription factor are necessary and sufficient for regulation by ambient pH of the isopenicillin N synthase gene promoter. J. Biol. Chem. 1996;271:28825–28830. doi: 10.1074/jbc.271.46.28825. [DOI] [PubMed] [Google Scholar]
- Espeso EA, Tilburn J, Sanchez-Pulido L, Brown CV, Valencia A, Arst HN, Jr, Penalva MA. Specific DNA recognition by the Aspergillus nidulans three zinc finger transcription factor PacC. J. Mol. Biol. 1997;274:466–480. doi: 10.1006/jmbi.1997.1428. [DOI] [PubMed] [Google Scholar]
- Feng B, Wang X, Hauser M, Kaufmann S, Jentsch S, Haase G, Becker JM, Szaniszlo PJ. Molecular cloning and characterization of WdPKS1, a gene involved in dihydroxynaphthalene melanin biosynthesis and virulence in Wangiella (Exophiala) dermatitidis. Infect. Immun. 2001;69:1781–1794. doi: 10.1128/IAI.69.3.1781-1794.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fernandez-Martinez J, Brown CV, Diez E, Tilburn J, Arst HN, Jr, Penalva MA, Espeso EA. Overlap of nuclear localisation signal and specific DNA-binding residues within the zinc finger domain of PacC. J. Mol. Biol. 2003;334:667–684. doi: 10.1016/j.jmb.2003.09.072. [DOI] [PubMed] [Google Scholar]
- Flaherty JE, Pirttila AM, Bluhm BH, Woloshuk CP. PAC1, a pH-regulatory gene from Fusarium verticillioides. Appl. Environ. Microbiol. 2003;69:5222–5227. doi: 10.1128/AEM.69.9.5222-5227.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Geiser DM, Gueidan C, Miadlikowska J, Lutzoni F, Kauff F, Hofstetter V, Fraker E, Schoch CL, Tibell L, Untereiner WA, Aptroot A. Eurotiomycetes: Eurotiomycetidae and Chaetothyriomycetidae. Mycologia. 2006;98:1053–1064. doi: 10.3852/mycologia.98.6.1053. [DOI] [PubMed] [Google Scholar]
- Karuppayil SM, Szaniszlo PJ. Importance of calcium to the regulation of polymorphism in Wangiella (Exophiala) dermatitidis. J. Med. Vet. Mycol. 1997;35:379–388. doi: 10.1080/02681219780001471. [DOI] [PubMed] [Google Scholar]
- Lamb TM, Mitchell AP. The transcription factor Rim101p governs ion tolerance and cell differentiation by direct repression of the regulatory genes NRG1 and SMP1 in Saccharomyces cerevisiae. Mol. Cell. Biol. 2003;23:677–686. doi: 10.1128/MCB.23.2.677-686.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lamb TM, Xu W, Diamond A, Mitchell AP. Alkaline response genes of Saccharomyces cerevisiae and their relationship to the RIM101 pathway. J. Biol. Chem. 2001;276:1850–1856. doi: 10.1074/jbc.M008381200. [DOI] [PubMed] [Google Scholar]
- Li W, Mitchell AP. Proteolytic activation of Rim1p, a positive regulator of yeast sporulation and invasive growth. Genetics. 1997;145:63–73. doi: 10.1093/genetics/145.1.63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu H, Abramczyk D, Cooper CR, Jr, Zheng L, Park C, Szaniszlo PJ. Molecular cloning and characterization of WdTUP1, a gene that encodes a potential transcriptional repressor important for yeast-hyphal transitions in Wangiella (Exophiala) dermatitidis. Fungal Genet. Biol. 2008;45:646–656. doi: 10.1016/j.fgb.2007.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu H, Kauffman S, Becker JM, Szaniszlo PJ. Wangiella (Exophiala) dermatitidis WdChs5p, a class V chitin synthase, is essential for sustained cell growth at temperature of infection. Eukaryot. Cell. 2004;3:40–51. doi: 10.1128/EC.3.1.40-51.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lotz H, Sohn K, Brunner H, Muhlschlegel FA, Rupp S. RBR1, a novel pH-regulated cell wall gene of Candida albicans, is repressed by RIM101 and activated by NRG1. Eukaryot. Cell. 2004;3:776–784. doi: 10.1128/EC.3.3.776-784.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- MacCabe AP, Orejas M, Perez-Gonzalez JA, Ramon D. Opposite patterns of expression of two Aspergillus nidulans xylanase genes with respect to ambient pH. J. Bacteriol. 1998;180:1331–1333. doi: 10.1128/jb.180.5.1331-1333.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- MacCabe AP, Van den Hombergh JP, Tilburn J, Arst HN, Jr, Visser J. Identification, cloning and analysis of the Aspergillus niger gene pacC, a wide domain regulatory gene responsive to ambient pH. Mol. Gen. Genet. 1996;250:367–374. doi: 10.1007/BF02174395. [DOI] [PubMed] [Google Scholar]
- Matsumoto T, Ajello L, Matsuda T, Szaniszlo PJ, Walsh TJ. Developments in hyalohyphomycosis and phaeohyphomycosis. J. Med. Vet. Mycol. 1994;1(32 Suppl):329–349. doi: 10.1080/02681219480000951. [DOI] [PubMed] [Google Scholar]
- Mingot JM, Espeso EA, Diez E, Penalva MA. Ambient pH signaling regulates nuclear localization of the Aspergillus nidulans PacC transcription factor. Mol. Cell. Biol. 2001;21:1688–1699. doi: 10.1128/MCB.21.5.1688-1699.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mingot JM, Tilburn J, Diez E, Bignell E, Orejas M, Widdick DA, Sarkar S, Brown CV, Caddick MX, Espeso EA, et al. Specificity determinants of proteolytic processing of Aspergillus PacC transcription factor are remote from the processing site, and processing occurs in yeast if pH signalling is bypassed. Mol. Cell. Biol. 1999;19:1390–1400. doi: 10.1128/mcb.19.2.1390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Muhlschlegel FA, Fonzi WA. PHR2 of Candida albicans encodes a functional homolog of the pH-regulated gene PHR1 with an inverted pattern of pH-dependent expression. Mol. Cell. Biol. 1997;17:5960–5967. doi: 10.1128/mcb.17.10.5960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Penalva MA, Arst HN., Jr Recent advances in the characterization of ambient pH regulation of gene expression in filamentous fungi and yeasts. Annu. Rev. Microbiol. 2004;58:425–451. doi: 10.1146/annurev.micro.58.030603.123715. [DOI] [PubMed] [Google Scholar]
- Penalva MA, Tilburn J, Bignell E, Arst HN., Jr Ambient pH gene regulation in fungi: making connections. Trends Microbiol. 2008;16:291–300. doi: 10.1016/j.tim.2008.03.006. [DOI] [PubMed] [Google Scholar]
- Ramon AM, Fonzi AW. Diverged binding specificity of Rim101p, the Candida albicans ortholog of PacC. Eukaryot. Cell. 2003;2:718–728. doi: 10.1128/EC.2.4.718-728.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramon AM, Porta A, Fonzi WA. Effect of environmental pH on morphological development of Candida albicans is mediated via the PacC-related transcription factor encoded by PRR2. J. Bacteriol. 1999;181:7524–7530. doi: 10.1128/jb.181.24.7524-7530.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rollins JA, Dickman MB. pH signaling in Sclerotinia sclerotiorum: identification of a pacC/RIM1 homolog. Appl. Environ. Microbiol. 2001;67:75–81. doi: 10.1128/AEM.67.1.75-81.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saporito-Irwin SM, Birse CE, Sypherd PS, Fonzi WA. PHR1, a pH-regulated gene of Candida albicans, is required for morphogenesis. Mol. Cell. Biol. 1995;15:601–613. doi: 10.1128/mcb.15.2.601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schmitt EK, Kempken R, Kuck U. Functional analysis of promoter sequences of cephalosporin C biosynthesis genes from Acremonium chrysogenum: specific DNA-protein interactions and characterization of the transcription factor PACC. Mol. Genet. Genomics. 2001;265:508–518. doi: 10.1007/s004380000439. [DOI] [PubMed] [Google Scholar]
- Suarez T, Penalva MA. Characterization of a Penicillium chrysogenum gene encoding a PacC transcription factor and its binding sites in the divergent pcbAB-pcbC promoter of the penicillin biosynthetic cluster. Mol. Microbiol. 1996;20:529–540. doi: 10.1046/j.1365-2958.1996.5421065.x. [DOI] [PubMed] [Google Scholar]
- Szaniszlo PJ. Molecular genetic studies of the model dematiaceous pathogen Wangiella dermatitidis Int. J. Med. Microbiol. 2002;292:381–390. doi: 10.1078/1438-4221-00221. [DOI] [PubMed] [Google Scholar]
- Szaniszlo PJ, Hsieh PH, Marlowe JD. Induction and ultrastructure of the multicellular (sclerotic) morphology in Phialophora dermatitidis. Mycologia. 1976;68:117–130. [PubMed] [Google Scholar]
- Tilburn J, Sarkar S, Widdick DA, Espeso EA, Orejas M, Mungroo J, Penalva MA, Arst HN., Jr The Aspergillus PacC zinc finger transcription factor mediates regulation of both acid- and alkaline-expressed genes by ambient pH. EMBO J. 1995;14:779–790. doi: 10.1002/j.1460-2075.1995.tb07056.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vincent O, Rainbow L, Tilburn J, Arst HN, Jr, Penalva MA. YPXL/I is a protein interaction motif recognized by Aspergillus PalA and its human homologue, AIP1/Alix. Mol. Cell. Biol. 2003;23:1647–1655. doi: 10.1128/MCB.23.5.1647-1655.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Q, Liu H, Szaniszlo PJ. Compensatory expression of five chitin synthase genes, a response to stress stimuli, in Wangiella (Exophiala) dermatitidis, a melanized fungal pathogen of humans. Microbiology. 2002;148:2811–2817. doi: 10.1099/00221287-148-9-2811. [DOI] [PubMed] [Google Scholar]
- Wang Q, Szaniszlo PJ. WdStuAp, an APSES transcription factor, is a regulator of yeast-hyphal transitions in Wangiella (Exophiala) dermatitidis. Eukaryot. Cell. 2007;6:1595–1605. doi: 10.1128/EC.00037-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z, Szaniszlo PJ. WdCHS3, a gene that encodes a class III chitin synthase in Wangiella (Exophiala) dermatitidis, is expressed differentially under stress conditions. J. Bacteriol. 2000;182:874–881. doi: 10.1128/jb.182.4.874-881.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z, Zheng L, Hauser M, Becker JM, Szaniszlo PJ. WdChs4p, a homolog of chitin synthase 3 in Saccharomyces cerevisiae, alone cannot support growth of Wangiella (Exophiala) dermatitidis at the temperature of infection. Infect. Immun. 1999;67:6619–6630. doi: 10.1128/iai.67.12.6619-6630.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye X, Szaniszlo PJ. Expression of a constitutively active Cdc42 homologue promotes development of sclerotic bodies but represses hyphal growth in the zoopathogenic fungus Wangiella (Exophiala) dermatitidis. J. Bacteriol. 2000;182:4941–4950. doi: 10.1128/jb.182.17.4941-4950.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog, S G. Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol. 2007;45:3713–3720. doi: 10.1128/JCM.02012-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng L, Mendoza L, Wang Z, Liu H, Park C, Kauffman S, Becker JM, Szaniszlo PJ. WdChs1p, a class II chitin synthase, is more responsible than WdChs2p (Class I) for normal yeast reproductive growth in the polymorphic, pathogenic fungus Wangiella (Exophiala) dermatitidis. Arch. Microbiol. 2006;185:316–329. doi: 10.1007/s00203-006-0101-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng L, Szaniszlo PJ. Cloning and use of the WdURA5 gene as a hisG cassette selection marker for potentially disrupting multiple genes in Wangiella dermatitidis. Med. Mycol. 1999;37:85–96. [PubMed] [Google Scholar]












