Abstract
The heme-containing protein CooA of Rhodospirillum rubrum regulates the expression of genes involved in CO oxidation. CooA binds its target DNA sequence in response to CO binding to its heme. Activity measurements and resonance Raman (RR) spectra are reported for CooA variants that bind DNA even in the absence of CO, those in which the wild-type residues at the 121-126 positions, TSCMRT, are replaced by the residues AYLLRL or RYLLRL, and also for variants that bind DNA poorly in the presence of CO, such as L120S and L120F. The Fe-C and C-O stretching RR frequencies of all CooAs examined deviate from the expected backbonding correlation in a manner indicating weakening of the Fe-His77 proximal ligand bond, and the extent of weakening correlates positively with DNA-binding activity. The A(R)YLLRL variants have detectable populations of 5-coordinate heme resulting from partial dissociation of the endogenous distal ligand, Pro2. Selective excitation of this population reveals downshifted Fe-His77 stretching RR bands, confirming the proximal bond weakening. These results support our previous hypothesis that the conformational change required for DNA binding is initiated by displacement of the heme into an adjacent hydrophobic cavity, once CO displaces the Pro2 ligand. Examination of the crystal structure reveals a physical basis for these results, and a mechanism is proposed to link heme displacement to conformational change.
An increasing volume of research has revealed the ubiquity of heme sensor proteins [1, 2], which regulate a range of biological activities in response to changing levels of the gaseous molecules CO, NO or O2. In these proteins, nature has taken advantage of heme’s ability to bind these non-polar molecules, and has coupled the elementary act of ligand binding to a change of protein activity. How this is accomplished has become a central issue in chemical biology.
One of the best opportunities to probe this question is presented by the well-studied molecule CooA [3, 4] from Rhodospirillum rubrum, which grows on CO as sole energy source under anaerobic conditions. When bound by CO, CooA binds its target DNA sequence and activates transcription of genes coding for proteins that oxidize CO to CO2 and reduce protons to H2. CooA is a homodimer and each 221-residue monomer contains an N-terminal heme-binding domain and a C-terminal DNA-binding domain. The X-ray crystal structure has been determined for the CO-free inactive state of Fe(II) CooA [5], but not for the CO-bound active state. However, CooA is homologous to another well-studied transcription factor, CRP (cAMP receptor protein) [6-8], whose crystal structure has been determined in the cAMP-bound active state. Comparison of the two structures (Figure 1) reveals similar folds for both the DNA- and effector-binding domains, but very different domain orientations. In the symmetric structure of active CRP, the DNA-binding domains are positioned near to the effector-binding domains in such a way as to expose the F helices to properly interact with target DNA. In contrast, the structure of inactive CooA is asymmetric, presumably owing to crystal forces [5]. The “B” chain has an extended structure due to a fusion of the C helix at the dimer interface with the D helix of the DNA-binding domain. The “A” chain has a bend between the C and D helices as in active CRP, but the domain orientation is completely different. In both monomers of inactive CooA, the F helices are buried from solvent and should be inactive for DNA binding. In both CRP and CooA, the C-helices are associated in a coiled-coil, and each is in contact with both effector domains. The heme groups of inactive Fe(II) CooA are ligated on one side by His77 and on the other by the Pro2 N-terminus of the opposite chain. The Pro2 ligands are displaced when CO binds [9]. These interconnections between the two chains no doubt account for the cooperativity observed in CO binding [10].
Figure 1.

X-ray crystal structures of CooA (left, PDB ID#1FT9) and CRP (right, PDB ID#1G6N) showing the difference in orientation of the DNA-binding domains, relative to the effector-binding domains. In the CooA crystal, the C-helix connecting the effector- and DNA-binding domains is fully extended in the B chain, but is bent over in the A chain (though not as much as in CRP), probably due to crystal forces (5).
The question of how CO binding to the CooA hemes can induce reorientation of the DNA-binding domains has been addressed via mutagenesis and spectroscopic studies [10-15]. From resonance Raman (RR) evidence on altered proteins, we have proposed [10] that the displacement of Pro2 by CO induces displacement of the hemes into adjacent hydrophobic cavities, accompanied by readjustment of the C-helices. The importance of C-helix repositioning has also been shown by a substantial amount of functional analysis of variants altered in this region [16]. We now elaborate our model with further evidence, including RR studies of variants that are constitutively active (active in the absence of CO), as well as other variants with low activity even in the presence of CO. In addition we suggest a mechanism for the initiation of C-helix bending required for reorientation of the DNA-domains, through protein tension generated by the heme displacement. Finally we present evidence that CO-bound wild-type (WT) CooA is not entirely in the ‘on’ conformation, but is in an intermediate conformation, or else in an equilibrating mixture of ‘on’ and ‘off’ populations. The latter alternative is supported by previous kinetic measurements [17], indicating that CO-bound CooA is a mixture of forms that are ‘closed’ and ‘open’ with respect to CO dissociation and has recently been discussed more fully in [3].
METHODS
Strains, Plasmids, and in Vivo Assays
The construction of strains overexpressing WT CooA and CooA variants in an Escherichia coli background having a β-galactosidase reporter system in the chromosome was described previously [8]. All the site-directed and region-randomized cooA mutations were constructed in a pEXT20-based expression plasmid, which provides tight control of cooA expression [11]. The selection for and properties of 121-AYLLRL-126 and 121-RYLLRL-126 CooAs (WT sequence is 121-TSCMRT-126) are described elsewhere [18]. Construction and purification of G117I CooA [27] and ΔP3R4 CooA [14,20] have been described.
CooA Purification
The purification of WT CooA and the variants was performed with our standard method as described previously [12] or by modified protocols [13,14,18]. The purity of WT CooA and CooA variants was estimated to be >95% based on SDS-PAGE. The heme content of CooA preparations was estimated using the extinction coefficient of WT Fe(II)-CO CooA (220 mM-1 cm-1, ref. 31) and protein concentration was measured using the BCA assay (Pierce).
In vitro DNA-binding assays of WT CooA and CooA variants were performed using the conditions described elsewhere [18]. As a fluorescence probe, a 26-base pair target DNA containing PcooF was labeled with Texas Red on one end of the duplex and used at the concentration of 6.4 nM. Salmon sperm DNA was used at 1,000-fold excess as the non-specific DNA competitor. Dissociation constants (Kd) were calculated by fitting of the binding data to a nonlinear equation with correction of the fluorescence quenching as described elsewhere [15].
Sample preparation
Purified CooA was diluted in buffer (25 mM MOPS/0.1 M NaCl, pH 7.4) to a heme concentration of ~ 20 μM. For AYLLRL and RYLLRL variants, whose solubility and degree of Pro2 ligation is salt-dependent [18], a 25 mM MOPS/0.5 M NaCl/50 mM CaCl2, pH 7.4 buffer was used. CooA samples were purged with N2 for 20 min, then with CO for ~ 5 min, followed by reduction of the Fe(III) to the Fe(II) form with sodium dithionite (final concentration ~20-60 mM). Reduction and CO binding were monitored by changes in the absorption spectra.
The Fe(II) CooA samples were prepared by first purging with N2 for 20 min, followed by the reduction with sodium dithionite. In order to increase the 5-coordinate (5-c) fraction, a buffer with higher salt concentration (25 mM MOPS/0.5 M NaCl/50 mM CaCl2, pH 7.4) was used.
DNA-bound Fe(II)-CO CooA was prepared according to the published procedures [19, 20] with the following modifications. The double-stranded DNA sample (provided by Prof. Thomas Poulos, UC Irvine)
5’–GCATAACTGTCATCTGGCCGACAGACGATGG–3’
3’–GTATTGACAGTAGACCGGCTGTCTGCTACCG–5’
was heated at 80°C for 5 min in a water bath and then cooled at room temperature for ~2 h. Then the annealed DNA (final concentration 15 μM) was mixed with a sample of either WT or RYLLRL CooA (final concentration 15 μM) in 40 mM Tris/50 mM KCl/6 mM CaCl2, pH 8.0 buffer and incubated at room temperature for ~30 min. The Fe(II)-CO sample was then prepared as described above.
Resonance Raman (RR) spectroscopy
RR spectra were obtained with excitation wavelengths of 406.7 nm and 568.1 nm from a Kr+ laser (Spectra Physics, 2080-RS) and 441.7 nm from a He-Cd (Liconix) laser in a 270° backscattering sample geometry. Photodissociation of the bound CO was minimized by using low laser power (~1 mW at the sample) and by spinning the sample. The scattered light was collected and focused onto a triple spectrograph (Chromex) equipped with a CCD detector (Roper Scientific) operating at 77 K. Spectra were calibrated with dimethyl formamide, ethyl acetate and dimethylsulfoxide-d6.
RESULTS
In Vitro DNA-binding analysis identifies variants affected in the heme vicinity with a range of activities
To explore the connection between ligand binding and protein conformation change, a set of CooA variants was chosen with substitutions predicted to be near the heme. Three classes of variants were investigated: a) those with changes at position Phe74, which forms part of the interior heme pocket on the proximal side (His77, Figure 1), and is conserved (Phe or Tyr) in CooA homologues [21], b) those with changes at position Leu120, an invariant residue in CooA homologues [21], which forms part of the heme pocket on the distal side and simultaneously serves as an “a” position coiled-coil residue in the C-helix, and c) those in which changes to the C-helix position 121-126 segment (Figure 1) have significantly stabilized the DNA-binding conformation of the protein [18].
These variants were produced by the mutagenesis scheme described below and selected on the basis of in vivo screens in which CooA activity is linked to the expression of β-galactosidase [18]. The in vivo activity depends upon the variant’s accumulation levels, specific DNA-binding affinity, and ability to interact with RNA polymerase. Consequently the biochemical properties of the identified variants were examined further through in vitro DNA binding.
Randomization of the codon for residue 74, followed by screening for variants with CO-dependent activity in vivo, yielded two distinct classes with activity above background (data not shown). Highly active variants possessed either Phe or Tyr residues, while variants with lower activity contained Leu, Gly, or His residues. At position 120, similar mutagenesis and screening showed that only Leu afforded CO-dependent activity similar to WT CooA; L120F and L120S, which were chosen for further study, were poorly activated by CO. The selection and analysis of the CO-independent, constitutively active variants possessing changes in the C-helix 121-126 region is elaborated elsewhere [18]. These changes produce CooA that is active even without added CO.
In vitro DNA-binding affinity (Table 1) was measured with a fluorescence polarization assay, which monitors binding of CooA to a Texas Red-labeled target DNA [20]. The 121-126 C-helix variants precipitate from solution at high protein concentrations, but were stabilized at higher salt concentrations. This property and their exceptional DNA affinity made analysis under standard conditions difficult (50 mM KCl had been used previously, [12]), the DNA-binding analysis was modified to include higher salt levels (250 mM KCl and 20 mM CaCl2) and a 1000-fold excess of non-specific DNA to all samples. The affinity of CO-bound WT CooA for the target DNA was decreased approximately 10-fold under these conditions relative to assays performed previously at lower salt levels [20]. In terms of DNA binding, F74Y and F74L CooAs showed CO-dependent affinities similar to that of WT CooA (Table 1), suggesting that the poor in vivo activity of F74L CooA represents a defect in its interaction with RNA polymerase. In contrast, changing Leu120 to Phe or Ser diminished activity in vivo and in vitro, with >10-fold decrease in DNA affinity relative to CO-bound WT CooA (Table 1). The activities of the 121-126 C-helix variants were unusual in two respects: a) these variants possessed DNA-binding affinities in vitro in the absence of CO that were similar to those of CO-bound WT CooA, and b) in the presence of CO their DNA-binding affinity exceeded that of WT CooA. Two rather similar variants in this region were studied, with the following two sequences at positions 121-6: AYLLRL and RYLLRL. In the following text, we will refer to them by these names or by A(R)YLLRL for the pair.
Table 1.
In vitro DNA-binding affinities of purified CooA proteins.
| CooA | Fe(II) Kd (nM in heme) | Fe(II)-CO Kd (nM in heme) |
|---|---|---|
| WTa,b | >5,000 | 212 (13) |
| 121-RYLLRL-126a,b | 178 (18) | 59 (7) |
| 121-AYLLRL-126b | 86 (10) | 46 (2) |
| F74Y | >5,000 | 152 (1) |
| F74L | >5,000 | 383 (136) |
| L120F | >5,000 | ~2900 (estimated) |
| L120S | >5,000 | ~3200 (estimated) |
Average of independent assays with 95% confidence interval shown in parentheses. All assays were performed in “high salt” fluorescence polarization buffer that includes 250 mM KCl and 20 mM CaCl2.
Data from [18]
RR Frequencies Indicate Variable Fe-His Bond Strengths in CO Adducts of the CooA variants
Resonance Raman spectra of heme-CO adducts reveal the positions of Fe-C and C-O stretching vibrations, and these positions provide information on both distal and proximal interactions of the adduct with the surrounding protein [22]. Figure 2 reveals an unusual pattern for the νFeC and νCO Raman bands of the CooA variants in this study. νCO varies over a significant range, 1975 – 1986 cm-1, but νFeC is essentially constant, at 486 - 487 cm-1.
Figure 2.

RR bands arising from Fe-C (left) and C-O (right) stretching vibrations for CO adducts of the indicated CooA variants.
When there are changes in backbonding due electrostatic influences in the vicinity of the bound CO, then νCO and νFeC are anticorrelated; as one increases the other decreases, as a result of changes in backbonding [22]. This behavior is illustrated in Figure 3 (solid line) for a series of myoglobin (Mb) variants having substitutions among residues distal to the bound CO. However, increasing or decreasing the donor strength of the proximal ligand, trans to the CO, produces negative or positive deviations from the backbonding correlation [22].
Figure 3.

νFe-C/νCO backbonding plot showing data for CO adducts of myoglobin variants (□) (17) and of the CooA variants in this study (■). The CooA variants deviate horizontally from the Mb line, as expected for weakening of the Fe-His bond. The dashed line is the correlation for 5-coordinate Fe(II) porphyrin CO adducts (20). The lower insert shows the proximal histidine H-bond arrangement in Mb.
The νCO/νFeC point for WT CooA falls significantly above the Mb line, implying, as noted earlier [10], a significant weakening of the bond to the proximal imidazole ring relative to Mb. This was attributed to displacement of the heme as part of the activation mechanism of CooA induced by CO binding. We now observe that the data for the variants in the present study fall on a horizontal line, which intersects the Mb line at about the position occupied by Mb variants in which the distal histidine is replaced by apolar residues. This is exactly the behavior expected if the CO pocket is apolar in CooA (as inferred earlier), but the Fe-His bond is weakened to different extents, depending on the variant. The higher νCO reflects diminished backdonation because of diminished forward donation by the His ligand; however, the expected inverse effect on νFeC is compensated by diminished σ competition between the Fe-His and Fe-C bonds [22]. DFT calculations by Franzen [23] find νCO lowering but little change in νFeC when the bond to a proximal imidazole is strengthened by donating a H-bond, as the proximal ligand in Mb does (see lower inset in Figure 3). We infer that the CooA Fe-His is weakened to various extents, reflecting variable displacement of the heme group.
Significantly, νCO is increased when CO-bound WT CooA binds its target DNA sequence, implying a further weakening of the Fe-His bond (Figure 2). This same higher frequency is seen for CO adducts of the constitutively active A(R)YLLRL variants, in the absence of DNA, and no further shift is seen when DNA is bound. In the presence of CO, DNA-binding affinity is about three times higher for A(R)YLLRL than for WT CooA (Table 1). We interpret these results to mean that the position 121-126 substitutions have fully stabilized the ‘on’ conformation of CooA-CO, whereas CO-bound WT CooA is in an equilibrium between ‘on’ and ‘off’ forms, or else it is in an intermediate form, which is turned ‘on’ by DNA binding. Although an equilibrium between two forms should produce a superposition of two spectral responses, the spectral resolution is insufficient to distinguish a superposition from an intermediate response; the difference in the central position of the νCO band is less than its width (Figure 2). An equilibrium mixture of ‘on’ and ‘off’ populations would be consistent with kinetic evidence for ‘open’ and ‘closed’ forms of CooA coexisting in the CO-bound WT protein [17].
On the other hand, the L120S and L120F variants, which display low CO-dependent activity, have significantly stronger Fe-His bonds, as judged by their νCO/νFeC points being closer to the Mb line than is the WT protein. Thus the low activity of these mutants can be attributed to destabilization of the ‘on’ conformation, with an attendant diminution in the average heme displacement. The L120S variant displays a small but noticeable (3 cm-1) downshift in νFeC, relative to the L120F variant, and a corresponding upshift (4 cm-1) in νCO. These opposite shifts are a signal of decreased backdonation, associated with negative polarity among distal groups near the bound CO. This effect implies that the Leu120 sidechain is close to the CO, and that replacement with Ser introduces negative polarity via the OH lone pair, similar to the H64V/V68T variant of Mb. Yamashita et al. reached a similar conclusion by examining the L120N variant, although in that case there was a 6 cm-1 upshift in νFeC, presumably reflecting positive polarity from the asparagine NH2 group [15].
Aono and coworkers reported that adding DNA to CooA induced an additional νFeC RR band, at 519 cm-1, and a narrowing of the main νFeC band at 487 cm-1 [19]. We do not observe these effects (Figure 2) and note that their experiments were carried out without added divalent cations, which have subsequently been shown to be essential for DNA binding [24]. Also the CooA preparation studied by Aono’s group exhibited the νCO band at 1969 cm-1 [19], much lower than the 1982 cm-1 we observe, but close to a subsidiary νCO band which can be seen in our spectra at higher amplification, and assigned earlier to a fraction of inactive molecules with undisplaced heme [10]. The preparation of Aono and coworkers did contain a fraction with νCO = 1979 cm-1, the position found in picosecond FTIR experiments for CO-bound CooA molecules undergoing photolysis [25]. This can be taken to represent the active fraction of molecules.
Constitutively Active Variants without CO Show Weakened Fe-His Bonds
To assess the Fe-His bond strength in the absence of bound CO, we determined the frequency of the Fe-His stretching vibration. This mode can only be detected in RR spectra of 5-c hemes, with no sixth ligand. It is not enhanced for 6-coordinate (6-c) hemes [26]. WT CooA has a sixth ligand, Pro2, but there are variants with detectable populations of 5-c heme because of perturbations to the Fe-Pro2 bond. One such variant is G117I, in which the bulky Ile sidechain sterically hinders the Pro2 ligand [27]. By tuning the Raman laser to 442 nm, the wavelength of the 5-c heme Soret absorption (seen as a shoulder on the dominant 420-nm band in Figure 4), one can selectively enhance the 5-c heme RR spectrum, which reveals a strong Fe-His band at 218 cm-1 (in our previous study [10] the reported frequency was 220 cm-1, probably reflecting a small calibration error; within a given study, the band positions are repeatable to +/- 1 cm-1). This value is close to the 220 cm-1 frequency of deoxyMb [28]. Likewise the variant ΔP3R4, in which the two penultimate residues are deleted from the N-terminus, has a small 5-c fraction, because the Fe-Pro2 bond is weakened [10]. Its 442 nm RR spectrum also reveals a 218 cm-1 νFe-His band (Figure 4). Thus variants with 5-c populations resulting from distal perturbations of the Fe-Pro2 bond have Fe-His bonds that are comparable to that of deoxyMb.
Figure 4.
RR spectra excited at 441.6 nm (left) in resonance with the 440 nm Soret absorption shoulder (right) of from the 5-coordinate populations of the indicated CooA variants in their Fe(II) states. The Fe-His stretching band shifts from 218 cm-1 for the inactive variants (top) to 214 cm-1 for the constitutively active variants (bottom) in their Fe(II) states. (A spectrum of Fe(II) WT CooA lacks these signals because it has not detectable 5-coordinate species.)
The A(R)YLLRL variants also have significant 5-c populations, as revealed by prominent 440 nm absorption band shoulders (Figure 4). Their 440 nm RR spectra reveal Fe-His bands at significantly downshifted frequencies, 214 cm-1. Inasmuch as these variants bind DNA in the absence of CO, we infer that the downshifted frequency is an indication of the protein being substantially in the ‘on’ conformation. The downshift is an indication of a weakened Fe-His bond in this conformation. This inference is consistent with the detection by Uchida et al. [29] of a downshifted Fe-His band in picosecond RR spectrum of the prompt photoproduct of WT CooA-CO. On this time scale, the 5-c heme generated by photolysis has not yet relaxed to the structure it would have in the ‘off’ conformation of WT CooA. The reported frequency, 216 cm-1 [30], was slightly higher than that of the A(R)YLLRL variants, consistent with the view that the latter are shifted further toward the ‘on’ conformation than is the WT CooA CO adduct.
The weakened Fe-His bond is thus attributed to heme displacement in the ‘on’ conformation. The very existence of a 5-c fraction in the A(R)YLLRL variants can also be attributed to heme displacement, which would strain both the Fe-His77 and the Fe-Pro2 bond, occasioning disruption of the latter.
Fe-His Bond Weakening and H-bonding
The Fe-imidazole bond strength in heme adducts is known to be modulated by H-bond donation from the N-H proton on the bound imidazole to nearby H-bond acceptors [22]. The H-bond increases the negative charge on the imidazole ligand, increasing its interaction with the Fe. DeoxyMb has an intermediate νFe-His frequency, 220 cm-1, consistent with an H-bond, of moderate strength, to the neutral OH group of a Ser residue and to a backbone carbonyl (see the lower inset in Figure 3). An H-bond of similarly moderate strength is implied by the comparable frequency, 218 cm-1, observed for the 5-c population of the G117I variant of CooA (Figure 4).
The crystal structure of inactive Fe(II) CooA reveals that the most obvious candidate for accepting an H-bond from His77 is the amide sidechain carbonyl of Asn42 [5] (Figure 5); the N….O distance is short, 2.7 Å, consistent with a significant H-bond. To test the role of this H-bond, we replaced Asn42 in the G117I variant with alanine and aspartate residues. Alanine eliminates the possibility of H-bonding, while aspartate might make the H-bond stronger, by analogy with the peroxidases [28,31]. To our surprise, the Fe-His band remained at 218 cm-1 (Figure 4). We speculate that both replacements induced a water molecule to enter the proximal region of the heme, and H-bond with His77, replacing the Asn42 H-bond with one of about the same strength. We considered testing this hypothesis with D2O exchange, but there be an exchange on the imidazole, increasing its effective mass slightly and causing a small shift whether an H-bond to H2O existed. Alternatively, the H-bond acceptor might be the Cys75 residue, which is known to become the proximal ligand in the oxidized form [32,33]; a Cys….His interaction has been proposed in the heme sensor protein N PAS protein 2 [34]. However, such an interaction in CooA would require a significant conformation change between crystal and solution.
Figure 5.

Detail of the CooA crystal structure showing the proposed displacement (red arrows) of the hemes into the adjacent cavities (purple and aqua space-filled regions), and the connection of the His77 ligand to the β4/β5 hairpin loop, which is anchored to the C-helix via the Arg118-Asp72 and (in the B chain) Arg138-Glu59 salt-bridges. Also shown are specific surfaces of the two cavities that are actually lined by Phe74 (green).
An alternative explanation for Fe-His bond weakening implied by the 214 cm-1 frequency is simple mechanical tension. Displacement of the heme would strain the Fe-His bond, because His77 is anchored on a β-strand in the effector-binding domain (Figure 5). Hemoglobin (Hb) provides a precedent, since T-state displacement of the F-helix, which holds the proximal histidine, induces Fe-His weakening in the α chains in hemoglobin tetramers [28]. The energetics have been evaluated computationally by Marti et al. [35], who found an anomalously weak Fe-His bond in the deoxyHb α subunit, resulting from protein forces, although H-bonding also plays a role. In general, effects of tension and H-bonding will be entangled, since any motion of the histidine ligand in response to strain will also affect its H-bonding to nearby acceptors.
Negligible Heme Electronic Interaction with Phe74
The Phe74 sidechain is in close proximity to the heme (see Figure 5) and the possibility existed of even closer contact in the CO adduct as a result of heme displacement. This might have induced an electronic interaction between the heme and the phenyl group. We tested for such an effect by measuring the position of the porphyrin ν11 band for Phe74 variants (Figure 6). ν11 is a non-totally symmetric mode of the heme, and is selectively enhanced with 568 nm excitation, in resonance with the Q electronic transitions. The position of ν11 is sensitive to electron donation effects at the heme Fe. In WT CooA, its frequency is 1532 cm-1, but is shifted up to 1536 cm-1 in the ΔP3R4 variant, as a result of weakening of the strong donor interaction of the N-terminal proline with the heme [10]. In CooA-CO the frequency shifts up further, to 1546 cm-1 (Figure 6), as a result of electron withdrawal from the heme to the CO, via back donation. When the CO adducts were compared for F74Y and F74L variants with WT CooA (Figure 6), the frequency did not vary by more than 1 cm-1. The νFeC and νCO positions were likewise unaffected by the Phe74 substitutions (data not shown), indicating no influence on the Fe-His bond weakening. We conclude that there is no evidence for a significant heme-phenyl electronic interaction.
Figure 6.

RR spectra for the indicated CooA variants excited at 568 nm, in resonance with the heme Q absorption bands; non-totally symmetric porphyrin modes are selectively enhanced. The insert shows that ν11, a marker for electron donation to the porphyrin ring, shifts no more that 1cm-1 when Phe74 is replaced by Tyr or Leu.
DISCUSSION
CooA Activation is Initiated by Heme Displacement
This study addresses the mechanism whereby the binding of CO to the heme group of CooA induces the protein to bind its target DNA sequence. The crystal structure of the inactive CO-free form reveals that the DNA-binding domains of the two monomers are different from each other, but both are strikingly rearranged when compared to the structure of the active form of the homologous CRP protein (Figure 1). It is less obvious, however, how representative the crystal structures are to the set of the protein structures in solution. Modeling of small angle X-ray scattering data led Akiyama et al. [36] to the conclusion that there is only a small change in the relative orientation of the effector and DNA-binding domains when CO binds CooA in solution. However, this analysis did not take into account the possibility that CooA-CO is a mixture of conformations, as discussed below. In view of the flexibility of the interdomain hinge, and the evidence from the CooA structure that crystal forces may affect the domain orientation, it seems quite possible that still other orientations are accessible in solution.
How is the transition from ‘off’ to ‘on’ induced by CO binding to the heme? In our earlier study we proposed that the primary impetus for the repositioning of the DNA-binding domains was displacement of the heme toward an adjacent cavity that can be identified in the CooA crystal structure (Figure 5), together with a complementary displacement of the C-helices [10]. The cavity is hydrophobic and hydrophobic forces would favor the heme displacement toward it, once the anchoring sixth ligand, the proline N-terminus of the opposite chain (Figure 1), is displaced by CO and expelled from the heme pocket [10], thus exposing the heme to solvent. The C-helix would then readjust to accommodate the displaced heme, thereby repositioning itself to reorient the DNA-binding domains.
Support for this proposal came from mutational and RR evidence for interaction of the bound CO with C-helix residues, Ile113, Leu116, Gly117, and such interaction requires repositioning of the hemes and the C-helices [10]. The heme displacement accounts for the weakening of the Fe-His bond, which is deduced from the horizontal displacement of the νFeC/νCO point from the backbonding plot (Figure 3), the extent of the deviation increasing with DNA-binding affinity of a given CooA variant. Kubo et al. [30] report additional support for the heme and C- helix displacements hypothesis. The UV-RR response of the single tryptophan residue, Trp110, is augmented when CO binds to CooA, indicative of a more hydrophobic environment for the Trp110 sidechain. Trp110 is on the C-helix, close to the heme, and would become more buried as a result of the proposed displacements.
The connection between heme displacement and Fe-His bond weakening is confirmed by the lowered νFe-His in the 5-coordinate fractions of constitutively active CooA variants. In these variants substitution of the 121-126 sequence, TSCMRT, by A(R)YLLR produces active protein with or without CO binding [16]. The heme is displaced even in the absence of CO, weakening the bonds to both axial ligands, Pro2 and His77. This weakening is reflected in partial dissociation of Pro2 and in lowering of the Fe-His77 stretching frequency, and, by implication, the bond force constant.
Variant Residues Alter the Heme Cavity
How can we understand the heme displacement in the CO-free A(R)YLLR variants? The 121-126 chain segments are adjacent to the heme, and are part of the coiled-coil region of the C-helices from the two chains; they are close to the hinge, formed by residues 130-140, where the C-helices bend in the ‘on’ conformation (CRP) (Figure 1). In Figure 5, we show the hydrophobic cavities adjacent to the heme groups in the CooA crystal structure [5], as calculated by the SwissPDB Viewer program (version 3.7). The surfaces of these cavities are lined by residues from both chains (Table 2). Two of these residues are in the 121-126 sequence, Cys123 and Met124. In the A(R)YLLR variants both are replaced by leucine residues, thereby modestly increasing the hydrophobicity of the cavity. Also the computed cavity size (assuming no change in backbone structure or side-chain orientation) increases in the A(R)YLLR variants, expanding from 74 to 104 Å for the cavity next to the B-chain heme, and from 59 to 83 Å for the cavity next to the A-chain heme. The combination of increased cavity size and hydrophobicity is consistent with the enhanced heme displacement propensity of the A(R)YLLR variants, even in the absence of CO binding.
Table 2.
Residues lining the surfaces of CooA cavities adjacent to the hemes (Fig. 5)
| CooA | Heme A | Heme B |
|---|---|---|
| WT | Val54 (A) | Val54 (B) |
| Leu65 (A) | Leu65 (B) | |
| Phe66 (A) | Phe66 (B) | |
| Phe74 (A) | Phe74 (B) | |
| Ser78 (A) | Ser78 (B) | |
| Cys80 (A) | Cys80 (B) | |
| Ala119 (A) | Ala119 (B) | |
| Ser122 (A) | ||
| Cys123 (A) | Cys123 (B) | |
| Leu120 (B) | Leu120 (A) | |
| Met124 (B) | Met124 (A) | |
| AYLLRL | Val54 (A) | Val54 (B) |
| Leu65 (A) | Leu65 (B) | |
| Phe66 (A) | Phe66 (B) | |
| Phe74 (A) | Phe74 (B) | |
| Ser78 (A) | Ser78 (B) | |
| Cys80 (A) | Cys80 (B) | |
| Ala119 (A) | Ala119 (B) | |
| Tyr122 (B) | ||
| Leu123 (A) | Leu123 (B) | |
| Leu120 (B) | Leu120 (A) | |
| Leu124 (B) | Leu124 (A) |
The computed cavity also suggests why heme displacement is restricted (small νFeC/νCO deviations, Figure 3) in the L120S/F variants. The Leu120 side-chain forms a significant part of the hydrophobic cavity surfaces, consistent with the RR evidence for a polar influence on the bound CO in L120S (Fig. 2), and also in L120N [15]. Introduction of a polar group in L120S reduces the hydrophobicity of the cavities, and diminishes the driving force for heme displacement. On the other hand, phenylalanine substitution is expected to occlude the cavities, thereby impeding heme displacement sterically.
In addition to the cavity effects, it is likely that altered contacts within the C-helix coiled-coil contribute to stability of the ‘off’ and ‘on’ conformations. The two Cys123 sidechains are in contact, at the critical ‘d’ position of the heptad repeat; replacement of the Cys by Leu produces an optimal ‘leucine zipper’ contact [16]. On the other hand, the Leu120 sidechains are already in contact at the heptad ‘a’ position, and substitution of Ser or Phe would interfere with this contact.
A caveat to this analysis is that the contacts and cavities computed from the CooA crystal structure cannot accurately represent the coil and heme contacts in the ‘on’ state, because of the modest repositioning of the C-helices, which accompanies the heme displacement. For example the residues Ile113, Leu 116 and Gly117 do not appear on the cavity surfaces (Figure 5, Table 2) yet are indicated by mutational analysis to be in close proximity to the bound CO [10]. This can be rationalized by the fact that the heme is much larger than the cavity and so some residue-heme contacts certainly exist in both the on and off states. Nevertheless, the CooA structure provides a hypothesis for the forces that would impel the protein in its conformational transition.’
Heme Displacement and C-helix Bending
How is heme displacement connected to the C-helix bending that is required for reorientation of the DNA-binding domains? Again, the crystal structure points to a plausible connection (Figure 5). The proximal ligand, His77 is on a strand that is linked to the base of the β4/β5 hairpin loop. Heme displacement would apply tension to this hairpin, tension that is reflected in the observed weakening of the Fe-His77 bond. The tip of the hairpin contacts the hinge region of the C-helix. Thus there is a mechanical link between the heme and the point at which the C-helix bends.
We have no evidence on how this mechanical link may operate, but note that Lanzilotta et al. [5] identified two switch residues in the hinge region, Phe132 and Arg138, which form alternative and complementary contacts in the B-chain of CooA, on the one hand, and in CRP, on the other. In the CooA B-chain, Phe132 contacts the DNA-binding domain, while Arg138 forms a salt bridge with Glu59, in the β4/β5 hairpin loop of the A-chain regulatory domain. However, in CRP, the homologous Phe136 contacts the β4/β5 hairpin loop, while the homologous Arg142 contacts a phosphate in the DNA backbone.
In addition to the Arg138-Glu59 salt-bridge, CooA has a salt-bridge between Arg118 and Asp72 connecting the C-helix with the proximal β-strand (Figure 5). A homologous pair exists in CRP, Arg122 and Asp68, but the salt-bridge is absent in the CRP structure, suggesting that activation breaks this salt-bridge as well. Asp72 is only five residues from His77, and it is reasonable that maintenance of the salt-bridge would be incompatible with heme displacement. By inducing heme displacement and β-strand tension, CO binding might break both salt-bridges.
The β-strand tension model can also explain why binding NO, unlike CO, does not activate DNA binding by CooA [37]. Upon heme displacement the NO trans effect induces the Fe-His77 to break, thereby relieving the tension on the β-strand. Intriguingly, Clark et al. [38] have discovered that NO does activate DNA binding in a CooA homolog from the thermophile Carboxydothermus hydrogenoformans, and that the NO adduct is 6-coordinate, indicating that the Fe-His77 bond is not broken. However, raising the temperature induced bond rupture and produced a 5-coordinate NO-heme (the DNA-binding activity could not be determined at elevated temperature, but would presumably be diminished). Apparently, Fe-His77 bond breaking is prevented by the rigidity of the thermophile protein, despite heme displacement, but is induced at high temperature where the protein is more flexible. Clark et al. found evidence in the absorption spectrum of R. rubrum CooA that lowering the temperature to 4° C induced 6-coordination in a fraction of the NO adducts, supporting the idea that Fe-His77 bond breaking is dependent on protein mobility. Kerby et al. [18] have found that the (A/R)YLLRL variant also forms a 6-coordinate NO adduct. This finding suggests that, in addition to inducing heme displacement, these substitutions diminish protein flexibility in the proximal region of the heme, so that the Fe-His77 bond does not break when NO binds.
CO Binding Produces Comparable ‘on’ and ‘off’ Conformational Energies
The ‘on’ and ‘off’ conformations have similar energies in the CO adduct of CooA. Evidence for this is that the heme is fully displaced in the WT CO adduct only when DNA is added. The νFeC/νCO deviation from the Mb line (Figure 3) is maximal for the A(R)YLLR variants, with or without DNA, and for the WT protein with DNA; but without DNA the WT deviation is at an intermediate value. We infer that the WT CO adduct has roughly comparable populations of ‘on’ and ‘off’ populations, with displaced and undisplaced heme. DNA binding pulls the equilibrium toward the ‘on’ conformation. Alternatively the WT CO adduct may be in an intermediate conformation, with partially displaced heme, perhaps like the A-chain of the CooA crystal structure. This intermediate conformation would be pulled into the ‘on’ conformation by DNA binding. Consistent with both of these postulates is the observation of Kubo et al. [30] that the Trp110 UV-RR response is augmented still further when CooA binds DNA.
The hypothesis of coexisting ‘on’ and ‘off’ populations is consistent with our previous finding [17] of comparable populations of ‘open’ and ‘closed’ molecules having different rates of CO dissociation. The ‘open’ rate was similar to that of MbCO, while the ‘closed’ rate was 10-fold slower. It seems likely that the ‘open’ molecules are in the ‘off’ conformation and have undisplaced heme, while the ‘closed’ molecules are in the ‘on’ conformation and have displaced heme. The movement of the heme into its hydrophobic cavity (Figure 5) could account for the marked slowing in the CO dissociation rate.
The DNA-binding constants (Table 1) support these inferences. Without CO, WT CooA does not bind DNA; it is in the ‘off’ conformation. Once CO binds the affinity is substantial (Kd = 206 nM), but it is significantly higher for the CO adducts of the A(R)YLLRL variants (Kd ~ 50 nM), consistent with their being in a substantially ‘on’ conformation. In the absence of CO, these variants bind DNA with approximately the same affinity as does CO-bound WT CooA. We surmise that heme displacement is significant, but incomplete in the absence of CO because of the restraining effect of the Pro2 ligand, which remains bound to the heme in the main population of the variant molecules (Figure 4). The CO adducts of L120S and L120F have very low DNA affinities, indicating a shift of the energetics toward an ‘off’ conformation, consistent with the small average heme displacements of these variants.
CONCLUSIONS
CooA responds to its effector molecule, CO, by realigning its DNA-binding domains into the correct orientation for recognizing its target DNA sequence. In our model, it does this by displacing the endogenous Pro2 ligand and inducing displacement of the heme into an adjacent hydrophobic cavity. In turn this displacement induces bending of the C-helix at the hinge connecting the regulatory and DNA-domains, by altering contacts between the hinge and the β4/β5 hairpin loop of the regulatory domain (of the opposite subunit). The β4/β5 hairpin loop is connected to the heme via the Fe-His77 bond; heme displacement applies tension to this bond, which is transmitted to the β4/β5 hairpin loop.
The conformational change induced in WT CooA by CO binding is incomplete, and is drawn to completion by DNA binding. Either the energetics are comparable for the ‘on’ and ‘off’ conformations, or else the conformation of the CO adduct is intermediate between them. The former alternative is consistent with biphasic CO dissociation rates, which indicate comparable populations of ‘closed’ and ‘open’ forms. The energetics are biased toward the ‘on’ conformation by replacement of the 121-126 residue C-helix segment, TSCMRT, with the sequence A(R)YLLRL, because the Cys123 and Met124 sidechains form part of the hydrophobic cavity surface, and are replaced by leucine residues, which are more hydrophobic, and enlarge the cavity (and perhaps because they improve the C-helix coiled-coil contacts). The A(R)YLLRL variants are active, even without CO. On the other hand, the L120S/F variants bias the energy toward the ‘off’ conformation, because the Leu120 sidechain also forms part of the cavity surface, and is replaced by a hydrophilic (Ser) or bulky (Phe) residue (and perhaps because these substitutions weaken the coiled-coiled contacts).
The abbreviations used are
- CRP
cAMP receptor protein
- RR
resonance Raman
- WT
wild-type
- MOPS
4-morpholinepropanesulfonic acid
- Mb
myoglobin
- Hb
hemoglobin
Footnotes
This work was supported by National Institute of Health (NIH) grants GM33576 (to T.G.S.) and GM53228 (to G.P.R.). We are grateful to Prof. Thomas Poulos for kindly providing target DNA samples for our study.
References
- 1.Gilles-Gonzalez M, Gonzalez G. J Inorg Biochem. 2005;99:1–22. doi: 10.1016/j.jinorgbio.2004.11.006. [DOI] [PubMed] [Google Scholar]
- 2.Uchida T, Kitagawa T. Acc Chem Res. 2005;38:662–670. doi: 10.1021/ar030267d. [DOI] [PubMed] [Google Scholar]
- 3.Roberts GP, Kerby RL, Youn H, Conrad M. J Inorg Biochem. 2005;99:280–292. doi: 10.1016/j.jinorgbio.2004.10.032. [DOI] [PubMed] [Google Scholar]
- 4.Aono S. Acc Chem Res. 2003;36:825–831. doi: 10.1021/ar020097p. [DOI] [PubMed] [Google Scholar]
- 5.Lanzilotta WN, Schuller DJ, Thorsteinsson MV, Kerby RL, Roberts GP, Poulos TL. Nat Struct Biol. 2000;7:876–880. doi: 10.1038/82820. [DOI] [PubMed] [Google Scholar]
- 6.Weber IT, Steitz TA. J Mol Biol. 1987;198:311–326. doi: 10.1016/0022-2836(87)90315-9. [DOI] [PubMed] [Google Scholar]
- 7.Passner JM, Schultz SC, Steitz TA. J Mol Biol. 2000;304:847–859. doi: 10.1006/jmbi.2000.4231. [DOI] [PubMed] [Google Scholar]
- 8.Parkinson G, Wilson C, Gunasekara A, Ebright Y, Ebright R, Berman H. J Mol Biol. 1996;260:395–408. doi: 10.1006/jmbi.1996.0409. [DOI] [PubMed] [Google Scholar]
- 9.Yamamoto K, Ishikawa H, Takahashi S, Ishimoro K, Morishima I, Nakajima H, Aono S. J Biol Chem. 2001;276:11473–11476. doi: 10.1074/jbc.C100047200. [DOI] [PubMed] [Google Scholar]
- 10.Coyle CM, Puranik M, Youn H, Nielsen SB, Williams RD, Kerby RL, Roberts GP, Spiro TG. J Biol Chem. 2003;278:35384–35393. doi: 10.1074/jbc.M301000200. [DOI] [PubMed] [Google Scholar]
- 11.Thorsteinsson MV, Kerby RL, Youn H, Conrad M, Serate J, Staples CR, Roberts GP. J Biol Chem. 2001;276:26807–26813. doi: 10.1074/jbc.M102758200. [DOI] [PubMed] [Google Scholar]
- 12.Youn H, Kerby RL, Clark RW, Burstyn JN, Roberts GP. J Biol Chem. 2002;277:33616–33623. doi: 10.1074/jbc.M203684200. [DOI] [PubMed] [Google Scholar]
- 13.Thorsteinsson MV, Kerby RL, Roberts GP. Biochemistry. 2000;39:8284–8290. doi: 10.1021/bi000327c. [DOI] [PubMed] [Google Scholar]
- 14.Youn H, Kerby RL, Roberts GP. J Biol Chem. 2003;278:2333–2340. doi: 10.1074/jbc.M210825200. [DOI] [PubMed] [Google Scholar]
- 15.Yamashita T, Hoashi Y, Tomisugi Y, Ishikawa Y, Uno T. J Biol Chem. 2004;279:47320–47325. doi: 10.1074/jbc.M407766200. [DOI] [PubMed] [Google Scholar]
- 16.Kerby RL, Youn H, Thorsteinsson MV, Roberts GP. J Mol Biol. 2003;325:809–823. doi: 10.1016/s0022-2836(02)01203-2. [DOI] [PubMed] [Google Scholar]
- 17.Puranik M, Nielsen SB, Youn H, Hvitved AN, Bourassa JL, Case MA, Tengroth C, Balakrishnan G, Thorsteinsson MV, Groves JT, McLendon GL, Roberts GP, Olson JS, Spiro TG. J Biol Chem. 2004;279:21096–21108. doi: 10.1074/jbc.M400613200. [DOI] [PubMed] [Google Scholar]
- 18.Kerby RL, Lanz ND, Youn H, Roberts GP. J Biol Chem. 2006 submitted for publication. [Google Scholar]
- 19.Uchida T, Ishikawa H, Takahashi S, Ishimori K, Morishima I, Ohkubo K, Nakajima H, Aono S. J Biol Chem. 1998;273:19988–19992. doi: 10.1074/jbc.273.32.19988. [DOI] [PubMed] [Google Scholar]
- 20.Thorsteinsson MV, Kerby RL, Conrad M, Youn H, Staples CR, Lanzilotta WN, Poulos TJ, Serate J, Roberts GP. J Biol Chem. 2000;275:39332–39338. doi: 10.1074/jbc.M007691200. [DOI] [PubMed] [Google Scholar]
- 21.Youn H, Kerby RL, Conrad M, Roberts GP. J Bacteriol. 2004;186:1320–1329. doi: 10.1128/JB.186.5.1320-1329.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Spiro TG, Wasbotten IH. J Inorg Biochem. 2005;99:34–44. doi: 10.1016/j.jinorgbio.2004.09.026. [DOI] [PubMed] [Google Scholar]
- 23.Franzen S. J Am Chem Soc. 2001;123:12578–12589. doi: 10.1021/ja0108988. [DOI] [PubMed] [Google Scholar]
- 24.Youn H, Thorsteinsson MV, Kerby RL, Conrad M, Roberts GP. J Bacteriol. 2005;187:2573–2581. doi: 10.1128/JB.187.8.2573-2581.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Rubtsov IV, Zhang TQ, Nakajima H, Aono S, Rubtsov GI, Kumazaki S, Yoshihara K. J Am Chem Soc. 2001;123:10056–10062. doi: 10.1021/ja011023w. [DOI] [PubMed] [Google Scholar]
- 26.Spiro TG, Li XY. In: Biological Applications of Raman Spectroscopy. Spiro TG, editor. Vol. 3. John Wiley & Sons, Inc.; New York: 1988. pp. 1–38. [Google Scholar]
- 27.Youn H, Kerby RL, Thorsteinsson MV, Conrad M, Staples CR, Serate J, Beack J, Roberts GP. J Biol Chem. 2001;276:41603–41610. doi: 10.1074/jbc.M106165200. [DOI] [PubMed] [Google Scholar]
- 28.Kitagawa T. In: Biological Applications of Raman Spectroscopy. Spiro TG, editor. Vol. 3. John Wiley & Sons, Inc.; New York: 1988. pp. 97–132. [Google Scholar]
- 29.Uchida T, Ishikawa H, Ishimori K, Morishima I, Nakajima H, Aono S, Mizutani Y, Kitagawa T. Biochemistry. 2000;39:12747–12752. doi: 10.1021/bi0011476. [DOI] [PubMed] [Google Scholar]
- 30.Kubo M, Inagaki S, Yoshioka S, Uchida T, Mizutani Y, Aono S, Kitagawa T. J Biol Chem. 2006;281:11271–11278. doi: 10.1074/jbc.M513261200. [DOI] [PubMed] [Google Scholar]
- 31.Smulevich G, Mauro JM, Fishel LA, English AM, Kraut J, Spiro TG. Biochemistry. 1988;27:5477–5485. doi: 10.1021/bi00415a014. [DOI] [PubMed] [Google Scholar]
- 32.Aono S, Ohkubo K, Matsuo T, Nakajima H. J Biol Chem. 1998;273:25757–25764. doi: 10.1074/jbc.273.40.25757. [DOI] [PubMed] [Google Scholar]
- 33.Shelver D, Reynolds MF, Thorsteinsson MV, Kerby RL, Chung S, Parks RL, Burstyn JN, Roberts GP. Biochemistry. 1999;38:2669–2678. doi: 10.1021/bi982658j. [DOI] [PubMed] [Google Scholar]
- 34.Uchida T, Sato E, Sato A, Sagami I, Shimizu T, Kitagawa T. J Biol Chem. 2005;280:21358–21368. doi: 10.1074/jbc.M412350200. [DOI] [PubMed] [Google Scholar]
- 35.Marti MA, Scherlis DA, Doctorovich FA, Ordejon P, Estrin DA. J Biol Inorg Chem. 2003;8:595–600. doi: 10.1007/s00775-003-0452-9. [DOI] [PubMed] [Google Scholar]
- 36.Akiyama S, Fujisawa T, Ishimori K, Morishima I, Aono S. J Mol Biol. 2004;341:651–668. doi: 10.1016/j.jmb.2004.06.040. [DOI] [PubMed] [Google Scholar]
- 37.Reynolds MF, Parks RB, Burstyn JN, Shelver D, Thorsteinsson MV, Kerby RL, Roberts GP, Vogel KM, Spiro TG. Biochemistry. 2000;39:388–396. doi: 10.1021/bi991378g. [DOI] [PubMed] [Google Scholar]
- 38.Clark RW, Lanz ND, Lee AJ, Kerby RL, Roberts GP, Burstyn JN. Proc Natl Acad Sci USA. 2006;103:891–896. doi: 10.1073/pnas.0505919103. [DOI] [PMC free article] [PubMed] [Google Scholar]

