Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Oct 1.
Published in final edited form as: Traffic. 2009 Jul 21;10(10):1502–1517. doi: 10.1111/j.1600-0854.2009.00965.x

The COG complex, Rab6 and COPI define a novel Golgi retrograde trafficking pathway that is exploited by SubAB toxin

Richard D Smith 1, Rose Willett 1, Tetyana Kudlyk 1, Irina Pokrovskaya 1, Adrienne W Paton 2, James C Paton 2, Vladimir V Lupashin 1
PMCID: PMC2756830  NIHMSID: NIHMS139279  PMID: 19678899

Abstract

Toxin trafficking studies provide valuable information about endogenous pathways of intracellular transport. Subtilase cytotoxin (SubAB) is transported in a retrograde fashion through the endosome to the Golgi and then to the ER, where it specifically cleaves the ER chaperone BiP/GRP78. To identify the SubAB Golgi trafficking route, we have used siRNA-mediated silencing and immunofluorescence microscopy in HeLa and Vero cells. Knockdown of subunits of the Conserved Oligomeric Golgi (COG) complex significantly delays SubAB cytotoxicity and blocks SubAB trafficking to the cis-Golgi. Depletion of Rab6 and β-COP proteins causes similar delay in SubAB-mediated GRP78 cleavage and did not augment the trafficking block observed in COG KD cells, indicating that all three Golgi factors operate on the same “fast” retrograde trafficking pathway. SubAB trafficking is completely blocked in cells deficient in the Golgi SNARE Syntaxin5 and does not require the activity of endosomal sorting nexins SNX1 and SNX2. Surprisingly, depletion of Golgi tethers p115 and golgin-84 which regulates two previously described COPI vesicle-mediated pathways did not interfere with SubAB trafficking, indicating that SubAB is exploiting a novel COG/Rab6/COPI-dependent retrograde trafficking pathway.

Keywords: Golgi, SubAB toxin, retrograde traffic, Conserved Oligomeric Golgi complex, coiled-coil tether

INTRODUCTION

Many bacterial and plant toxins often exhibit a structural organization consisting of two fragments, called A and B (1). B subunits of these toxins recognize and bind to specific receptors on the surface of mammalian cells and direct the internalization and trafficking of an enzymatic A subunit. A medically important subset of bacterial toxins, called the AB5 toxins, consists of hexameric assemblies comprising a single catalytically active A-subunit and a pentamer of B-subunits. Subtilase cytotoxin (SubAB) belongs to a new AB5 toxin family that is produced by a strain of Shiga toxigenic Escherichia coli (2). The Catalytic A subunit of SubAB, which shares sequence homology to a subtilase–like serine protease of Bacillus anthracis, specifically cleaves and inactivates the ER lumen-localized chaperone BiP/GRP78 (3). The SubAB-mediated GRP78 cleavage leads to a transient inhibition of protein synthesis, cell cycle arrest and 2 days later to cell death (4). SubAB is the only toxin known to target a lumenal ER protein. The B subunits of SubAB bind to the surface of target cells via glycans displayed on glycoproteins, including beta1 integrin (5). Surprisingly, SubAB has a high degree of binding specificity for glycans terminating with α2,3-linked residues of the non-human sialic acid N-glycolylneuraminic acid (6), and therefore in humans a SubAB receptor is generated by metabolic incorporation of an exogenous factor derived from food. Internalization of SubAB is exclusively clathrin-dependent (7). The other two well-studied AB5 toxins, Shiga toxin and Cholera toxin, are internalized in both a clathrin- and a cholesterol-dependent manner. On the way from the cell surface to the ER all three toxins are passing through the Golgi apparatus, although the exact intra-Golgi retrograde trafficking pathways used by various toxins are not well understood.

Studies of bacterial toxins can provide valuable information about pathways of intracellular transport. Retrograde transport of both Shiga and Cholera toxins to the Golgi and the ER seems to be dependent on different Rab and ARF GTPases, SNAREs and vesicular tethering proteins (8–15). Comparison of different toxins reveals differences indicating the presence of more than one pathway between early endosomes and the ER through the Golgi apparatus (16). Specific SubAB-mediated GRP78 cleavage provides an extremely sensitive and quantitative assay (7) to measure subtilase cytotoxin arrival at the ER in both control cells and in cells deficient in putative components of the Golgi retrograde trafficking machinery. This should allow identification of SubAB intra-Golgi trafficking pathway(s). We have recently found that co-depletion of Rab6 and Conserved Oligomeric Golgi (COG) vesicular tethering factor suppresses the Golgi fragmentation phenotype that is associated with the COG knockdown (KD) (17). This epistatic assay provides the evidence that two proteins act in the same pathway.

In this work we have used both single and double KD strategies to uncover a novel Rab6, COG and COPI-dependent intra-Golgi retrograde trafficking pathway that is exploited by SubAB toxin for fast delivery to the ER.

RESULTS

In both HeLa and Vero cells, Brefeldin A treatment completely blocks SubAB-mediated cleavage of GRP78 (7), indicating that the functional Golgi apparatus is essential for SubAB trafficking from plasma membrane to endoplasmic reticulum (ER). We have previously identified the COG protein complex as an important vesicle tethering component of the intra-Golgi retrograde trafficking machinery that is responsible for the localization of Golgi glycosyltransferases and for retrograde delivery of Shiga toxin B subunit (15, 18). To test the hypothesis that the COG complex is involved in the retrograde trafficking of SubAB toxin, we have utilized a shRNA (short hairpin RNA) strategy to create a stable Cog4p knock-down (Cog4 sKD) HeLa GalNAc T2-GFP cell line. The level of Cog4 protein in Cog4 sKD cells was reduced by more than 85%, as compared to the actin loading control (Figure 1A). Golgi membranes in Cog4 sKD cells appeared to be partially fragmented (Figure 1B) that is consistent with the phenotype previously described for Cog3 siRNA KD cells (15). Both control and Cog4 sKD cells were incubated with purified SubAB toxin (3 µg/ml) for three hours. Kinetics of GRP78 cleavage was used to estimate SubAB trafficking efficiency. In control HeLa cells GRP78 cleavage started at the 60 min time point, with more than 80% of GRP78 cleaved after 120 min of incubation (Figure 1C–D, Control). In sharp contrast, GRP78 cleavage in Cog4 sKD cells was significantly delayed and started 120 min after toxin application (Figure 1C–D, Cog4 KD). Three hours after the start of the assay less than 60% of the GRP78 was cleaved in Cog4 sKD cells indicating that Cog4p is required for the “fast” delivery of the SubAB to the ER. The block in SubAB trafficking in Cog4 sKD cells was not complete and GRP78 was completely cleaved 5 hours after toxin application (data not shown), indicating that in HeLa cells SubAB is also using a Cog4p-independent “slow” delivery pathway. Importantly, the delay in GRP78 cleavage observed in Cog4 sKD cells was not due to the Golgi fragmentation, since a treatment of HeLa cells with Nocodazole, a drug that affects microtubule function and causes severe Golgi fragmentation, demonstrated the SubAB-mediated GRP78 cleavage kinetics were similar to that of the untreated cells (Figure 1D, Nocodazole). Incubation of HeLa cells with labelled cytotoxin at 4°C revealed that the same amount of SubAB binds to mock-treated and Cog4 KD cells (Figure 1E), indicating that COG complex knock-down did not compromise the plasma membrane-localized SubAB receptor(s).

Figure 1. SubAB-mediated GRP78 cleavage is inhibited in stable Cog4 KD HeLa cells.

Figure 1

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with pCog4 shRNA plasmid and maintained in selective puromycin-containing media. One month after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A) or fixed and visualized by fluorescent microscopy (B). Bar, 10 µm. Effect of Cog4 KD on SubAB-induced cleavage of GRP78. Control and Cog4 sKD cells were treated with SubAB (3 µg/ml) and incubated at 37°C for the time indicated. Panel C shows a blot representative of three such experiments. (D) Graph of SubAB-induced GRP78 cleavage for control, Cog4 sKD, and HeLa cells treated with 30 µM Nocodazole for 2 hours prior to toxin application. (E) Binding of SubAB-HF555 to control and Cog4 KD GalNAcT2-GFP HeLa cells. Cells were exposed to SubAB-Hylite 555 toxin for 20 min at 4°C, formalin fixed and viewed by laser confocal microscopy (63x oil objective). Bar, 10 µm.

The COG complex is composed of eight subunits that are grouped into two sub-complexes: Lobe A (Cog1–4) and Lobe B (Cog5–8) (19–21).To check whether other subunits of the COG complex are necessary for the fast intracellular trafficking of SubAB toxin, HeLa cells were transfected with siRNAs that specifically down-regulated biosynthesis of Cog2p, Cog3p, Cog4p, Cog6p and Cog8p. In all cases a significant (96% for COG3 KD, 92% for COG4 KD, 91% for COG6 KD, 88% for COG8 KD) reduction in the protein level of targeted proteins was achieved for all COG subunits as estimated by immunoblot analysis using Odyssey LiCOR System (Figure 2A). Due to a lack of anti-Cog2p antibodies, the efficiency of COG2 knock-down was estimated by RT-PCR (Figure 2B). In all COG KD cells the rate of SubAB-mediated GRP78 cleavage was significantly decreased (Figure 2C), indicating that the entire COG complex is important for a fast SubAB intracellular delivery. Expression of siRNA-resistant mouse Cog3p (15) partially restored a SubAB-mediated GRP78 cleavage in COG3 KD HeLa cells (Figure 2D–E); similar rescue of SubAB trafficking was observed in Cog4KD cells transfected with Cog4-myc siRNA-resistant plasmid and in COG8KD cells transfected with Cog8-myc siRNA-resistant plasmid (Supplementary figure 1). To test for possible synergy between Lobe A and Lobe B subunits in SubAB delivery, GRP78 cleavage in Cog3/Cog6 and Cog3/Cog4 double knock-down cells was analyzed (Figure 2F). The delay in GRP78 cleavage was found to be more significant in double COG subunit KD HeLa cells as compared to a single COG subunit KD cells. It was more pronounced in Cog3/Cog4 KD cells lacking two subunits of the same lobe, indicating that the increased delay in SubAB trafficking was due to more efficient silencing achieved in a double KD procedure, rather than to the synergy between COG complex sub-complexes. Very limited (less than 20%) GRP78 cleavage was observed in COG double KD cells two hours after incubation with toxin, signifying the essential role of the COG complex in a fast PM-Golgi-ER delivery of SubAB toxin. Importantly, we found that at the 180 min incubation time point, up to 20% of GRP78 was cleaved even in the most severe Cog3/Cog4 double KD cells (Figure 2F). SubAB-mediated GRP78 cleavage continued slowly, reaching up to 80% after six hours of incubation (data not shown). This slowly sustained GRP78 cleavage is likely to indicate existence of a secondary “slow” COG complex-independent SubAB delivery pathway in HeLa cells.

Figure 2. Both single and double KD of COG subunits causes similar delay in the SubAB-mediated GRP78 cleavage.

Figure 2

Figure 2

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6 or Cog8. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with indicated antibodies (A). Total RNA was purified from control, Cog2 KD and Cog3 KD cells and the level of Cog2 and Cog3 RNA was estimated by RT-PCR (B). (C) Graph of SubAB-induced GRP78 cleavage for control, Cog2 KD, Cog3 KD, Cog4 KD, Cog6 KD, and Cog8 KD in HeLa cells. (D–E) COG3 siRNA-induced block in SubAB delivery is reversible. GalNAcT2-GFP HeLa cells were transfected with siRNA to human Cog3 or transfected with siRNA to human Cog3 then (24 hour later) transfected with a plasmid encoding mouse Cog3. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS and separated by SDS-PAGE and analyzed by immunoblotting with either the polyclonal Cog3 antibody that recognizes human and mouse Cog3, or with the monoclonal Cog3 only recognize human Cog3 (D). (E) Graph of SubAB-induced cleavage of GRP78 for Cog3 KD cells and for Cog3 KD transfected with siRNA-resistant mouse Cog3. (F) GalNAcT2-GFP HeLa cells were mock-transfected or double-transfected with siRNA to Cog3/Cog4, or Cog3/Cog6. Graph of SubAB-induced GRP78 cleavage for control, Cog3/6 KD, and Cog3/4 KD in HeLa cells.

COG complex deficiency could affect SubAB cytotoxicity either directly, via regulation of retrograde membrane carriers that carry SubAB to ER, or indirectly, by affecting localization and/or expression of SubAB receptors on the cell surface. We have shown previously that the depletion of Cog3p did not block the delivery of both plasma membrane and lysosomal proteins (15, 18). In agreement to this result, the depletion of other COG subunits did not significantly effect the anterograde protein trafficking in HeLA cells (Supplementary figure 2) To visualize SubAB trafficking we have labelled SubAB with HiLyte Fluor 555 (HF555) dye and with Alexa Fluor 647(AF647) and analyzed SubAB-HF555 and SubAB-AF647 intracellular trafficking by the immunofluorescence (IF) approach. Labelling of SubAB with either HiLyte Fluor 555 or Alexa Fluor 647 dyes did not change the kinetics of SubAB-mediated GRP78 cleavage (data not shown); hence SubAB-HF555/AF647 trafficking is likely to be identical to the trafficking of the unlabelled subtilase cytotoxin.

We have initially tried to use SubAB-HF555 in HeLa cells and found that after 60 min and 120 min of incubation, the majority of SubAB-HF555 did not localize with GalNAc-T2-GFP-positive Golgi structures, indicating that in HeLa cells SubAB is being distributed throughout a variety of endocytic compartments (data not shown). As a result, the pattern of SubAB intracellular trafficking in HeLa cells was not interpretable with a straightforward IF approach. This is in agreement with an earlier observation that that in several cell types, including HeLa cells, not more than 5–10% of endocytosed toxin is transported in the direction of the Golgi apparatus (22).

A less complicated intracellular trafficking pattern of SubAB was observed previously in Vero cells (3). In Vero cells significantly lower SubAB initial concentration (0.05 µg/ml) was sufficient to completely cleave GRP78 in 60 min (Figure 3B, control). Vero cells transfected with COG3 siRNA demonstrated substantial down-regulation of Cog3p (Figure 3A). Again, as in the HeLa case, depletion of Cog3p in Vero cells significantly delayed SubAB-mediated GRP78 cleavage (Figure 3B). Incubation of both control and Cog3 KD Vero cells with SubAB-HF555 at 4°C resulted in a comparable binding of labelled toxin to the plasma membrane (Figure 3C–D, 0 min row). Upon incubation at 37°C the SubAB-HF555 was rapidly internalized and in more than 80% of control cells the toxin was mostly located in a perinuclear region where it co-localized with cis-Golgi marker giantin (Figure 3C, 30 min, arrows). This major co-localization of internalized SubAB-HF555 with cis-Golgi was persistent in control Vero cells 60 min after toxin trafficking started (Figure 4C, 60 min). Labelled SubAB toxin was rapidly endocytosed in Cog3 KD Vero cells, however, in a striking contrast with control cells, the majority of internalized cytotoxin was found at the cell periphery at both 30 and 60 min time points (Figure 3D). Less than 15% of Cog3 KD cells demonstrated perinuclear localization of SubAB-HF555. However, even in these cells the perinuclear toxin was not co-localized with the cis-Golgi marker giantin (Figure 3D, 60 min, arrowhead), indicating that COG complex malfunction causes accumulation of internalized cytotoxin in pre-cis-Golgi trafficking intermediates.

Figure 3. Cog3 depletion in Vero cells partially inhibits SubAB cytotoxicity and blocks SubAB-HF555 delivery to cis-Golgi.

Figure 3

Figure 3

Vero cells were mock-transfected or transfected with siRNA to Cog3. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). Control and Cog3 KD cells were exposed to SubAB for the time indicated and SubAB-induced GRP78 cleavage was calculated for each time point (B). Subcellular localization of SubAB-HF555 in control (C) and Cog3 KD (D) Vero cells. Cells were exposed to SubAB-HF555 toxin for 20 min at 4°C and then either immediately fixed (0 min) or incubated for 30 or 60 min at 37°C (B). For immunofluorescence, cells were formalin fixed, permeabilized with Triton X-100, treated with anti-Giantin, and developed using HiLyte-488-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm. Arrows indicate colocalization of giantin and SubAB-HF555 in control cells. Arrow heads show perinuclear area localization of SubAB-HF555 in Cog3KD cells. Bar, 10 µm.

Figure 4. Fluorescently labelled SubAB partially localizes with TGN46-positive compartments in Cog3-depleted cells.

Figure 4

Vero cells were mock-transfected or transfected with siRNA to Cog3. 72 hours after transfection, the cells were treated with 1 µg/ml SubAB HF555 for one hour. Control (A) and Cog3 cells (B) were fixed in 4% paraformaldehyde, permeabilized with Triton X-100, stained with anti-TGN46, anti-EEA1, anti-Rab7, and anti-LAMP2, and developed using HiLyte-488-conjugated-anti-mouse and HiLyte-488-conjugated-anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63X oil objective). Bar, 10 µm. Arrows demonstrate colocalization between TGN46 and SubAB HF555.

To gain more understanding about SubAB-positive pre-cis-Golgi compartments both COG3KD and mock-treated Vero cells were incubated with fluorescently labelled SubAB (SubAB-HF555 and SubAB-AF647) and stained for the markers for both endocytic and secretory pathways (Figure 4). In control cells SubAB upon incubation at for 60 min at 37°C was partially co-localized with trans-Golgi marker TGN46 and did not show any significant co-localization with endosomal-lysosomal compartments. In COG3 KD Vero cells some (~15–20%) of internalized SubAB was co-localized with TGN46 (Figure 4, TGN46 row, arrow), indicating that COG depletion did not block SubAB delivery to TGN/trans-Golgi. No significant co-localization of SubAB was observed with early endosomal protein EEA1 (Figure 4, EEA1 row), late endosomal protein Rab7 (Figure 4, rab7 row) and lysosomal marker Lamp2 (Figure 4, Lamp2 row). We also were unable to find a significant SubAB co-localization with Snx2, Vps26,Rab11 and PDI (Supplementary figure 3 and data not shown). Similar results were obtained for COG8 KD cells (data not shown).

To identify other Golgi proteins that may regulate intracellular trafficking of SubAB, we have analyzed known COG complex-interacting trafficking factors.

We have demonstrated previously that the COG complex is acting downstream of the trans-Golgi-localized Rab6 protein and that the epistatic depletion of Rab6 inhibited the Golgi-disruptive effect of COG inactivation by siRNA or antibodies (17). Here we found that the depletion of Rab6 in HeLa cells affected the kinetics of SubAB-mediated GRP78 cleavage in a manner analogous to COG depletion (Figure 5). Efficient double Rab6/Cog3 KD (Figure 5A) resulted in delay in SubAB delivery similar to that observed in the single Rab6 KD cells (Figure 5B) indicating that both Rab6 and the COG complex operate on the same retrograde pathway of SubAB delivery. Rab6 siRNA was not efficient in Vero cells (data not shown), therefore we tested if the overexpression of GDP-restricted Rab6 mutant would interfere with SubAB trafficking. Vero cells were co-transfected with pCFP and pRab6S21N plasmids and treated with fluorescently-labelled SubAB. We found that in CFP-positive cells internalized SubAB was preferentially co-localized with EEA1 and not with giantin (Figure 5C), indicating that Rab6 malfunction was interfered with the endosome-to-Golgi leg of SubAB retrograde trafficking itinerary.

Figure 5. Rab6 and Rab6/Cog3 depletions as well as overexpression of Rab6-GDP cause similar delays in the SubAB-mediated GRP78 cleavage.

Figure 5

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Rab6 or Rab6/Cog3. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). (B) Graph of SubAB-induced GRP78 cleavage for control, Rab6 KD or Rab6/Cog3 double-KD cells. (C) Vero cells were transfected with pRab6-S21N and 24 hours later treated with 1 µg/ml SubAB-HF555 for 20 min. Toxin was additionally internalized for 60 min, after that cells were fixed in 4% paraformaldehyde, permeabilized with Triton X-100, treated with anti-EEA1 and anti-giantin, and developed using HiLyte-488-conjugated anti-mouse antibodies and HiLyte-647-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm. Arrows indicate colocalization of EEA1 and SubAB.

The COG complex genetically and physically interacts with subunits of COPI vesicular coat that operates in both intra-Golgi and Golgi to ER retrograde membrane trafficking steps (15, 23, 24), and COG and COPI may work in concert to ensure the proper retention and retrieval of a subset of proteins in the Golgi (25). To downregulate β-COP we used a previously characterized siRNA in HeLa cells (26). Efficient (more than 90%) siRNA-mediated depletion of β-COP did not affect the intracellular level of Cog3p (Figure 6A), but caused a significant delay in SubAB-mediated GRP78 cleavage (Figure 6B). Again, double β-COP/Cog3 KD resulted in delay in SubAB delivery similar to that observed in the single β-COP KD cells (Figure 6B), demonstrating that both COPI and COG complexes control the same retrograde SubAB delivery pathway.

Figure 6. β-COP and β-COP/Cog3 knockdowns along with overexpression of Arf1-Q71L cause delays in the SubAB-mediated GRP78 cleavage and block the traffic of SubAB.

Figure 6

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to β-COP or β-COP/Cog3. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). (B) Graph of SubAB-induced GRP78 cleavage for control, β-COP KD or β-COP/Cog3 double-KD cells. (C) Vero cells were transfected with the CFP-Arf1-Q71L plasmid and 24 hours later treated with 1 µg/ml SubAB-HF555 for 20 min. Toxin was additionally internalized for 60 min, after that cells were fixed in 4% paraformaldehyde, permeabilized with Triton X-100, treated with anti-giantin, and developed using HiLyte-647-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm. The asterisk indicates a control cell not transfected with CFP-Arf1-Q71L.

Knock-down of β-COP was in some way detrimental for HeLa cells (only 50% of cells were recovered after 72 of β-COP KD) and resulted in an extensive Golgi fragmentation (data not shown). Therefore we have tested if the less invasive COPI malfunction caused by overexpressioin of GTP-locked mutant for on Arf1(27) would interfere with SubAB trafficking. Vero cells were transfected with pArf1Q71L-CFP plasmid and treated with fluorescently-labelled SubAB. We found that CFP-Arf1Q71L expression blocked fluorescently-labelled SubAB trafficking to Giantin-positive cis-Golgi membranes (Figure 6C), confirming the essential role of COPI in retrograde trafficking of subtilase cytotoxin. As in the case of COG3 KD cells, in Arf1Q71L expressing Vero cells SubAB was trapped in trafficking intermediates that did not co-localize with any tested endocytic markers (data not shown).

The COG complex genetically and physically interacts with a subset of Golgi-operated SNARE molecules (15, 23, 24). In mammalian cells, hCog4p and hCog6p interact with Qa-SNARE Syntaxin5a (28). We have used previously described siRNA (29) to knockdown both long and short isoforms of Syntaxin5 (Figure 7A) and found that SubAB-mediated GRP78 cleavage was almost completely blocked (Figure 7B). Less than 8% of GRP78 was cleaved even after 180 min of incubation of HeLa cells with SubAB toxin, indicating that Syntaxin 5 is required for both fast (COG complex-dependent) and slow (COG complex-independent) intracellular delivery of subtilase cytotoxin. In Syntaxin5 KD Vero cells fluorescently-labelled SubAB failed to co-localize with both cis (Giantin) and trans (P230) Golgi compartments (Figure 7C) and was accumulated in peripherally–located small membrane structures, indicating an early block in retrograde trafficking.

Figure 7. SubAB-mediated GRP78 cleavage is completely blocked in Syntaxin 5 KD cells.

Figure 7

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Syntaxin 5. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with indicated antibodies (A). Note that both long and short isoforms of Syntaxin 5 were depleted, while the non-specific protein band (indicated with an asterisk) was not. (B) Graph of SubAB-induced GRP78 cleavage for control and Syntaxin 5 KD cells. (C) Vero cells were transfected with siRNA to Syntaxin 5. 72 hours later cell were treated with 1 µg/ml SubAB-HF555, fixed in 4% paraformaldehyde, permeabilized with Triton X-100, treated with anti-P230 and anti-giantin, and developed using HiLyte-488-conjugated anti-mouse antibodies and HiLyte-647-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm.

Knock-down of Cog2, Cog3, Cog6,Cog8 and Rab6 resulted in a four-fold increase of potency or Inhibitory Concentration of 50% (IC50) for SubAB in HeLa cells (Table 1 and Supplementary figure 4). More dramatic IC50 increase was detected in β-COP KD cells, while even a significant increase (up to 6 µg/ml) in SubAB concentration applied on Syntaxin5 KD cells has not resulted in any GRP78 cleavage.

TABLE 1. Potency and efficacy of SubAB on control and single KDs in HeLa cells treated for 3 hours.

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6, Cog8, Rab6, Syntaxin 5, β-COP, and Vps26. 72 hours after transfection, the cells were intoxicated with SubAB for 3 hours at 0-, 0.074-, 0.222-, 0.667-, 2-, and 6 µg/ml. Cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE with the GRP78 antibody. Results of GRP78 cleavage by SubAB was calculated using the GraphPad Prism software to demonstrate IC50, r-squared, and Imax values.

IC50 (µg/ml) r-squared Imax (%)
Control 0.153 0.954 80
Cog2 KD 0.788 0.998 79
Cog3 KD 0.579 0.999 66
Cog4 KD 0.388 0.936 33
Cog6 KD 0.645 0.979 70
Cog8 KD 0.656 0.988 63
Rab6 KD 0.739 0.966 62
β-COP KD 3.65 0.897 37
Syntaxin 5 KD >6 No fit 0
Vps26 KD 0.417 0.996 56

It was reported recently that Cog2p physically interacts with another cis-Golgi vesicle-tethering factor p115 (30), and that p115 stimulates formation of Syntaxin 5-containing SNARE complex in vitro (31). In addition, p115/SNARE interaction was shown to be essential for Golgi biogenesis (32). On the other hand, we have shown previously that the epistatic depletion of Rab6 did not inhibit the Golgi-disruptive effect of p115 inactivation by siRNA (17), indicating that Rab6 and p115 operate on independent Golgi trafficking pathways. Here we used the same siRNA–mediated p115 silencing to test for a possible p115 requirement in SubAB trafficking in HeLa cells. P115 KD cells lacked the signal for p115 protein and demonstrated the characteristic Golgi fragmentation phenotype (Figure 8A,C), but rather surprisingly, did not show any inhibition or delay in SubAB-mediated GRP78 cleavage (Figure 8B), indicating that SubAB is delivered to the ER via a p115-independent pathway.

Figure 8. The retrograde traffic of Subtilase cytotoxin is independent of p115 and golgin-84.

Figure 8

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to COG3, p115, or golgin-84. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). A non-specific protein band on a golgin84 blot is indicated with an asterisk. Effect of protein depletion on SubAB-induced cleavage of GRP78. Control, COG3KD, p115 KD and golgin-84 KD cells (B) were treated with SubAB (3 µg/ml) and incubated at 37°C for time indicated. Each lane on the graph is calculated from three independent experiments. (C). GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Golgin84 or p115Cells. 72 hour later cells were fixed and visualized by fluorescent microscopy. Bar, 10 µm.

The Warren lab recently proposed that p115-giantin and golgin-84-CASP Golgi tethers define two distinct sub-populations of COPI vesicles (33). Since p115 was dispensable for the fast COPI-dependent delivery of SubAB through the Golgi stack, we tested golgin-84 involvement in cytotoxin trafficking. Interestingly, golgin-84 KD cells lacked the signal for golgin-84 protein and demonstrated the characteristic Golgi fragmentation phenotype in HeLa cells (Figure 8A, C), but again, as in the case of p115 KD cells, did not show any inhibition or delay in SubAB-mediated GRP78 cleavage (Figure 8B), indicating that SubAB is delivered to the ER via a golgin-84-independent pathway. This data indicate that SubAB is exploiting a novel p115/golgin-84-independent intra-Golgi trafficking pathway. Another possibility is that the small residual amounts of coiled-coil Golgi tethers in p115 KD and golgin 84 KD cells were sufficient to fully support SubAB retrograde delivery.

We have reported previously that Cog3 KD HeLa cells are deficient in retrograde trafficking of Shiga-like toxin B (SLTB) subunit (15). Previous reports suggested that SubAB and SLTB retrograde trafficking pathways are similar, but not identical (7). Indeed we have observed that in Vero cells incubated with both SubAB-HF555 and SLTB-AF647, STBL accumulation in perinuclear Golgi presided the arrival of SubAB to the same area (data not shown). We also found different sensitivity of toxins retrograde trafficking to the level of COG3 knock-down (Figure 9). At the intermediate level of COG3 KD fast delivery of SubAB to Golgi was blocked, while STLB was delivered normally (Figure 9, partial COG3 KD row). In a contrast, cells that maintain a very low level of Cog3p, both SubAB and SLTB were not delivered to the Golgi (Figure 9, COG3 KD).

Figure 9. The retrograde traffic of SubAB is independent of SNX1/2 and partially inhibited in cells depleted for Vps26.

Figure 9

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Snx1, Snx2, both Snx1 and Snx2, and Vps26. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). Effect of protein depletion on SubAB-induced cleavage of GRP78. Control, Snx1 KD, Snx2 KD, Snx1/2 double KD, and Vps26 KD cells (B and C) were treated with SubAB (3 µg/ml) and incubated at 37°C for time indicated. Each lane on the graph is calculated from three independent experiments.

Endosomal-to Golgi trafficking of Shiga toxin is also regulated by Rab6 (9, 34) and by sorting nexins SNX1 and SNX2 (35, 36). Combined depletion of SNX1 and SNX2 in Vero cells gave a total inhibition of Shiga toxin transport to the trans-Golgi network by 80% (36). Having established the requirement for both COG complex and Rab6 in SubAB trafficking, we tested whether SNX1 and/or SNX2 are essential for this process in HeLa cells. siRNA-mediated inhibition was efficient in knocking down SNX1, SNX2 and both SNX1/SNX2 (Figure 10A), but in all cases SubAB-mediated GRP78 cleavage was indistinguishable from control cells (Figure 10B), indicating that SubAB is delivered to the ER via the SNX1/SNX2-independent pathway. Interestingly, we found that the knock-down of another retromer component, Vps26 in HeLa cells (figure 10A) moderately inhibited SubAB-mediated GRP78 cleavage (Figure 10C), indicating that the retromer complex is not completely disposable for SubAB retrograde delivery.

Figure 10. Correct SubAB and SLTB delivery require different Cog3 protein level.

Figure 10

Vero cells were mock-transfected or transfected with siRNA to Cog3. 72 hours after transfection cells were pulse-chased with 1 µg/ml of SLTB-Alexa fluor 647 and SubAB-HiLyte fluor 555 for one hour. Cells were formalin fixed, permeabilized with Triton X-100, treated with anti-Cog3, and developed using HyLite-488-conjugated anti-rabbit antibodies. Samples were viewed by triple-laser confocal microscopy (63x oil objective). Level of Cog3 expression in individual cells (left column) is shown using a rainbow palette. Bar, 10 µm.

DISCUSSION

Analysis of SubAB trafficking in HeLa and Vero cells revealed several key Golgi resident proteins that are indispensable for the efficient delivery of the subtilase cytotoxin to the ER. The COG complex has been previously implicated in the retrograde trafficking of several Golgi enzymes, SNAREs and Shiga toxin B subunit (15, 18, 28). Our experiments revealed that down-regulation of any subunit of the COG complex significantly delayed SubAB delivery to the ER. The delay in SubAB delivery was very similar in cells deficient for either Lobe A (Cog 2, 3 and 4) or Lobe B (Cog6 and 8) of the COG complex, suggesting that the entire COG complex is required for the toxin delivery. The defect in SubAB trafficking was most apparent in cells deficient for two COG subunits, indicating that the residual COG complex activity that remained in cells after the knockdown of any single subunit was still sufficient to support at least some SubAB trafficking. Binding to the cell surface and initial internalization of labelled SubAB was normal in COG-deficient cells, whereas trafficking to cis-Golgi was dramatically inhibited, indicating that the COG complex is required for either intra-Golgi or endosome-to-Golgi trafficking steps. In COG3 KD Vero cells the internalized SubAB did not show any significant co-localization with markers of endosomal/lysosomal pathway indicating a post-endosomal trafficking block. Some SubAB was able to arrive at the perinuclear area and co-localize with TGN46 in Cog3 KD cells, but failed to co-localize with the cis-Golgi marker giantin, indicating an intra-Golgi trafficking defect.

Importantly, COG deficiencies only notably delayed, but did not completely block the SubAB-mediated GRP78 cleavage, indicating the existence of multiple retrograde pathways exploited by SubAB toxin. The incomplete SubAB trafficking block in COG KD cells was actually beneficial to this study, and allowed us to analyze other components of the intra-Golgi trafficking machinery that may work on the same or parallel pathway. Knockdown of either trans-Golgi Rab6 or β-COP delayed SubAB delivery in a manner similar to that observed in COG KD cells, suggesting that these trafficking regulators may work on the same pathway. Block in SubAB delivery to the ER in cells that overexpress either Rab6-GTP or Arf1-GTP further underlined the importance of Rab6 and COPI for SubAB trafficking, Most importantly, simultaneous KD of either Rab6/Cog3 or β-COP/Cog3 did not change the severity of the toxin trafficking block, supporting the notion that the COG complex, Rab6 and COPI regulate the same fast intra-Golgi trafficking pathway exploited by SubAB cytotoxin. This is in good agreement with previously described interactions between the COG and COPI complexes (15, 23–25), as well as with the recently uncovered epistatic interaction between Rab6 and the COG complex (17). SubAB was preferentially accumulated in EEA1-positive endosomal compartment in cells that overexpress Rab6GDP mutant, but not in COG3 KD cells, indicating that Rab6 functions upstream of the COG complex in SubAB retrograde trafficking pathway

It is possible that all SubAB trafficking in normal cells is COG/Rab6/COPI-dependent, but in cells deficient for this major retrograde trafficking pathway, the alternative endosome to ER transport is activated. The induction of routes that are normally nonexistent was observed before in the case of ricin trafficking in cells that express a temperature-sensitive mutant of ε-COP (37). We favour the alternative hypothesis that SubAB toxin normally travels through the Golgi by two separate routes: fast, COG/Rab6/COPI-dependent, and slow, COG/Rab6/COPI-independent. This interpretation is supported by the toxin trafficking results obtained in cells deficient in Qa-SNARE Syntaxin5.

SubAB trafficking block in Syntaxin5 KD cells was similar to a block observed in cells pre-treated with Brefeldin A (data not shown and (7)). In both cases, no GRP78 cleavage was observed after 3 hours of incubation with SubAB, indicating that Brefeldin A treatment and Syntaxin5 KD inhibit both fast and slow routes through the Golgi. Interestingly, that among all COG complex knock-down cells the strongest inhibition of SubAB trafficking was associated with depletion of Cog4p, a Lobe A subunit that directly interacts with Syntaxin5 (28). Syntaxin5 was implicated in both intra-Golgi (38) and early/recycling endosome to the Trans Golgi Network (TGN) (39) retrograde trafficking steps. One possibility is that SubAB is delivered from endosomes to the ER via two distinct mechanisms by exploiting either the fast COG complex-dependent inter-cisternae vesicular trafficking pathway or by hopping on to the slow direct TGN to ER membrane flow (Figure 11). In specific experimental conditions the retrograde transport of Cholera toxin from the plasma membrane to the ER was shown to require the TGN, but not the Golgi complex (40). Existence of the endogenous direct TGN-to-ER trafficking route was also proposed (41). Syntaxin5 KD most likely will eliminate both routes for SubAB delivery.

Figure 11. Model of retrograde transport of Subtilase cytotoxin.

Figure 11

The solid arrows indicate the Rab6/COG complex/COPI-dependent pathway that SubAB traffics through the HeLa cell. The dotted arrow indicates that Syntaxin 5 will completely inhibit both the Rab6/COG complex/COPI-dependent and –independent pathways.

Alternatively, the complete SubAB trafficking block in Syntaxin5 KD cells is associated with the dual role of Syntaxin5 in both anterograde and retrograde trafficking. Indeed, some of the endogenous CD44 and the majority of the model (VSVG-GFP) anterograde cargo proteins were accumulated in the Golgi area in Syntaxin5 KD cells, while both control and COG-deficient HeLa cells correctly delivered both proteins to the plasma membrane (Supplementary figure 2).

Depletion of several Golgi factors (Cog3, Cog4, β-COP and Syntaxin5) in HeLa cells leads to an intense Golgi fragmentation, but the Golgi breakup observed in KD cells seemed to be not linked to the inhibition of SubAB trafficking. Indeed, the trafficking of SubAB to the fragmented Golgi continued in the presence of Nocodazole (7), and the Golgi fragmentation observed in p115 KD and golgin84 KD cells did not interfere with cytotoxin arrival in the ER.

Rather surprisingly we found that SubAB intra-Golgi trafficking does not require two previously described Golgi-localized coiled-coil vesicle tethers p115 and golgin-84. Recent work from Warren lab proposed that p115-giantin and golgin-84-CASP Golgi tethers define two distinct sub-populations of COPI vesicles (33). Since only a sub-fraction of Golgi-derived COPI vesicles was efficiently captured by both tethering pairs, Warren lab suggested that “other tethers should identify other populations, allowing us to map the flow patterns of resident, cargo, and recycling molecules”. Our finding clearly reinforces this prediction, suggesting that SubAB is using a novel p115/golgin84-independent and COG/Rab6/COPI-dependent intra-Golgi trafficking pathway.

The nature of the molecule (or molecules) that carry SubAB through the retrograde Golgi pathways is currently unknown. It could be a SubAB plasma membrane glycoprotein receptor itself, analogous to a lipid-raft ganglioside GM1 that was proposed to carry Cholera toxin all the way from plasma membrane to ER (42). Alternatively, SubAB could use distinct carriers for different trafficking steps “jumping” from one to another in sorting compartments. While the nature of the intracellular SubAB carrier is not known at present, it is clear that SubAB retrograde trafficking is quite distinct from the trafficking of other known AB5 toxins. Both Cholera and Shiga toxin enter target cells via both clathrin-dependent and clathrin-independent mechanisms, while SubAB internalization is strictly clathrin-dependent (7). Unlike Shiga toxin, SubAB trafficking does not require sorting nexins SNX1/SNX2, is more sensitive to COG complex depletion and is dependent on COPI vesicular coat.

The initial characterization of the COG/Rab6/COPI–dependent retrograde pathway may provide a useful framework for better understanding of intra-Golgi trafficking in mammalian cells.

MATERIALS AND METHODS

Reagents and antibodies

Reagents were as follows: Nocodazole (stock solution = 10 mM) (Sigma), Subtilase cytotoxin (1.49 mg/ml) (2), and Shiga-like toxin subunit B prepared as described previously (43). Antibodies used for immunofluorescence microscopy (IF) or western blotting (WB) were purchased through commercial sources, gifts from generous individual investigators, or generated by us. Antibodies (and their dilutions) were as follows: rabbit affinity purified anti-hCog3 (WB 1:10,000 (44), hCog4 (WB 1:1000, this lab), hCog6 (WB 1:1000, this lab), hCog8 (WB 1:1000, this lab), Syntaxin 5 (WB 1:1000, this lab), p115 (IF 1:100 (45)), Rab6 (WB 1:200 (Santa Cruz), Giantin (IF 1:1000 (Covance), TGN46 (IF 1:300; AdB Serotec), Vps26 (WB 1:500; Abcam); mouse monoclonal anti- β-Actin (WB 1:10,000 (Sigma), β-COP (WB 1:500 (Sigma), GAPDH (WB 1:1000 (Santa Cruz), golgin-84 (WB 1:500 (BD Biosciences), Snx1 (WB 1:1000 (BD Biosciences), Snx2 (WB 1:1000 (BD Biosciences), p115 (IF 1:100 (46)), EEA1 (IF 1:200 (BD Biosciences), P230 (IF 1:200 (BD Biosciences), GPP130 (IF 1:1000 (Alexis Biochemicals), LAMP2 (IF 1:100 (Developmental Studies Hybridoma Bank, University of Iowa), Rab7 (IF 1:200 (Cell Signaling Technology), CD44 (IF 1:50; Developmental Studies Hybridoma Bank, University of Iowa), and goat anti-GRP78 (WB goat 1:1000 (Santa Cruz).

Secondary anti-goat-HRP, anti-mouse-HRP, and anti-rabbit-HRP for WB were obtained from Jackson ImmunoResearch Laboratories. IRDye 680 goat anti-rabbit, IRDye 700 goat anti-mouse, and IRDye 800 donkey anti-goat for WB were obtained from LI-COR biosciences. Anti-rabbit HiLyte 488 and anti-rabbit HiLyte 555 for IF were obtained from AnaSpec, Inc.

Cell culture

HeLa cells stably expressing GalNAcT2-GFP were cultured in DMEM/F-12 medium supplemented with 15 mM HEPES, 2.5 mM L-glutamine, 10% FBS, and 0.4 mg/ml G418 sulfate. Additionally, the stable Cog4 KD cell line was cultured in DMEM/F-12 medium supplemented with 15 mM HEPES, 2.5 mM L-glutamine, 10% FBS, and 1.0 µg/ml puromycin. GalNAcT2-GFP HeLa cells is a gift from Dr. Storrie (UAMS, Little Rock, AR).

Vero cells were grown in DMEM/F-12 (50:50) with 15 mM HEPES, 2.5 mM L-glutamine, 10% fetal bovine serum, and 1% antibiotic/antimycotic (100 U/ml penicillin G, 100 g/ml streptomycin, and 0.25 µg/ml amphotericin B). All cell culture media and sera are from Invitrogen (Carlsbad, CA).

shRNA and siRNA-induced knockdowns

To generate a stable knockdown of Cog4, HeLa T2-GFP cells (15) were transfected with the shRNA plasmid (OriGene) (target sequence TGACATCTTGGACCTGAAGTTCTGCATGG) using Lipofectamine 2000 according to a protocol from the manufacturer (Invitrogen). Medium containing 1 µg ml−1 puromycin was used to select for the plasmid. Colonies were chosen according to Cog4 down-regulation as judged by immunoblotting.

Human Cog2 (target sequence: GGGCAGTTGATGAACGAAT), Cog4 (target sequence: GTGCTGAAATCCACCTTTA), Cog6 (target sequence: AGATATGACAAGTCGCCTA), Cog8 (target sequence: GATGATCCCTATTTCCATA), Cog3 (15), Snx1 and Snx2 (47), p115 (32), β-COP (26), Rab6 (17), golgin-84 (33), Vps26 (48) and Syntaxin 5 (49) siRNA duplexes were obtained from Dharmacon and Sigma-Proligo. Transfection was performed using Oligofectamine (Invitrogen) following a protocol recommended by Invitrogen. Two cycles of transfections (100 nM siRNA each) were performed and cells were analyzed 72 hours after the second cycle.

For Vero cells, we used RNAiMAX to transfect Cog3 and Syntaxin 5 siRNA duplexes using a protocol from the supplier (Invitrogen).

Plasmid preparation and transfection

Plasmids for Rab6-GDP (pRab6S21N), CFP-Arf1-Q71L, mouse Cog3 were described previously (9, 15, 50). Mutant (siRNA-resistant) versions of Cog4, and Cog8 were generated by GeneScript (Piscataway, NJ) using plasmids pCOD1-myc and pDOR1-myc(51).

Plasmid transfections were performed with Lipofectamine 2000 (Invitrogen) or with FuGene (Roche) according to the manufacturer’s protocol.

Immunofluorescence microscopy

For IF, cells are grown on 12 mm glass coverslips one day before transfection. 72h after siRNA transfection, cells are fixed and stained with antibodies as previously described (18, 52). In short, cells were fixed in 4% paraformaldehyde (16% stock solution; Electron Microscopy Sciences). Cells were then treated with 1% Triton X-100 for one minute. After that the cells were treated with 50 mM ammonium chloride for 5 min. Cells were washed with PBS and blocked twice for 10 min with 1% BSA, 0.1% saponin in PBS. Cells were stained in primary antibody for 1 hour (1% cold fish gelatin, 0.1% saponin in PBS) at room temperature. Cells were washed four times with PBS and incubated for 30 min with fluorescently tagged secondary antibody (1:400 HiLyte; AnaSpec). After that cells were washed four times with PBS, and rinsed with ddH2O. Cells were mounted on microscope slides using Prolong® Gold antifade reagent (Invitrogen). Cells were imaged with the 63X oil 1.4 numerical aperture (NA) objective of a LSM510 Zeiss Laser inverted microscope outfitted with confocal optics for image acquisition. Image acquisition is controlled with LSM510 software (Release Version 4.0 SP1).

Subtilase cytotoxin assay

Both control and knockdown GalNAcT2-GFP HeLa cells were grown on 12-well culture plates to 70–80% of confluency. Cells were placed in 10% FBS in DMEM/F-12 (50:50) without antibiotics and antimycotics for at least one hour before the assay was performed. The subtilase cytotoxin was diluted in the same medium (without antibiotic) and warmed up to 37°C. The time course is 0-, 30-, 60-, 120-, and 180-min. Cells were incubated with the subtilase cytotoxin for the appropriate times in the 37°C incubator with 5% CO2. Cells were then washed off with PBS and lysed with 2% SDS warmed up to 95°C. 10 µl of cell lysates were loaded on a 12% gel and immunoblotted with anti-GRP78 (Santa Cruz; C-20) antibody. All experiments were performed in triplicates. The blots were scanned and analyzed with an Odyssey Infrared Imaging System (LI-COR, Lincoln, NE).

For Vero cells the concentration of SubAB was changed to 0.05 µg/ml and the incubation was performed in a 32°C incubator.

Fluorescently-labeling of the Subtilase cytotoxin and Shiga-like toxin B

Subtilase cytotoxin was labeled with HiLyte Fluor 555 (Dojindo Laboratories, Rockville, MA) and the Shiga-like Toxin B was labelled with Alexa Fluor 647 (Invitrogen) according to the protocols supplied by the manufacturers.

Reverse Transcriptase – Polymerase Chain Reaction (RT-PCR)

Control, Cog2 KD and Cog3 KD HeLa cells were lysed and homogenized passing five times using a 22-gauge needle. The mRNA from control and COG2 KD cells was isolated using the RNeasy Plus kit (Qiagen) using their protocol. RNA samples were translated to cDNA by using multiscribe reverse transcriptase (Applied Biosystems) in a BioRad MJ Mini Thermal cycler machine. The cDNAs were amplified using 25 cycles of PCR, using Taq DNA polymerase and primers for COG2 and COG3. 10 µl of PCR product was loaded to a 1% agarose gel and imaged with BioRad Quantity One software.

SDS-PAGE and western blotting

SDS-PAGE and WB were performed as described previously (24). The blots were incubated first with primary antibodies, and then with a secondary IgG antibody conjugated with IRDye 680 or IRDye 800 dyes. The blots were scanned and analyzed with an Odyssey Infrared Imaging System (LI-COR, Lincoln, NE). Alternatively, a signal was detected using an enhanced chemiluminescent reagent for HRP from Pierce (Rockford, IL) and quantified using ImageJ software (http://rsb.info.nih.gov/ij/).

Supplementary Material

Supp Mat

Supplementary Figure 1: Rescue of Cog4 KD and Cog8 KD with expression of mutated siRNA-resistant Cog4-myc and Cog8-myc.

GalNAcT2-GFP HeLa cells were transfected with siRNA to Cog4 and Cog8 or 24 hour later transfected with a siRNA resistant Cog4-myc and Cog8-myc plasmids. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS and separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). (B) Graph of SubAB-induced cleavage for human Cog4 KD and human Cog4 KD plus the mutated Cog4. (C) Graph of SubAB-induced cleavage for human Cog8 KD and human Cog8 KD plus the mutated Cog8.

Supplementary Figure 2: Syntaxin 5 but not COG depletion partially inhibits anterograde trafficking of both CD44 and VSVG-GFP

HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6, Cog8 and, Syntaxin 5. 40 hours after siRNA transfection, cells were transfected with VSVG-GFP-ts45 plasmid and incubated at 39°C for 18h to accumulate VGVG-GFP in the ER. Then cells were transferred to 32°C for 3 hours to allow VSVG to fold and transit to the plasma membrane. After that both control and knockdown cells were fixed in 4% paraformaldehyde, stained with CD44 antibody and developed using HiLyte-555-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm.

Supplementary Figure 3: Subtilase cytotoxin does not significantly co-localize with early and sorting endosome markers in control, Cog3 KD, and Syntaxin5 KD cells

Vero cells were mock-transfected or transfected with siRNA to Cog3 and Syntaxin 5. 72 hours after transfection, the cells were intoxicated with fluorescently-labeled SubAB for one hour. Cells were fixed in 4% paraformaldehyde, permeabilized with Triton X-100, and stained against SNX2 or EEA1 antibody. Images were developed using Hylite-488 conjugated anti-mouse antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm.

Supplementary Figure 4: Graph for IC50 of Subtilase cytotoxin on control and single KDs in HeLa cells treated for 3 hours

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6, Cog8, Rab6, Syntaxin 5, β-COP, and Vps26. 72 hours after transfection, the cells were intoxicated with SubAB for 3 hours at 0-, 0.074-, 0.222-, 0.667-, 2-, and 6 µg/ml. Cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE with the GRP78 antibody. Results of GRP78 cleavage by SubAB was calculated using the GraphPad Prism software. Graphs of plots of the various GRP78 cleavages are shown on control and single KDs that delayed the SubAB trafficking.

Acknowledgments

We are thankful to S. Munro, B. Storrie, E. Sztul and others who provided reagents and critical reading of the manuscript. We also would like to thank Paul Prather for entering data in the GraphPad Prism for calculating the IC50 and Imax values. Supported by grants from the NSF (MCB-0645163) and the NIH (1R01GM083144-01A1).

Abbreviation List

COG

conserved oligomeric Golgi complex

KD

knockdown

RT-PCR

Reverse Transcriptase –Polymerase Chain Reaction

SubAB

subtilase cytotoxin

siRNA

short interfering RNA

SNARE

soluble Nethylmaleimide-sensitive fusion protein attachment protein receptor

References

  • 1.Merritt EA, Hol WG. AB5 toxins. Curr Opin Struct Biol. 1995;5(2):165–171. doi: 10.1016/0959-440x(95)80071-9. [DOI] [PubMed] [Google Scholar]
  • 2.Paton AW, Srimanote P, Talbot UM, Wang H, Paton JC. A new family of potent AB(5) cytotoxins produced by Shiga toxigenic Escherichia coli. J Exp Med. 2004;200(1):35–46. doi: 10.1084/jem.20040392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Paton AW, Beddoe T, Thorpe CM, Whisstock JC, Wilce MC, Rossjohn J, Talbot UM, Paton JC. AB5 subtilase cytotoxin inactivates the endoplasmic reticulum chaperone BiP. Nature. 2006;443(7111):548–552. doi: 10.1038/nature05124. [DOI] [PubMed] [Google Scholar]
  • 4.Morinaga N, Yahiro K, Matsuura G, Moss J, Noda M. Subtilase cytotoxin, produced by Shiga-toxigenic Escherichia coli, transiently inhibits protein synthesis of Vero cells via degradation of BiP and induces cell cycle arrest at G1 by downregulation of cyclin D1. Cell Microbiol. 2008;10(4):921–929. doi: 10.1111/j.1462-5822.2007.01094.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yahiro K, Morinaga N, Satoh M, Matsuura G, Tomonaga T, Nomura F, Moss J, Noda M. Identification and characterization of receptors for vacuolating activity of subtilase cytotoxin. Mol Microbiol. 2006;62(2):480–490. doi: 10.1111/j.1365-2958.2006.05379.x. [DOI] [PubMed] [Google Scholar]
  • 6.Byres E, Paton AW, Paton JC, Lofling JC, Smith DF, Wilce MC, Talbot UM, Chong DC, Yu H, Huang S, Chen X, Varki NM, Varki A, Rossjohn J, Beddoe T. Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin. Nature. 2008;456(7222):648–652. doi: 10.1038/nature07428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chong DC, Paton JC, Thorpe CM, Paton AW. Clathrin-dependent trafficking of subtilase cytotoxin, a novel AB5 toxin that targets the endoplasmic reticulum chaperone BiP. Cell Microbiol. 2008;10(3):795–806. doi: 10.1111/j.1462-5822.2007.01085.x. [DOI] [PubMed] [Google Scholar]
  • 8.Amessou M, Fradagrada A, Falguieres T, Lord JM, Smith DC, Roberts LM, Lamaze C, Johannes L. Syntaxin 16 and syntaxin 5 are required for efficient retrograde transport of several exogenous and endogenous cargo proteins. J Cell Sci. 2007;120(Pt 8):1457–1468. doi: 10.1242/jcs.03436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Girod A, Storrie B, Simpson JC, Johannes L, Goud B, Roberts LM, Lord JM, Nilsson T, Pepperkok R. Evidence for a COP-I-independent transport route from the Golgi complex to the endoplasmic reticulum. Nat Cell Biol. 1999;1(7):423–430. doi: 10.1038/15658. [DOI] [PubMed] [Google Scholar]
  • 10.Lieu ZZ, Derby MC, Teasdale RD, Hart C, Gunn P, Gleeson PA. The golgin GCC88 is required for efficient retrograde transport of cargo from the early endosomes to the trans-Golgi network. Mol Biol Cell. 2007;18(12):4979–4991. doi: 10.1091/mbc.E07-06-0622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Majoul I, Sohn K, Wieland FT, Pepperkok R, Pizza M, Hillemann J, Soling HD. KDEL receptor (Erd2p)-mediated retrograde transport of the cholera toxin A subunit from the Golgi involves COPI, p23, and the COOH terminus of Erd2p. J Cell Biol. 1998;143(3):601–612. doi: 10.1083/jcb.143.3.601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Mallard F, Tang BL, Galli T, Tenza D, Saint-Pol A, Yue X, Antony C, Hong W, Goud B, Johannes L. Early/recycling endosomes-to-TGN transport involves two SNARE complexes and a Rab6 isoform. J Cell Biol. 2002;156(4):653–664. doi: 10.1083/jcb.200110081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tai G, Lu L, Wang TL, Tang BL, Goud B, Johannes L, Hong W. Participation of the syntaxin 5/Ykt6/GS28/GS15 SNARE complex in transport from the early/recycling endosome to the trans-Golgi network. Mol Biol Cell. 2004;15(9):4011–4022. doi: 10.1091/mbc.E03-12-0876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang Y, Tai GH, Lu L, Johannes L, Hong WJ, Tang BL. Trans-Golgi network syntaxin 10 functions distinctly from syntaxins 6 and 16. Mol Membr Biol. 2005;22(4):313–325. doi: 10.1080/09687860500143829. [DOI] [PubMed] [Google Scholar]
  • 15.Zolov SN, Lupashin VV. Cog3p depletion blocks vesicle-mediated Golgi retrograde trafficking in HeLa cells. Journal of Cell Biology. 2005;168(5):747–759. doi: 10.1083/jcb.200412003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sandvig K, Spilsberg B, Lauvrak SU, Torgersen ML, Iversen TG, van Deurs B. Pathways followed by protein toxins into cells. Int J Med Microbiol. 2004;293(7–8):483–490. doi: 10.1078/1438-4221-00294. [DOI] [PubMed] [Google Scholar]
  • 17.Sun Y, Shestakova A, Hunt L, Sehgal S, Lupashin V, Storrie B. Rab6 regulates both ZW10/RINT-1 and conserved oligomeric Golgi complex-dependent Golgi trafficking and homeostasis. Mol Biol Cell. 2007;18(10):4129–4142. doi: 10.1091/mbc.E07-01-0080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Shestakova A, Zolov S, Lupashin V. COG complex-mediated recycling of Golgi glycosyltransferases is essential for normal protein glycosylation. Traffic. 2006;7(2):191–204. doi: 10.1111/j.1600-0854.2005.00376.x. [DOI] [PubMed] [Google Scholar]
  • 19.Ungar D, Oka T, Brittle EE, Vasile E, Lupashin VV, Chatterton JE, Heuser JE, Krieger M, Waters MG. Characterization of a mammalian Golgi-localized protein complex, COG, that is required for normal Golgi morphology and function. Journal of Cell Biology. 2002;157(3):405–415. doi: 10.1083/jcb.200202016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fotso P, Koryakina Y, Pavliv O, Tsiomenko AB, Lupashin VV. Cog1p plays a central role in the organization of the yeast conserved oligomeric golgi complex. Journal of Biological Chemistry. 2005;280(30):27613–27623. doi: 10.1074/jbc.M504597200. [DOI] [PubMed] [Google Scholar]
  • 21.Ungar D, Oka T, Vasile E, Krieger M, Hughson FM. Subunit architecture of the conserved oligomeric golgi complex. Journal of Biological Chemistry. 2005;280(38):32729–32735. doi: 10.1074/jbc.M504590200. [DOI] [PubMed] [Google Scholar]
  • 22.Sandvig K, van Deurs B. Membrane traffic exploited by protein toxins. Annu Rev Cell Dev Biol. 2002;18:1–24. doi: 10.1146/annurev.cellbio.18.011502.142107. [DOI] [PubMed] [Google Scholar]
  • 23.Ram RJ, Li B, Kaiser CA. Identification of sec36p, sec37p, and sec38p: components of yeast complex that contains sec34p and sec35p. Mol Biol Cell. 2002;13(5):1484–1500. doi: 10.1091/mbc.01-10-0495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Suvorova ES, Duden R, Lupashin VV. The Sec34/Sec35p complex, a Ypt1p effector required for retrograde intra-Golgi trafficking, interacts with Golgi SNAREs and COPI vesicle coat proteins. Journal of Cell Biology. 2002;157(4):631–643. doi: 10.1083/jcb.200111081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Oka T, Ungar D, Hughson FM, Krieger M. The COG and COPI complexes interact to control the abundance of GEARs, a subset of Golgi integral membrane proteins. Mol Biol Cell. 2004;15(5):2423–2435. doi: 10.1091/mbc.E03-09-0699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Guo Y, Punj V, Sengupta D, Linstedt AD. Coat-Tether Interaction in Golgi Organization. Mol Biol Cell. 2008 doi: 10.1091/mbc.E07-12-1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Teal SB, Hsu VW, Peters PJ, Klausner RD, Donaldson JG. An activating mutation in ARF1 stabilizes coatomer binding to Golgi membranes. J Biol Chem. 1994;269(5):3135–3138. [PubMed] [Google Scholar]
  • 28.Shestakova A, Suvorova E, Pavliv O, Khaidakova G, Lupashin V. Interaction of the conserved oligomeric Golgi complex with t-SNARE Syntaxin5a/Sed5 enhances intra-Golgi SNARE complex stability. J Cell Biol. 2007;179(6):1179–1192. doi: 10.1083/jcb.200705145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Suga K, Hattori H, Saito A, Akagawa K. RNA interference-mediated silencing of the syntaxin 5 gene induces Golgi fragmentation but capable of transporting vesicles. FEBS Lett. 2005;579(20):4226–4234. doi: 10.1016/j.febslet.2005.06.053. [DOI] [PubMed] [Google Scholar]
  • 30.Sohda M, Misumi Y, Yoshimura S, Nakamura N, Fusano T, Ogata S, Sakisaka S, Ikehara Y. The interaction of two tethering factors, p115 and COG complex, is required for Golgi integrity. Traffic. 2007;8(3):270–284. doi: 10.1111/j.1600-0854.2006.00530.x. [DOI] [PubMed] [Google Scholar]
  • 31.Shorter J, Beard MB, Seemann J, Dirac-Svejstrup AB, Warren G. Sequential tethering of Golgins and catalysis of SNAREpin assembly by the vesicle-tethering protein p115. J Cell Biol. 2002;157(1):45–62. doi: 10.1083/jcb.200112127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Puthenveedu MA, Linstedt AD. Gene replacement reveals that p115/SNARE interactions are essential for Golgi biogenesis. Proc Natl Acad Sci U S A. 2004;101(5):1253–1256. doi: 10.1073/pnas.0306373101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Malsam J, Satoh A, Pelletier L, Warren G. Golgin tethers define subpopulations of COPI vesicles. Science. 2005;307(5172):1095–1098. doi: 10.1126/science.1108061. [DOI] [PubMed] [Google Scholar]
  • 34.White J, Johannes L, Mallard F, Girod A, Grill S, Reinsch S, Keller P, Tzschaschel B, Echard A, Goud B, Stelzer EH. Rab6 coordinates a novel Golgi to ER retrograde transport pathway in live cells. J Cell Biol. 1999;147(4):743–760. doi: 10.1083/jcb.147.4.743. [published erratum appears in J Cell Biol 2000 Jan 10;148(1):following table of contents] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bujny MV, Popoff V, Johannes L, Cullen PJ. The retromer component sorting nexin-1 is required for efficient retrograde transport of Shiga toxin from early endosome to the trans Golgi network. J Cell Sci. 2007;120(Pt 12):2010–2021. doi: 10.1242/jcs.003111. [DOI] [PubMed] [Google Scholar]
  • 36.Utskarpen A, Slagsvold HH, Dyve AB, Skanland SS, Sandvig K. SNX1 and SNX2 mediate retrograde transport of Shiga toxin. Biochem Biophys Res Commun. 2007;358(2):566–570. doi: 10.1016/j.bbrc.2007.04.159. [DOI] [PubMed] [Google Scholar]
  • 37.Llorente A, Lauvrak SU, van Deurs B, Sandvig K. Induction of direct endosome to endoplasmic reticulum transport in Chinese hamster ovary (CHO) cells (LdlF) with a temperature-sensitive defect in epsilon-coatomer protein (epsilon-COP) J Biol Chem. 2003;278(37):35850–35855. doi: 10.1074/jbc.M303425200. [DOI] [PubMed] [Google Scholar]
  • 38.Xu Y, Martin S, James DE, Hong W. GS15 forms a SNARE complex with syntaxin 5, GS28, and Ykt6 and is implicated in traffic in the early cisternae of the Golgi apparatus. Mol Biol Cell. 2002;13(10):3493–3507. doi: 10.1091/mbc.E02-01-0004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tai G, Lu L, Wang TL, Tang BL, Goud B, Johannes L, Hong W. Participation of the Syntaxin 5/Ykt6/GS28/GS15 SNARE Complex in Transport from the Early/Recycling Endosome to the TGN. Mol Biol Cell. 2004 doi: 10.1091/mbc.E03-12-0876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Feng Y, Jadhav AP, Rodighiero C, Fujinaga Y, Kirchhausen T, Lencer WI. Retrograde transport of cholera toxin from the plasma membrane to the endoplasmic reticulum requires the trans-Golgi network but not the Golgi apparatus in Exo2-treated cells. EMBO Rep. 2004;5(6):596–601. doi: 10.1038/sj.embor.7400152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sannerud R, Saraste J, Goud B. Retrograde traffic in the biosynthetic-secretory route: pathways and machinery. Curr Opin Cell Biol. 2003;15(4):438–445. doi: 10.1016/s0955-0674(03)00077-2. [DOI] [PubMed] [Google Scholar]
  • 42.Lencer WI, Tsai B. The intracellular voyage of cholera toxin: going retro. Trends Biochem Sci. 2003;28(12):639–645. doi: 10.1016/j.tibs.2003.10.002. [DOI] [PubMed] [Google Scholar]
  • 43.Tarrago-Trani MT, Jiang S, Harich KC, Storrie B. Shiga-like toxin subunit B (SLTB)-enhanced delivery of chlorin e6 (Ce6) improves cell killing. Photochem Photobiol. 2006;82(2):527–537. doi: 10.1562/2005-06-20-RA-583. [DOI] [PubMed] [Google Scholar]
  • 44.Suvorova ES, Kurten RC, Lupashin VV. Identification of a human orthologue of Sec34p as a component of the cis-Golgi vesicle tethering machinery. Journal of Biological Chemistry. 2001;276(25):22810–22818. doi: 10.1074/jbc.M011624200. [DOI] [PubMed] [Google Scholar]
  • 45.Alvarez C, Fujita H, Hubbard A, Sztul E. ER to Golgi transport: Requirement for p115 at a pre-Golgi VTC stage. J Cell Biol. 1999;147(6):1205–1222. doi: 10.1083/jcb.147.6.1205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sapperstein SK, Walter DM, Grosvenor AR, Heuser JE, Waters MG. p115 is a general vesicular transport factor related to the yeast endoplasmic reticulum to Golgi transport factor Uso1p. Proc Natl Acad Sci U S A. 1995;92(2):522–526. doi: 10.1073/pnas.92.2.522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gullapalli A, Garrett TA, Paing MM, Griffin CT, Yang Y, Trejo J. A role for sorting nexin 2 in epidermal growth factor receptor down-regulation: evidence for distinct functions of sorting nexin 1 and 2 in protein trafficking. Mol Biol Cell. 2004;15(5):2143–2155. doi: 10.1091/mbc.E03-09-0711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Popoff V, Mardones GA, Tenza D, Rojas R, Lamaze C, Bonifacino JS, Raposo G, Johannes L. The retromer complex and clathrin define an early endosomal retrograde exit site. J Cell Sci. 2007;120(Pt 12):2022–2031. doi: 10.1242/jcs.003020. [DOI] [PubMed] [Google Scholar]
  • 49.Suga K, Saito A, Tomiyama T, Mori H, Akagawa K. Syntaxin 5 interacts specifically with presenilin holoproteins and affects processing of betaAPP in neuronal cells. J Neurochem. 2005;94(2):425–439. doi: 10.1111/j.1471-4159.2005.03210.x. [DOI] [PubMed] [Google Scholar]
  • 50.Majoul I, Straub M, Hell SW, Duden R, Soling HD. KDEL-cargo regulates interactions between proteins involved in COPI vesicle traffic: measurements in living cells using FRET. Dev Cell. 2001;1(1):139–153. doi: 10.1016/s1534-5807(01)00004-1. [DOI] [PubMed] [Google Scholar]
  • 51.Whyte JR, Munro S. The Sec34/35 Golgi Transport Complex Is Related to the Exocyst, Defining a Family of Complexes Involved in Multiple Steps of Membrane Traffic. Developmental Cell. 2001;1(4):527–537. doi: 10.1016/s1534-5807(01)00063-6. [DOI] [PubMed] [Google Scholar]
  • 52.Jiang S, Storrie B. Cisternal rab proteins regulate Golgi apparatus redistribution in response to hypotonic stress. Mol Biol Cell. 2005;16(5):2586–2596. doi: 10.1091/mbc.E04-10-0861. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Mat

Supplementary Figure 1: Rescue of Cog4 KD and Cog8 KD with expression of mutated siRNA-resistant Cog4-myc and Cog8-myc.

GalNAcT2-GFP HeLa cells were transfected with siRNA to Cog4 and Cog8 or 24 hour later transfected with a siRNA resistant Cog4-myc and Cog8-myc plasmids. 72 hours after transfection, the cells were solubilized in phosphate-buffered saline with 2% SDS and separated by SDS-PAGE and analyzed by immunoblotting with the indicated antibodies (A). (B) Graph of SubAB-induced cleavage for human Cog4 KD and human Cog4 KD plus the mutated Cog4. (C) Graph of SubAB-induced cleavage for human Cog8 KD and human Cog8 KD plus the mutated Cog8.

Supplementary Figure 2: Syntaxin 5 but not COG depletion partially inhibits anterograde trafficking of both CD44 and VSVG-GFP

HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6, Cog8 and, Syntaxin 5. 40 hours after siRNA transfection, cells were transfected with VSVG-GFP-ts45 plasmid and incubated at 39°C for 18h to accumulate VGVG-GFP in the ER. Then cells were transferred to 32°C for 3 hours to allow VSVG to fold and transit to the plasma membrane. After that both control and knockdown cells were fixed in 4% paraformaldehyde, stained with CD44 antibody and developed using HiLyte-555-conjugated anti-rabbit antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm.

Supplementary Figure 3: Subtilase cytotoxin does not significantly co-localize with early and sorting endosome markers in control, Cog3 KD, and Syntaxin5 KD cells

Vero cells were mock-transfected or transfected with siRNA to Cog3 and Syntaxin 5. 72 hours after transfection, the cells were intoxicated with fluorescently-labeled SubAB for one hour. Cells were fixed in 4% paraformaldehyde, permeabilized with Triton X-100, and stained against SNX2 or EEA1 antibody. Images were developed using Hylite-488 conjugated anti-mouse antibodies. Samples were viewed by dual-laser confocal microscopy (63x oil objective). Bar, 10 µm.

Supplementary Figure 4: Graph for IC50 of Subtilase cytotoxin on control and single KDs in HeLa cells treated for 3 hours

GalNAcT2-GFP HeLa cells were mock-transfected or transfected with siRNA to Cog2, Cog3, Cog4, Cog6, Cog8, Rab6, Syntaxin 5, β-COP, and Vps26. 72 hours after transfection, the cells were intoxicated with SubAB for 3 hours at 0-, 0.074-, 0.222-, 0.667-, 2-, and 6 µg/ml. Cells were solubilized in phosphate-buffered saline with 2% SDS, and the lysates were separated by SDS-PAGE with the GRP78 antibody. Results of GRP78 cleavage by SubAB was calculated using the GraphPad Prism software. Graphs of plots of the various GRP78 cleavages are shown on control and single KDs that delayed the SubAB trafficking.

RESOURCES